Primer combination, reagent combination, kit, and application and method for identifying Echinococcus granulosus G1 type and Echinococcus multilocularis

Abstract

The invention relates to the technical field of biology, in particular to a primer combination, a reagent combination, a kit and application and a method for identifying Echinococcus granulosus G1 type and Echinococcus multilocularis. Based on the principle that recombinase polymerase amplification is combined with a lateral flow chromatography test strip, specific primers are designed aiming at mitochondrial genomes of the echinococcus granulosus G1 type and the echinococcus multilocularis, and accurate identification of the echinococcus granulosus G1 type and the echinococcus multilocularis is achieved by optimizing the concentration of related reagents and reaction conditions. The method is high in sensitivity, strong in specificity, high in accuracy and good in repeatability, in addition, the whole detection process is convenient and rapid, only a constant-temperature heating instrument is needed, and other expensive instruments are not needed. According to the present invention, the pathogen detection time is substantially shortened, the equipment conditions required by the detection are reduced, the rapid detection requirements of the Echinococcus granulosus G1 type and the Echinococcus multilocularis on the site or in the grassroots unit are met, and the wide application prospect is provided.

Description

Technical Field

[0001] The present invention relates to the field of detection technology, and in particular to a primer combination, a reagent combination, a kit, and applications and methods thereof in identifying Echinococcus granulosus G1 type and Echinococcus multilocularis. Background Art

[0002] Echinococcus, commonly known as echinococcosis, is a chronic zoonotic parasitic disease caused by the larvae of Echinococcus tapeworms and is one of the 17 neglected tropical diseases proposed by the World Health Organization (WHO). Cystic echinococcosis (CE) caused by Echinococcus granulosus and alveolarechinococcosis (AE) caused by Echinococcus multilocularis are the two main types of the disease, which are widely distributed around the world and pose serious risks to public health and economic development.

[0003] The detection and diagnosis of Echinococcus and Echinococcus disease mainly adopts methods such as etiology, imaging, immunology and molecular biology. Etiological examination is a classic method for the diagnosis of Echinococcus infection or Echinococcus disease. The WHO recommends the "gold standard" of arecoline catharsis and autopsy for the detection of this disease. Although the examination has a high accuracy rate, it is time-consuming and labor-intensive, and there is a possibility that it does not comply with animal protection regulations. The imaging method is more intuitive and reliable for the diagnosis of Echinococcus disease than other methods, and can be used as an ideal choice for the diagnosis of this disease. Although the imaging method is intuitive and effective, it requires large instruments and equipment, is expensive, and has strict operating requirements. The diagnostic value of immunological methods in echinococcosis is mainly reflected in its ability to conduct early diagnosis of the disease and large-scale epidemiological surveys. At present, the most commonly used detection method for echinococcosis is ELISA, which plays a vital role in the early detection of echinococcosis. Although immunological methods have high sensitivity, false positives may occur when antigen-antibody binds. Cross-reactions between echinococcosis (such as Echinococcus granulosus and Echinococcus multilocularis) or other tapeworms (such as Taenia solium) may occur, resulting in reduced specificity and inability to distinguish or identify the type of echinococcosis infection. Among molecular biological techniques, PCR is widely used in the detection of echinococcosis, and it plays an important role in the identification of echinococcosis species and molecular epidemiological surveys, such as nested PCR, real-time quantitative PCR, PCR-RFLP, etc. Although the PCR method has good sensitivity and specificity, it cannot meet the needs of high-efficiency detection because it requires special temperature control equipment and has a long reaction time. Summary of the invention

[0004] In view of this, the present invention provides a primer combination, a reagent combination, a kit, and an application and method for identifying Echinococcus granulosus G1 type and Echinococcus multilocularis. The present invention is based on the principle of recombinase polymerase amplification combined with lateral flow chromatography test strips, and designs specific primers for the mitochondrial genome of Echinococcus granulosus G1 type and Echinococcus multilocularis, thereby achieving accurate identification of Echinococcus granulosus G1 type and Echinococcus multilocularis.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] In a first aspect, the present invention provides a primer combination, the primer combination comprising a first primer combination and a second primer combination;

[0007] The first primer combination is used to identify Echinococcus granulosus G1 type; the second primer combination is used to identify Echinococcus multilocularis;

[0008] The first primer combination has:

[0009] (I), the upstream primer has the nucleotide sequence shown in SEQ ID No. 1; and

[0010] The downstream primer has the nucleotide sequence shown in SEQ ID No. 2;

[0011] (II) A sequence in which one or more nucleotides are substituted, deleted, added and / or replaced based on the nucleotide sequence shown in (I); or

[0012] (III) a nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology to the nucleotide sequence as shown in any one of (I) or (II);

[0013] and / or

[0014] The second primer combination has:

[0015] (I), the upstream primer has the nucleotide sequence shown in SEQ ID No. 3; and

[0016] The downstream primer has the nucleotide sequence shown in SEQ ID No.4;

[0017] (II) A sequence in which one or more nucleotides are substituted, deleted, added and / or replaced based on the nucleotide sequence shown in (I); or

[0018] (III) A nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology to the nucleotide sequence shown in any one of (I) or (II).

[0019] In some specific embodiments of the present invention, the 5' end of the nucleotide sequence of the primer combination is modified with a chemical group;

[0020] The chemical group includes any one of Biotin, FAM fluorescent group, Digoxin and TAMRA fluorescent group;

[0021] The 5' end of the nucleotide sequence of the upstream primer of the first primer combination is modified by the biotin;

[0022] The 5' end of the nucleotide sequence of the downstream primer of the first primer combination is modified by the FAM fluorescent group;

[0023] The 5' end of the nucleotide sequence of the upstream primer of the second primer combination is modified by the Digoxin;

[0024] The 5' end of the nucleotide sequence of the downstream primer of the second primer combination is modified by the TAMRA fluorescent group.

[0025] In a second aspect, the present invention also provides the use of the primer combination in preparing a reagent or a kit for identifying Echinococcus granulosus G1 type and / or Echinococcus multilocularis.

[0026] In a third aspect, the present invention also provides a reagent combination, including the primer combination.

[0027] In some specific embodiments of the present invention, the reagent combination further comprises a reaction buffer, a standard positive control, a standard negative control, a starter and RPA lyophilized powder;

[0028] The reaction buffer includes a rehydration buffer (TwistDx nfo Kit, Cambridge, United Kingdom);

[0029] The standard positive control includes Echinococcus granulosus G1 type DNA and Echinococcus multilocularis DNA;

[0030] The standard negative control includes nucleic acid-free ddH2O;

[0031] The starter includes magnesium acetate; the concentration of magnesium acetate is 280 mmol / L;

[0032] The RPA lyophilized powder is a commercially available product (from the TwistAmpTM Basic kit);

[0033] The concentration of the upstream primer of the first primer combination is 10 μmol / L;

[0034] The concentration of the downstream primer of the first primer combination is 10 μmol / L;

[0035] The concentration of the upstream primer of the second primer combination is 10 μmol / L;

[0036] The concentration of the downstream primer of the second primer combination is 10 μmol / L;

[0037] The concentration of the genomic DNA of Echinococcus granulosus G1 type is 50 ng / μL;

[0038] The concentration of the genomic DNA of Echinococcus multilocularis is 50 ng / μL.

[0039] In some specific embodiments of the present invention, the reagent combination includes the following components in 50 μL:

[0040] 30 μL of the reaction buffer;

[0041] 2.4 μL of the genomic DNA of the Echinococcus granulosus G1 type or the Echinococcus multilocularis;

[0042] 1.4 μL of the upstream primer in the first primer combination;

[0043] 1.4 μL of the downstream primer in the first primer combination;

[0044] 1.0 μL of the upstream primer in the second primer combination;

[0045] 1.0 μL of the downstream primer in the second primer combination;

[0046] 9.8 μL of ddH2O;

[0047] The initiator was 3 μL.

[0048] In a fourth aspect, the present invention also provides a kit, comprising the primer combination or the reagent combination.

[0049] In a fifth aspect, the present invention further provides the use of any of the following items in identifying Echinococcus granulosus G1 type and / or Echinococcus multilocularis:

[0050] (i), the primer combination; and / or

[0051] (ii), the reagent combination; and / or

[0052] (iii) the kit.

[0053] In a sixth aspect, the present invention also provides a method for identifying Echinococcus granulosus G1 type and / or Echinococcus multilocularis, extracting genomic DNA of the sample to be tested, amplifying, detecting, and determining the result by any of the following methods;

[0054] (i), the primer combination; and / or

[0055] (ii), the reagent combination; and / or

[0056] (iii) the kit.

[0057] In some specific embodiments of the present invention, the amplification temperature is 38°C and the amplification time is 20 min;

[0058] The determination result is:

[0059] If the quality control line and any test line are colored at the same time, it is determined to be positive, that is, the sample to be tested contains the Echinococcus granulosus G1 type DNA and / or the Echinococcus multilocularis DNA;

[0060] If the control line is colored but the detection line is not colored, it is determined to be negative, that is, the sample to be tested does not contain the Echinococcus granulosus G1 type DNA and / or the Echinococcus multilocularis DNA;

[0061] If the quality control line does not show color, the experiment is judged to be invalid and the test results are invalid.

[0062] In some specific embodiments of the present invention, the method comprises the steps of:

[0063] Step 1, extracting DNA: extracting the genomic DNA of the sample to be tested in the reagent;

[0064] Step 2: Prepare the reaction system: Premix the following solutions in 50 μL:

[0065] 30 μL of the reaction buffer in the reagent;

[0066] 2.4 μL of the genomic DNA of the Echinococcus granulosus G1 type or the Echinococcus multilocularis;

[0067] 1.4 μL of the Echinococcus granulosus G1 upstream primer in the first primer combination;

[0068] 1.4 μL of the Echinococcus granulosus G1 type downstream primer in the first primer combination;

[0069] 1.0 μL of the Echinococcus multilocularis upstream primer in the second primer combination;

[0070] 1.0 μL of the Echinococcus multilocularis downstream primer in the second primer combination;

[0071] 9.8 μL of the ddH2O in the reagent.

[0072] After premixing, add the RPA lyophilized powder in the reagent to the reaction tube, and after fully dissolving, add 3 μL of the starter in the reagent to obtain a prepared reaction system;

[0073] Step 3, amplification: performing constant temperature amplification on the prepared reaction system to obtain an amplified product;

[0074] Step 4, detection: diluting the amplified product with a buffer solution, and dripping it onto the sample pad of the lateral flow chromatography test strip, and letting it stand;

[0075] Step 5, determining the result: after standing, observing the lateral flow chromatography test strip, if the quality control line and any detection line are colored at the same time, it is determined to be positive, that is, the sample to be tested contains the Echinococcus granulosus G1 type DNA and / or the Echinococcus multilocularis DNA; if the quality control line is colored but the detection line is not colored, it is determined to be negative, that is, the sample to be tested does not contain the Echinococcus granulosus G1 type DNA and / or the Echinococcus multilocularis DNA; if the quality control line is not colored, it is determined that the experiment is not established and the test result is invalid.

[0076] In some specific embodiments of the present invention, the sample to be tested includes but is not limited to dog feces or forage grass.

[0077] In some specific embodiments of the present invention, the buffer in step 4 includes but is not limited to PBST buffer; the dilution factor includes but is not limited to 50 times; and the added volume includes but is not limited to 40 μL.

[0078] In some specific embodiments of the present invention, the standing time in step 4 is 5 min.

[0079] The present invention provides primers, reagents, kits and applications for identifying Echinococcus granulosus G1 type and Echinococcus multilocularis. The present invention finds the unique sequences of Echinococcus granulosus G1 type and Echinococcus multilocularis respectively through sequence comparison, and uses the two unique sequences as primer candidate regions, designs multiple RPA primers, performs PCR experiments with the designed primers, uses DNA extracted from the worm body as template DNA for amplification reaction, and the reaction system includes template DNA, primers, dNTPs, Taq DNA polymerase, buffer, etc. The reaction procedure is 95°C pre-denaturation for 5 min, followed by 30 cycles of denaturation, annealing, and extension, and finally 72°C extension for 7 min. The PCR amplification product is detected by agarose gel electrophoresis to observe the size and specificity of the amplification product. It was observed that one set of primers for Eg showed a single clear band and had no cross-reactivity with Em, and subsequent specific experiments also showed no cross-reactivity with other parasites; one set of primers for Em showed a single clear band and had no cross-reactivity with Eg, and subsequent specific experiments also showed no cross-reactivity with other parasites. Then, a set of primers with strong specificity and high sensitivity that can quickly and effectively detect the genomic DNA of Echinococcus granulosus G1 type and Echinococcus multilocularis were screened out, and a dual RPA-LFD detection method was established by modifying the primers. The present invention provides an effective technical means for the rapid visual detection of Echinococcus granulosus G1 type and Echinococcus multilocularis, overcoming the problem that some grassroots testing laboratories are unable to conduct on-site testing due to backward equipment. The primers and probes designed by the present invention have strong specificity, can be used for the accurate diagnosis of Echinococcus granulosus G1 type and Echinococcus multilocularis, and have no cross-reaction with other types of parasites; they have high sensitivity, and the minimum nucleic acid detection limit is 10 2 copies / μL. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0081] Figure 1 The figure shows the PCR screening results of Echinococcus granulosus G1 type; wherein, M: DNA Marker; F1R1~F7R7: using the primers F1R1~F7R7 to amplify Echinococcus granulosus G1 type DNA, Echinococcus multilocularis DNA and ddH2O in sequence;

[0082] Figure 2 The figure shows the result of PCR screening of Echinococcus multilocularis; wherein, M: DNA Marker; F1R1~F5R5: using the primers of F1R1~F5R5 to amplify Echinococcus granulosus G1 type DNA, Echinococcus multilocularis DNA and ddH2O in sequence;

[0083] Figure 3The specific analysis of PCR results of specific primers for Echinococcus granulosus G1 type and Echinococcus multilocularis is shown; where M: DNA Marker; 1-13: 1, Echinococcus granulosus; 2, Echinococcus multilocularis; 3, Taenia lemborrhei; 4, Taenia multicephala; 5, Taenia asiatica; 6, Taenia saginata; 7, Fasciola hepatica; 8, Cryptosporidium; 9, Mesorchis orientalis; 10, Clonorchis sinensis; 11, Toxoplasma gondii; 12, Cysticercus; 13, negative control;

[0084] Figure 4 The specific analysis of RPA results of specific primers for Echinococcus granulosus G1 type and Echinococcus multilocularis is shown; where M: DNA Marker; 1-13: 1, Echinococcus granulosus; 2, Echinococcus multilocularis; 3, Taenia lemborrhei; 4, Taenia multicephala; 5, Taenia asiatica; 6, Taenia saginata; 7, Fasciola hepatica; 8, Cryptosporidium; 9, Mesorchis orientalis; 10, Clonorchis sinensis; 11, Toxoplasma gondii; 12, Cysticercus; 13, negative control;

[0085] Figure 5 Schematic diagram showing the condition optimization of the dual RPA-LFD of the present invention; wherein T1 is the detection line of Echinococcus granulosus G1 type; T2 is the detection line of Echinococcus multilocularis; C is the quality control line;

[0086] The upper left corner shows a schematic diagram of the optimization of reaction temperature conditions; from left to right, they are 34°C, 36°C, 38°C, 40°C, and 42°C;

[0087] The upper right corner shows the schematic diagram of reaction time optimization conditions; from left to right, they are 16 min, 18 min, 20 min, 22 min, and 24 min;

[0088] The lower left corner shows the schematic diagram of primer ratio optimization conditions; from left to right, the ratios of Echinococcus granulosus G1 primers / Echinococcus multilocularis primers are 1.6 / 0.8, 1.4 / 1.0, 1.2 / 1.2, 1.0 / 1.4, and 0.8 / 1.6;

[0089] The lower right corner shows the schematic diagram of sample dilution optimization conditions; from left to right, the sample is diluted 25 times, 50 times, 100 times, and 200 times;

[0090] Figure 6 Schematic diagram of determination of double RPA-LFD test results of the present invention; wherein T1 is the detection line of Echinococcus granulosus G1 type; T2 is the detection line of Echinococcus multilocularis; C is the quality control line; from left to right are schematic diagrams of positive results; schematic diagrams of negative results; schematic diagrams of invalid results; the right figure is the actual detection situation corresponding to the left figure;

[0091] Figure 7The double RPA-LFD specificity analysis of the present invention is shown; wherein, T1 is the G1 type detection line of Echinococcus granulosus; T2 is the detection line of Echinococcus multilocularis; C is the quality control line; from left to right: Echinococcus granulosus + Echinococcus multilocularis; Echinococcus granulosus; Echinococcus multilocularis; Taenia vesicularis; Taenia multicephala; Taenia asiatica; Taenia saginata; Fasciola hepatica; Cryptosporidium; Mesorchida orientalis; Clonorchis sinensis; Toxoplasma gondii; Cysticercus; NC (NC is a negative control);

[0092] Figure 8 The sensitivity analysis of the dual RPA-LFD of the present invention is shown; wherein T1 is the detection line of Echinococcus granulosus G1 type; T2 is the detection line of Echinococcus multilocularis; C is the quality control line; from left to right, the concentrations are 10 8 ~10 1 copies / μL, NC (NC is the negative control). DETAILED DESCRIPTION

[0093] The present invention discloses primer combinations, reagent combinations, kits, and applications and methods for identifying Echinococcus granulosus G1 type and Echinococcus multilocularis. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0094] Recombinase polymerase amplification combined with lateral flow chromatography test strips (RPA-LFD) is an isothermal DNA amplification technology that mainly relies on recombinase, single-stranded binding protein (SSB), and DNA polymerase to amplify the target gene at a constant temperature. This method can complete the amplification of the target gene within 20 minutes. Compared with the traditional PCR method, the entire process does not require high-temperature denaturation and low-temperature annealing steps. It is simple to operate and takes a short time. It has been widely used in the diagnosis of viruses, bacteria, and parasites. In addition, the RPA amplification product can be further combined with test strips and other detection equipment to easily read the test results, making endpoint analysis more flexible, achieving accurate, rapid, and visual detection goals, and overcoming the problem that some grassroots testing laboratories cannot conduct on-site testing due to backward equipment.

[0095] The first object of the present invention is to provide a specific primer and a detection kit thereof for identifying Echinococcus granulosus G1 type and Echinococcus multilocularis based on dual RPA-LFD.

[0096] The second object of the present invention is to provide the application of the above detection kit.

[0097] The present invention is achieved through the following technical solutions:

[0098] 1. Recombinase polymerase isothermal amplification primers for detecting and identifying Echinococcus granulosus G1 type and Echinococcus multilocularis based on dual RPA-LFD, the primers include:

[0099] Upstream primer of Echinococcus granulosus G1 type: Eg-T1-F: 5'-Biotin-TTTTTTGAGAAGTTTGTTTATGTATGTT-3'

[0100] Echinococcus granulosus G1 type downstream primer: Eg-T1-R: 5'-FAM-CCACGAGACCAAGGATACCCAAAACCCA-3'

[0101] Echinococcus multilocularis upstream primer: Em-T2-F: 5'-Digoxin-CGGCGTCGCCTAAGCGGCTTGACCCTTT-3'

[0102] Echinococcus multilocularis downstream primer: Em-T2-R: 5′-TAMRA-TTAATTTATCTTGACTATTCCATTTTCT-3′;

[0103] Among them, the molecular formula of Biotin is C 10 H 16 N2O3S; the molecular formula of FAM is C 27 H 18 N2O8; the molecular formula of Digoxin is C 41 H 64 O 14 ;The molecular formula of TAMRA is C 31 H 28 N4O6.

[0104] 2. Design and preparation method of the above-mentioned specific primers. The design method includes the following steps: obtaining the mitochondrial genome sequence of the family Echinococcus published in Genbank; using MEGA X software to compare and analyze the sequences, and selecting the unique sequences of Echinococcus granulosus G1 type and Echinococcus multilocularis as candidate primers; using primer explorer V5 online software (http: / / primerexplorer.jp / e / ) to screen RPA primers. The preparation method is as follows: the upstream primer of Echinococcus granulosus G1 type is modified by Biotin at the 5' end in the primer sequence of TTTTTTGAGAAGTTTGTTTATGTATGTT, and the downstream primer of Echinococcus granulosus G1 type is modified by FAM fluorescent group at the 5' end in the primer sequence of CCACGAGACCAAGGATACCCAAAACCCA; the upstream primer of Echinococcus multilocularis is modified by Digoxin at the 5' end in the primer sequence of CGGCGTCGCCTAAGCGGCTTGACCCTTT, and the downstream primer of Echinococcus multilocularis is modified by TAMRA fluorescent group at the 5' end in the primer sequence of TTAATTTATCTTGACTATTCCATTTTCT.

[0105] 3. The components of the above-mentioned detection kit for identifying Echinococcus granulosus G1 and Echinococcus multilocularis include: RPA lyophilized powder, 280 mmol / L magnesium acetate, reaction buffer using rehydration buffer (TwistDx nfoKit, Cambridge, United Kingdom), standard positive control, and standard negative control. The standard positive control is Echinococcus granulosus G1 and Echinococcus multilocularis genomic DNA (50 ng / μL), and the standard negative control is nucleic acid-free ddH2O.

[0106] 4. Application of the above-mentioned test kit for detecting and identifying Echinococcus granulosus G1 type and Echinococcus multilocularis. The samples to be tested (such as dog feces, forage grass) are treated with lysis solutions such as guanidine hydrochloride to extract genomic DNA, and amplified using the test kit for identifying Echinococcus granulosus G1 type and Echinococcus multilocularis.

[0107] Amplification reaction system 50 μL: 30 μL reaction buffer, 2.4 μL genomic DNA of the sample to be tested, 1.4 μL of 10 μmol / L Echinococcus granulosus G1 type upstream primer, 1.4 μL of 10 μmol / L Echinococcus granulosus G1 type downstream primer, 1.0 μL of 10 μmol / L Echinococcus multilocularis upstream primer, 1.0 μL of 10 μmol / L Echinococcus multilocularis downstream primer, 9.8 μL ddH2O, 3 μL 280 mmol / L magnesium acetate.

[0108] Amplification reaction conditions: 38°C constant temperature amplification for 20 min. RPA can complete target gene amplification at a constant temperature of about 38°C. The entire process does not require high-temperature denaturation and low-temperature annealing steps, and does not require expensive instruments and equipment (such as PCR instruments, etc.), overcoming the problem that some grassroots testing points cannot conduct on-site testing due to backward equipment.

[0109] The judgment result is as follows Figure 3 When the quality control line and any test line are colored at the same time, it is judged as positive, and the sample contains Echinococcus granulosus G1 type or Echinococcus multilocularis genomic DNA; when the quality control line is colored and the test line is not colored, it is judged as negative, and the sample does not contain Echinococcus granulosus G1 type and Echinococcus multilocularis genomic DNA; if the quality control line is not colored, it is judged that the experiment is not established and the test result is invalid.

[0110] The technical effect of adopting the above scheme: Compared with the prior art, the primers disclosed in the present invention are primers obtained by selecting the unique gene sequences of Echinococcus granulosus G1 type and Echinococcus multilocularis after comparison and analysis with the mitochondrial genome of Echinococcus tapeworm family. The detection effect is specific, sensitive and efficient, and the operation is simple: the enzymes and reagents required for amplification are placed in a separate reaction tube in the form of powder, which can be placed at room temperature. During amplification, only the corresponding buffer, primers, template and initiator need to be added to start the reaction. The requirements for operators are low, and it is suitable for on-site screening at grassroots detection points. The detection kit is fast, efficient, reproducible and accurate. Compared with traditional methods, it does not require expensive instruments, has a short amplification time, and can achieve accurate identification and identification of Echinococcus granulosus G1 type and Echinococcus multilocularis pathogens. Most grass-roots units use PCR for testing. Compared with PCR, this method does not require additional variable temperature instruments and personnel training, saving costs. Compared with the 1.5h~2h detection time of PCR, this method can complete the detection in 0.5h at isothermal temperature, meeting the requirements of rapid on-site detection.

[0111] The comparison with other methods is shown in Table 1:

[0112] Table 1 Comparison results of various methods

[0113]

[0114] The primers, reagents, and kit for identifying Echinococcus granulosus G1 type and Echinococcus multilocularis provided by the invention, and the raw materials and reagents used in their application can all be purchased from the market.

[0115] The present invention will be further described below in conjunction with embodiments:

[0116] Example 1

[0117] Design method of specific primers for RPA of Echinococcus granulosus G1 and Echinococcus multilocularis

[0118] The complete mitochondrial genome sequences of Echinococcus published in GenBank were obtained (GenBank accession numbers: AB018440.2, AB208064.1, AB208545.1, AB208546.1, AB208063.1, AB235846.1, AB786665.1, AB732958.1, MH300929.1, MH300955.1, MK774655.1). The sequences were aligned and analyzed using MEGA Ⅹ software, and the unique sequences of Echinococcus granulosus G1 (eg) and Echinococcus multilocularis (em) were selected as candidate primers. Primers were screened using primer explorer V5 online software (http: / / primerexplorer.jp / e / ). A total of 7 pairs of primers were designed for Echinococcus granulosus G1, with Eg DNA, Em DNA and ddH2O were used as templates for PCR experiments, and the results were as follows: Figure 1 As shown, only the Eg in the F7R7 group had amplified bands without mixed bands and no cross-reactivity with Em. Subsequent specific experiments also showed no cross-reactivity with other parasites. Five pairs of primers were designed for Echinococcus multilocularis. PCR experiments were performed using Eg DNA, Em DNA, and ddH2O as templates, respectively. The results are shown in Figure 1. Figure 2 As shown, only the Em in the F5R5 group had an amplified band without any mixed bands and no cross-reactivity with Eg. Subsequent specific experiments also showed no cross-reactivity with other parasites.

[0119] The primers initially screened were used for PCR specificity experiments. The TIANGEN blood / cell / tissue genomic DNA extraction kit (DP304) was used to extract the genomic DNA of Echinococcus granulosus G1 type, Echinococcus multilocularis, Taenia solium, Taenia multiceps, Taenia asiatica, Taenia saginata, Fasciola hepatica, Cryptosporidium, Mesorchida orientalis, Clonorchis sinensis, Toxoplasma gondii, and Cysticercus spp. (the above parasites were all from the laboratory of the applicant of the present invention) and ddH2O as template DNA for PCR amplification reaction. The reaction system included template DNA, primers, dNTPs, Taq DNA polymerase, buffer, etc. The reaction procedure was pre-denaturation at 95°C for 5 min, followed by 30 cycles of denaturation, annealing, and extension, and finally extension at 72°C for 7 min. The PCR amplification products were detected by agarose gel electrophoresis to observe the size and specificity of the amplified products. The results are shown in the figure. Figure 3As shown, it was observed that primer F7R7 only had a single clear band in the eg group, indicating no cross-reactivity with other parasites; it was observed that Em primer F5R5 only had a single clear band in the em group, indicating no cross-reactivity with other parasites. Subsequently, the RPA specificity experiment was performed, and the reactants were added according to the above system for RPA amplification, and the amplification was carried out at 38°C for 20 min. The RPA amplification product was detected by agarose gel electrophoresis to observe the size and specificity of the amplification product. The results are shown in Figure 4 As shown in the figure, primer F7R7 was observed to have only a single clear band in the eg group, indicating no cross-reactivity with other parasites; Em primer F5R5 was observed to have only a single clear band in the em group, indicating no cross-reactivity with other parasites. Both indicate that the primers have a certain degree of conservatism and strong specificity.

[0120] The screened upstream and downstream primers for Echinococcus granulosus G1 type are EG-T1-F / R, and the screened upstream and downstream primers for Echinococcus multilocularis are EM-T1-F / R, respectively. The primer sequences are shown in Table 2.

[0121] Table 2 RPA primer sequences for Echinococcus granulosus G1 and Echinococcus multilocularis designed by the present invention

[0122]

[0123] Example 2

[0124] Specific primer preparation method based on dual RPA-LFD

[0125] The upstream primer of Echinococcus granulosus G1 type was obtained by modifying the 5' end of the RPA primer sequence TTTTTTGAGAAGTTTGTTTATGTATGTT with Biotin, and the downstream primer of Echinococcus granulosus G1 type was obtained by modifying the 5' end of the RPA primer sequence CCACGAGACCAAGGATACCCAAAACCCA with FAM fluorescent group; the upstream primer of Echinococcus multilocularis was obtained by modifying the 5' end of the RPA primer sequence CGGCGTCGCCTAAGCGGCTTGACCCTTT with Digoxin, and the downstream primer of Echinococcus multilocularis was obtained by modifying the 5' end of the RPA primer sequence TTAATTTATCTTGACTATTCCATTTTCT with TAMRA fluorescent group. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0126] Among them, the molecular formula of Biotin is C 10 H 16 N2O3S, the chemical formula is shown in formula Ⅰ;

[0127] Formula I

[0128] The molecular formula of FAM is C 21 H 12 O7, the chemical formula is shown in formula II;

[0129] Formula II

[0130] The molecular formula of Digoxin is C 41 H 64 O 14 , the chemical formula is shown in Formula III;

[0131] Formula III

[0132] The molecular formula of TAMRA is C 25 H 22 N2O5, chemical formula is shown in formula IV;

[0133] Formula IV

[0134] Example 3

[0135] Establishment of dual RPA-LFD detection method

[0136] 1. Experimental steps

[0137] 1. Extraction of parasite genome: The Echinococcus granulosus G1 type and Echinococcus multilocularis strains used in the present invention were preserved in the applicant's laboratory. Genomic DNA was extracted using the TIANamp Genomic DNA Kit produced by TIANGEN, dissolved in TE, and stored at -20°C.

[0138] 2. Establishment of RPA-LFD reaction system and optimization of conditions

[0139] The basic reaction system was 50 μL and included: 30 μL rehydration buffer (TwistDxnfo Kit, Cambridge, United Kingdom), 2.4 μL genomic DNA of the sample to be tested, 1.2 μL of 10 μmol / L Echinococcus granulosus G1 type upstream primer, 1.2 μL of 10 μmol / L Echinococcus granulosus G1 type downstream primer, 1.2 μL of 10 μmol / L Echinococcus multilocularis upstream primer, 1.2 μL of 10 μmol / L Echinococcus multilocularis downstream primer, 9.8 μL ddH2O, and 3 μL of 280 mmol / L magnesium acetate.

[0140] (1) Optimization of primer ratio in RPA-LFD-2 reaction system:

[0141] Primer ratio: Echinococcus granulosus G1 primer: Echinococcus multilocularis primer

[0142] 1.6 / 0.8 1.6μL each of upstream and downstream primers 0.8μL each of upstream and downstream primers

[0143] 1.4 / 1.0 1.4μL each of upstream and downstream primers 1.0μL each of upstream and downstream primers

[0144] 1.2 / 1.2 1.2μL each of upstream and downstream primers 1.2μL each of upstream and downstream primers

[0145] 1.0 / 1.4 1.0 μL each of upstream and downstream primers 1.4 μL each of upstream and downstream primers

[0146] 0.8 / 1.6 Upstream and downstream primers 0.8μL each Upstream and downstream primers 1.6μL each

[0147] Keeping other conditions in the basic reaction system unchanged, perform RPA amplification reaction with different primer ratios. After the reaction is completed, dilute the amplification product 50 times with PBST, draw 40 μL and drop it on the sample pad, let it stand at room temperature for 5 min, and then observe the color development results of the test strip. Figure 5 As shown in the figure, the primer ratio combination with the most obvious color development effect was selected, and 1.4 Echinococcus granulosus G1 type primers / 1.0 Echinococcus multilocularis primers were the best primer ratio combination.

[0148] (2) Optimization of RPA amplification temperature of RPA-LFD-2 reaction system:

[0149] Keeping other conditions in the reaction system the same, perform RPA amplification reaction at 34°C, 36°C, 38°C, 40°C, and 42°C. After the reaction, dilute the amplification product 50 times with PBST, pipette 40 μL and drop it on the sample pad, let it stand at room temperature for 5 min, and then observe the color development results of the test strip. The results are as follows Figure 5 As shown, the temperature with the most obvious color development effect was selected, and 38°C was the optimal reaction temperature.

[0150] (3) Optimization of RPA reaction time of RPA-LFD-2 reaction system:

[0151] Keeping other conditions in the reaction system the same, the RPA amplification reaction was performed for 16 min, 18 min, 20 min, 22 min, and 24 min, respectively. After the reaction, the amplification product was diluted 50 times with PBST, 40 μL was aspirated and dropped onto the sample pad, and the color development results of the test strip were observed after standing at room temperature for 5 min. The results are shown in Figure 5 As shown in the figure, the time that consumes less time and has obvious color development effect is selected, and 20 min is the best reaction time.

[0152] (4) Optimization of sample dilution multiples in the RPA-LFD-2 reaction system:

[0153] Perform RPA amplification reaction according to the reaction system. After the reaction is completed, dilute the amplification product 25 times, 50 times, 100 times, and 200 times with PBST, draw 40 μL and drop it on the sample pad on the test strip, let it stand at room temperature for 5 minutes, and then observe the color development results of the test strip. The results are as follows Figure 5 As shown in the figure, the sample dilution factor with obvious color development effect was selected, and 50 times was the best sample dilution factor.

[0154] The optimized total reaction system was 50 μL: 30 μL rehydration buffer (TwistDxnfo Kit, Cambridge, United Kingdom), 2.4 μL genomic DNA of the sample to be tested, 1.4 μL 10 μmol / L Echinococcus granulosus G1 type upstream primer, 1.4 μL 10 μmol / L Echinococcus granulosus G1 type downstream primer, 1.0 μL 10 μmol / L Echinococcus multilocularis upstream primer, 1.0 μL 10 μmol / L Echinococcus multilocularis downstream primer, 9.8 μL ddH2O, and 3 μL 280 mmol / L magnesium acetate.

[0155] 47 μL of reaction reagents except the initiator were premixed and added to a separate reaction tube containing RPA lyophilized powder (RPA reaction kit TwistAmpTM Basic kit). After fully dissolved, 3 μL of initiator was added. The reaction temperature for RPA amplification was 38°C, the reaction time was 20 min, and the loading dilution was 50 times.

[0156] 3. Detection of RPA amplification products

[0157] The lateral flow chromatography test strip (Tiosbio dual-label nucleic acid detection test strip (JY209)) used in the present invention includes a sample pad, a chromatography pad, and a water-absorbing pad in the bottom plate in the chromatography direction of the sample detection, dried at 37°C for 2-3 h, and sealed for storage. The amplification product was diluted 50 times with PBST buffer, 40 μL was drawn and dropped on the sample pad, and the result was determined for 5 min. The determination result was as follows: Figure 6 When the quality control line and any test line are colored at the same time, it is judged as positive, and the sample contains Echinococcus granulosus G1 type or Echinococcus multilocularis genomic DNA; when the quality control line is colored and the test line is not colored, it is judged as negative, and the sample does not contain Echinococcus granulosus G1 type and Echinococcus multilocularis genomic DNA; if the quality control line is not colored, it is judged that the experiment is not established and the test result is invalid.

[0158] 2. Specificity Detection

[0159] The TIANGEN blood / cell / tissue genomic DNA extraction kit (DP304) was used to extract the genomic DNA of Echinococcus granulosus G1 type, Echinococcus multilocularis, Taenia solium, Taenia multiceps, Taenia asiatica, Taenia saginata, Fasciola hepatica, Cryptosporidium, Orientia orientalis, Clonorchis sinensis, Toxoplasma gondii, and Cysticercus taeniasis, and ddH2O was used as a template (the above parasites were all from the laboratory of the applicant of the present invention). The reactants were added according to the above system for RPA detection, and the amplification was carried out at a constant temperature of 38°C for 20 min. After the amplification, the amplified product was diluted 50 times with PBST, 40 μL was drawn and dropped on the sample pad, and the result was determined within 5 minutes. The results are as follows Figure 7 As shown, only the genomic DNA of Echinococcus granulosus G1 type and Echinococcus multilocularis could be amplified well, and the test strips were positive, while the others were negative, indicating that this method has a certain degree of conservatism and strong specificity for detecting Echinococcus granulosus G1 type and Echinococcus multilocularis.

[0160] 3. Sensitivity test

[0161] The genomic DNA of Echinococcus granulosus G1 and Echinococcus multilocularis were isolated according to 10 8 ~10 1 The samples were diluted 10 times with PBST, and 40 μL was added to the sample pad. The results were determined within 5 minutes. Figure 8 As shown, when the genomic DNA concentration was 10 2 When the concentration was 10 copies / μL, a positive signal could still be seen on the detection line. 1 There was no positive signal on the detection line when the detection limit was 10 copies / μL, indicating that the minimum detection limit of nucleic acid in the present invention was 10 2 copies / μL.

[0162] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer combination, characterized in that: The primer combination includes a first primer combination and a second primer combination; the first primer combination is used to identify Echinococcus granulosus G1 type; the second primer combination is used to identify Echinococcus multilocularis; The upstream primer of the first primer combination has a nucleotide sequence as shown in SEQ ID No.1, and the downstream primer has a nucleotide sequence as shown in SEQ ID No.2; The upstream primer of the second primer combination has a nucleotide sequence as shown in SEQ ID No.3, and the downstream primer has a nucleotide sequence as shown in SEQ ID No.

4.

2. The primer combination according to claim 1, characterized in that The 5' end of the nucleotide sequence of the primer combination is modified by a chemical group; the chemical group includes any one of Biotin, FAM fluorescent group, Digoxin and TAMRA fluorescent group; the 5' end of the nucleotide sequence of the upstream primer of the first primer combination is modified by the Biotin; the 5' end of the nucleotide sequence of the downstream primer of the first primer combination is modified by the FAM fluorescent group; the 5' end of the nucleotide sequence of the upstream primer of the second primer combination is modified by the Digoxin; the 5' end of the nucleotide sequence of the downstream primer of the second primer combination is modified by the TAMRA fluorescent group.

3. Use of the primer combination according to claim 1 or 2 in preparing a reagent or a kit for identifying Echinococcus granulosus G1 type and / or Echinococcus multilocularis.

4. A reagent combination, characterized in that Comprising the primer combination as described in claim 1 or 2.

5. The reagent combination according to claim 4, characterized in that The reagent combination also includes a reaction buffer, a standard positive control, a standard negative control, a starter and RPA lyophilized powder; The reaction buffer comprises a hydrolysis buffer; the standard positive control comprises Echinococcus granulosus G1 type DNA and Echinococcus multilocularis DNA; the standard negative control comprises nucleic acid-free ddH2O; the initiator comprises magnesium acetate; the concentration of the magnesium acetate is 280 mmol / L; the concentration of the upstream primer of the first primer combination is 10 μmol / L; the concentration of the downstream primer of the first primer combination is 10 μmol / L; the concentration of the upstream primer of the second primer combination is 10 μmol / L; the concentration of the downstream primer of the second primer combination is 10 μmol / L; the concentration of the genomic DNA of Echinococcus granulosus G1 type is 50 ng / μL; the concentration of the genomic DNA of Echinococcus multilocularis is 50 ng / μL.

6. The reagent combination according to claim 5, characterized in that 50 μL includes the following components: 30 μL of the reaction buffer; 2.4 μL of the genomic DNA of the Echinococcus granulosus G1 type or the Echinococcus multilocularis; 1.4 μL of the upstream primer in the first primer combination; 1.4 μL of the downstream primer in the first primer combination; 1.0 μL of the upstream primer in the second primer combination; 1.0 μL of the downstream primer in the second primer combination; 9.8 μL of ddH2O; The initiator was 3 μL.

7. A kit, characterized in that It comprises the primer combination as claimed in claim 1 or 2 or the reagent combination as claimed in any one of claims 4 to 6.

8. Use of the kit according to claim 7 in identifying Echinococcus granulosus G1 type and / or Echinococcus multilocularis.

9. A method for identifying Echinococcus granulosus G1 type and / or Echinococcus multilocularis, characterized in that: The genomic DNA of the sample to be tested is extracted, amplified by the primer combination as described in claim 1 or 2, tested, and the result is determined.

10. The method according to claim 9, characterized in that The amplification temperature is 38°C and the amplification time is 20 min; The determination result is: if the quality control line and any detection line are colored at the same time, it is determined to be positive, that is, the sample to be tested contains the Echinococcus granulosus G1 type DNA and / or the Echinococcus multilocularis DNA; if the quality control line is colored but the detection line is not colored, it is determined to be negative, that is, the sample to be tested does not contain the Echinococcus granulosus G1 type DNA and / or the Echinococcus multilocularis DNA; If the quality control line does not show color, the experiment is judged to be invalid and the test results are invalid.

Images