Application of group of SSR (Simple Sequence Repeat) primers of Oryza meyeriana in evaluating Oryza meyeriana resources

Abstract

The invention belongs to the technical field of molecular markers, and particularly discloses application of a group of oryza meyeriana SSR primers in evaluation of oryza meyeriana resources. The oryza meyeriana SSR primer disclosed by the invention is beneficial to evaluating the genetic diversity of oryza meyeriana resources on the molecular level, developing SSR genetic typing, and being beneficial to objectively evaluating the oryza meyeriana resources in Hainan and Yunnan province, and provides data reference for mining and utilizing excellent germplasm resources of oryza meyeriana.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to the application of a group of Oryza melongena SSR primers in evaluating Oryza melongena resources. Background Art

[0002] In China, Oryza versicolor ( O. meyeriana Baill.) is mainly distributed in Yunnan, Hainan and Taiwan. Oryza sativa has strong resistance to diseases and pests (especially resistance to bacterial leaf blight, sheath blight and rice blast), strong temperature sensitivity, weak photosensitivity, and strong drought tolerance. At present, the resources of Oryza sativa are sharply reduced. Oryza sativa belongs to the GG genome, is strictly self-pollinating, and is distantly related to cultivated rice (AA genome). It cannot be bred by conventional hybridization, but its sterile materials are abundant. Most of the existing populations are under moderate and severe external interference. Oryza sativa has many problems such as unclear reproductive characteristics and genetic integrity, difficult safe preservation of seed stems, and low seed preservation vitality, all of which affect the safe, effective and permanent preservation of wild rice. In addition, as a close relative of cultivated rice, the genome information of Oryza sativa is still unclear, and its potential utilization value has not been developed and utilized in rice breeding.

[0003] At present, it is urgent to effectively preserve resources through the collection and protection of germplasm resources, and to discover beneficial genes and create new germplasm through modern biology and genomics technologies. Summary of the invention

[0004] The present invention aims at the protection and utilization of Oryza granulata resources, and aims to provide a group of Oryza granulata SSR primers for use in evaluating Oryza granulata resources to solve the above technical problems.

[0005] One aspect of the present invention relates to the application of a set of Oryza granatum SSR primers in the evaluation of Oryza granatum resources, the primer sequences are one or more primer sequences among SEQ ID NO:1-SEQ ID NO:48, the GC content of the primers is between 50-60%, the length is between 18-23 bp, and the annealing temperature is between 57-63°C.

[0006] Preferably, the O. verruca was collected from Hainan Province and / or Yunnan Province.

[0007] Preferably, the collection location of the tuberculata wild rice is Changjiang Li Autonomous County, Hainan Province, Dongfang City, Hainan Province, Wuzhishan City, Hainan Province, Ledong Li Autonomous County, Hainan Province, Sanya City, Hainan Province, Dongfang City, Hainan Province, Ledong Li Autonomous County, Hainan Province, Baoting Li and Miao Autonomous County, Hainan Province or Lincang City, Yunnan Province.

[0008] Preferably, the collection site of the tuberculous wild rice is Wangxia Township, Changjiang Li Autonomous County, Hainan Province, Banqiao Town, Dongfang City, Hainan Province, Tuolei Village, Tian'an Township, Dongfang City, Hainan Province, Watongwan Village, Tian'an Township, Dongfang City, Hainan Province, Wen Village, Tian'an Township, Dongfang City, Hainan Province, Changhao Township, Wuzhishan City, Hainan Province, Jianfengling Nature Reserve, Ledong Li Autonomous County, Hainan Province, Luhuitou Scenic Area, Jiyang District, Sanya City, Hainan Province, Gancheng Town, Dongfang City, Hainan Province, Liguo Town, Ledong Li Autonomous County, Hainan Province, Jianfengling Nature Reserve, Ledong Li Autonomous County, Hainan Province, Baocheng Town, Baoting Li and Miao Autonomous County, Hainan Province or Cangyuan County, Lincang City, Yunnan Province.

[0009] The present invention aims at the protection and utilization of Oryza granatum resources. Based on the SSR primers developed from the genome resequencing data of Oryza granatum in Hainan and Yunnan, SSR-seq detection is performed on Oryza granatum resources, the genetic diversity of Oryza granatum resources is evaluated at the molecular level, and SSR genotyping is carried out, which can objectively evaluate the Oryza granatum resources collected from Hainan Province or Yunnan Province, and provide data reference for the mining and utilization of excellent germplasm resources of Oryza granatum. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 The UPGMA clustering results of 13 populations are as follows: HN12: Baoting Baocheng; HN1: Changjiang; HN9: Dongfang; HN2: Dongfang Banqiao; HN3: Dongfang Tuolei; HN5: Dongfang Wencun; HN4: Dongfang Watongwan; HM7: Ledong Jianfengling; HN11: Ledong Jianfengling; HN10: Ledong Liguo; HN8: Sanya Luhuitou; HN6: Wuzhishan Changhao; YN: Yunnan.

[0011] Figure 2 K value variation diagram drawn for the ΔK method of structure analysis.

[0012] Figure 3 These are the principal coordinate analysis results for 201 samples, including: HN12: Baoting Baocheng; HN1: Changjiang; HN9: Dongfang; HN2: Dongfang Banqiao; HN3: Dongfang Tuolei; HN5: Dongfang Wencun; HN4: Dongfang Watongwan; HM7: Ledong Jianfengling; HN11: Ledong Jianfengling; HN10: Ledong Liguo; HN8: Sanya Luhuitou; HN6: Wuzhishan Changhao; YN: Yunnan. DETAILED DESCRIPTION

[0013] The following is further described in detail through specific implementation methods: 1. Experimental Materials A total of 201 samples of Oryza ovata ( O. meyerianaBaill.) materials, and the young leaves were collected in August 2023 for DNA extraction. The 201 samples of Myrtillogetona ovata materials involved 13 populations, including 12 populations in Hainan and 1 population in Yunnan, where Myrtillogetona ovata is naturally distributed. Specific sampling information is shown in Table 1.

[0014] Table 1: Detailed information of population materials

[0015] 2. Experimental methods and results 2.1 SSR locus development and primer design A total of 201 Oryza verruca accessions were resequenced. After DNA samples were built, they were sequenced on HiSeq2000 with a sequencing depth of >20× and clean reads were obtained.

[0016] The simple repeat sequence identification software MISA (MIcroSAtellite identification tool) was used to analyze the whole-genome SSR site information, and then the whole-genome SSR differential site information was obtained by comprehensive comparison. Subsequently, single-copy gene analysis and comprehensive SSR differential site analysis were performed, analysis was performed based on the number of bases of the SSR marker repeat unit, and primers were designed and developed based on the conserved sequences at both ends.

[0017] By analyzing the obtained whole genome data, a total of 50108 SSR loci were identified, including 0 mononucleotide loci, 28890 dinucleotide loci, 15079 trinucleotide loci, 1078 tetranucleotide loci, 173 pentanucleotide loci, 137 hexanucleotide loci, and 4751 complex loci, accounting for 0%, 57.66%, 30.09%, 2.15%, 0.35%, 0.27%, and 9.48%, respectively. The specific experimental results are shown in Table 2.

[0018] Table 2: Distribution of SSR loci with different repeat motifs in the whole genome of Oryza granulosa

[0019] For the SSR loci identified above, the present invention randomly selected 198 SSR loci with a repeat base of 3 sequences, designed primers, and synthesized primers. Then, PCR detection was performed on one Oryza granatum germplasm resource, and it was found that 190 pairs of primers could be effectively amplified. The 190 pairs of primers were further used in 8 Oryza granatum germplasm resources from different geographical origins, and 24 pairs of SSR primers with good amplification effects were screened out (Table 3).

[0020] Primer design: Primer 3 software was used to design forward and reverse amplification primers according to the primer design principles. The GC content of the primers was between 50-60%, the length was about 18-23 bp, and the annealing temperature was between 57-63°C, with 58°C being the best. The 3' terminal base was avoided to be A during design, as well as the generation of potential secondary structures. The fluorescent primer sequences to be synthesized were selected and synthesized by Hainan Times Biotechnology Co., Ltd.

[0021] Table 3: 24 pairs of primer sequences and extended information

[0022] SEQ ID NO: 1: GACAATGCCACTGCTGAAA.

[0023] SEQ ID NO:2: GCGTGGAACTGAACAAGACG.

[0024] SEQ ID NO: 3: GTCGAGGTTGACGAGGAAGG.

[0025] SEQ ID NO: 4: TCGTCCCTCTCCACTTCCTC.

[0026] SEQ ID NO:5:TCCCTGCAATTCGAGCTGTT.

[0027] SEQ ID NO:6: GCGTAAAGCGAGATGGCAAG.

[0028] SEQ ID NO:7: TGTGATATCGCACGAGCTCC.

[0029] SEQ ID NO:8: TGACGAACAAGACCGACCAG.

[0030] SEQ ID NO:9: ATCACCGCCATGTCCACTTT.

[0031] SEQ ID NO: 10: TCAAGAAGGCGGCCAAAGAT.

[0032] SEQ ID NO: 11: GGTACGACGCCCAAAGATGT.

[0033] SEQ ID NO: 12: TCATCTCCCTCCTCGACCTC.

[0034] SEQ ID NO: 13: AAACGAGTCAGCTCAGCTCC.

[0035] SEQ ID NO:14:TGGGGTTTGATGCTCTCGAC。

[0036] SEQ ID NO:15:CGCTGTTGCTTCCAGATTCG。

[0037] SEQ ID NO:16:GCGCCTCAATTGACGATTCC。

[0038] SEQ ID NO:17:GCCACGCTATCTCGCTAGTT。

[0039] SEQ ID NO:18:AACGAGCTAGGAGAGGAGCA。

[0040] SEQ ID NO:19:ACTGGCGGAGATTGGAACAG。

[0041] SEQ ID NO:20:CAAGTGCAAATTGCCCACGA。

[0042] SEQ ID NO:21:CACAAGTAGAGTGTGGCCGT。

[0043] SEQ ID NO:22:AAACCGGGCCATGTGTTTTC。

[0044] SEQ ID NO:23:TCCACGGAGATGTGCTTAGC。

[0045] SEQ ID NO:24:AGCCAAATGTCCTCAAGGCT。

[0046] SEQ ID NO:25:TCCGCCTTCCATTGATTGCT。

[0047] SEQ ID NO:26:AGCGGGCTTTCCAAATTTGC。

[0048] SEQ ID NO:27:GCCTACTGTCGCTCACCTTT。

[0049] SEQ ID NO:28:ATCGGGCATATGAGAGCGTG。

[0050] SEQ ID NO:29:ATCCACTCTCTTCCTCCGCT。

[0051] SEQ ID NO:30:GGAAATGGGGGAAAGGGGAG。

[0052] SEQ ID NO:31:GCCCACTGCAGTTTCTTCAC。

[0053] SEQ ID NO:32:ACCAATGCCATGTTTCACGC。

[0054] SEQ ID NO:33:GCTGCTCGGCCTCTAAATCT。

[0055] SEQ ID NO:34:GCGTAGTTTCCGTGACGAGA。

[0056] SEQ ID NO:35:TATCTGGATTCGGTCGCGTG。

[0057] SEQ ID NO:36:AACGGCCGGATGTAAGTTGT。

[0058] SEQ ID NO:37:CCGCGAGAGTTGCTCCTAAT。

[0059] SEQ ID NO:38:GGTGGGTTTTTGGGATGCAT。

[0060] SEQ ID NO:39:TTTGCGTCACGGAGGATCAT。

[0061] SEQ ID NO:40:CACGTACGAGAGAGAGCGAC。

[0062] SEQ ID NO:41:GCCCTTCCGGTCATCAGATC。

[0063] SEQ ID NO:42:GACGAGCCCTTCTCAAAGCT。

[0064] SEQ ID NO:43:GAGATGTCTTGCGAGCCCAT。

[0065] SEQ ID NO:44:GCGGATCATCGTACTACGCA。

[0066] SEQ ID NO:45:GTCAGAGGCAGGGTTTCTCC。

[0067] SEQ ID NO:46:ATCAATTGTCCCCCTGCACC。

[0068] SEQ ID NO:47: GCAGGCAAATGATCCGCAAT.

[0069] SEQ ID NO:48: AACCTGATGTGTGCACTGCT.

[0070] 2.3 Population fluorescence PCR amplification 201 population samples were amplified with 24 pairs of polymorphic primers, and the reaction was performed on a Veriti384 PCR instrument.

[0071] The PCR reaction program is shown in Table 4. The PCR reaction system is shown in Table 5.

[0072] The PCR amplification program was set as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, gradient annealing at 62-52°C for 30 s, extension at 72°C for 30 s, for 10 cycles; denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, for 25 cycles; extension at 72°C for 20 min, and finally storage at 4°C.

[0073] Table 4: PCR amplification system and amplification procedure

[0074] Table 5: Fluorescence PCR reaction system of Oryza granulosa

[0075] After the PCR reaction is completed, the amplified product is detected by fluorescent capillary electrophoresis. The results are analyzed using GeneMarker software to obtain the number of alleles, peak graphs, and genotypes for each sample. Each PCR amplification operation sheet corresponds to a 96-well PCR amplification well, recording the order number, amplification plate number, amplification conditions, amplification site (fluorescent marker / upstream primer number, downstream primer number) of each PCR amplification, and DNA template in each amplification well (sample storage plate number-well number) and other experimental information to ensure that the experimental process is accurate.

[0076] 2.4 Detection of PCR products by fluorescence capillary electrophoresis According to the experimental requirements, add the fluorescent PCR products diluted to a uniform concentration to the upper plate, and add the upper detection reagents according to the system provided in Table 5. Centrifuge the plate to be tested with samples and reagents and put it on the PCR instrument to run the denaturation program (95°C, 3min). Cool it immediately after the denaturation is completed; refer to the ABI 3730xL upper operation process, select the detection file corresponding to the name of the plate to be tested, and run the SSR sample analysis detection program.

[0077] The raw data in fsa format were exported from the ABI 3730xL genetic analyzer, classified and archived according to the detection sites, and then imported into the GeneMarker analysis software to read the genotype data. The Excel genotype raw data and PDF typing peak graph files were exported according to the site name to obtain the number of alleles, peak graph and genotype of each sample.

[0078] SSR loci and genetic diversity of populations: POPGENEv1.31, PowerMarker v3.25, GenAlExversion 6.501 and other software were used to calculate AMOVA molecular variation analysis, various genetic diversity indicators of SSR loci and populations, including observed alleles (Na), effective alleles (Ne), Shannon index (I), polymorphism information index (PIC), observed heterozygosity (Ho), expected heterozygosity (He) and inbreeding coefficient (Fis).

[0079] The GenALEx software was used to analyze the genetic diversity of the 13 populations. The results in Table 6 showed that the Na of the 13 populations ranged from 1.034 to 2.957, with an average of 1.783. The Ne ranged from 1.026 to 2.159, with an average of 1.380. I The effective allele number (Ne) and Shannon index (I) of HN10 population were the largest, which were 2.159 and 0.770 respectively; the HN8 population was second, which were 1.993 and 0.756 respectively; the YN population was the smallest, which were 1.026 and 0.055 respectively; the remaining 10 populations were between 1.830-1.087 and 0.666-0.060 respectively, indicating that the genetic diversity among the 13 populations was rich, among which the YN population had the lowest genetic diversity, and the HN10 and HN8 populations had high genetic diversity.

[0080] Table 6: Genetic diversity among populations

[0081] Note: N a: observed allele; N e: effective allele; I : Shannon Information Index; H o: observed heterozygosity; H e: expected heterozygosity; F : Fixed index Molecular variance analysis is a method to measure and calculate the genetic variation between haplotypes (or genotypes) by evolutionary distance. In order to reveal the genetic variation of Oryza melongena, the AMOVA molecular variance analysis was used, and it was found that the genetic variation between Oryza melongena populations was 43%, the genetic variation between individuals was 37%, and the variation within individuals accounted for 20%, indicating that the genetic variation between Oryza melongena populations was higher than the genetic variation within and between individuals (Table 7). Pairwise AMOVA analysis showed that the differentiation coefficient between populations was 0.021-4.750; the gene flow was 0.038-0.921; the genetic distance was 0.046-0.877, indicating that there was low gene flow between populations.

[0082] Table 7: Analysis of molecular variance (AMOVA) of populations

[0083] 2.5 Analysis of population structure of O. melongena germplasm In order to reveal the population structure of 201 Oryza verruca germplasm resources, the genetic structure of 13 populations from different geographical origins was analyzed using the Bayesian analysis method, and the estimated population size was represented by the K value. The standard STRUCTURE analysis was used to test 15 K values ​​(K=1-15) one by one, and 10 independent runs were performed for each K value. The optimal population size was found to be 2 (K=2) ( Figure 2 ). Therefore, when K=2, the genetic structure of 201 Oryza melongena germplasm samples from 13 populations was analyzed. The results showed that the 201 Oryza melongena germplasm samples were divided into two subpopulations, including four materials (S04340, S04335, S04336, S04337) collected from population HN10 and three materials (S04217, S04224, S04225) from HN3, which contained unique genotypes and may have a small amount of gene exchange between populations. Combined with the results of the genetic diversity index gene flow (Nm) (Table 8), it was shown that there was little gene exchange in the 201 Oryza melongena germplasm resources.

[0084] 2.6 UPGMA clustering and PCoA analysis of O. melongena germplasm resources The Nei's unweighted group average method (UPGMA) of genetic distance was used to cluster 201 Oryza melongena germplasm resources from 13 populations according to the maximum likelihood value principle. When the optimal K value was 2, the populations were clustered into two subpopulation branches. The populations in Yunnan were clustered into one group (YN); the 12 populations in Hainan were clustered into one group (Table 8, Table 9, Figure 1The second group is divided into two small groups. Group I includes three populations: HN4, HN8, and HN9; Group II includes eight populations: HN12, HN1, HN2, HN3, HN5, HN11 (two populations in Ledong), HN10, and HN6.

[0085] Table 8: Gene flow between populations (upper triangle) and genetic differentiation coefficient (lower triangle)

[0086] Table 9: Genetic distance between populations

[0087] 2.7 F-statistic and gene flow analysis of the total population The F-statistic can be used to evaluate the level of population differentiation and the degree of inbreeding. The F-statistic and gene flow of the total population under 23 SSR loci are shown in Table 10. The overall inbreeding coefficient is -0.579-0.983, with an average of 0.683, indicating a high degree of inbreeding among individuals and a large amount of genetic variation; the genetic differentiation coefficient is 0.242-0.768, with an average of 0.586, indicating a high degree of genetic differentiation; the Nm value is between 0.032-0.782, and the Nm value of all polymorphic loci is less than 1, with an average of 0.204, indicating that there is little gene flow in the 201 accessions of Oryza melongena germplasm resources, which is consistent with the results of population structure analysis.

[0088] Table 10: Inbreeding coefficient and gene flow of 24 primer pairs

[0089] Note: Nm :Gene flow( N m = 0.25(1-Fst) / Fst) Inbreeding coefficient: It refers to the degree of gene purification expressed as a percentage based on the number of generations of inbreeding. It is also called the inbreeding coefficient when the percentage of homogeneous genes or homozygotes is reduced due to inbreeding.

[0090] Gene flow: The transfer of genes from one population to another.

[0091] 2.8 Population genetic structure analysis and UPGMA clustering and PCoA analysis The population structure of 201 samples was analyzed using STRUCTURE 2.3.4, with K = 1-20, Burn-in cycle of 10000, MCMC (MarkovChain Monte Carlo) set to 100000, and each K value was run 20 times, and the optimal △K value (i.e., the optimal population stratification) was calculated. The results of the optimal K value were plotted. The genetic distance between populations was calculated using Powermarker, and the UPGMA method was used for cluster analysis. The unweighted group average method (UPGMA) based on Nei genetic distance was used for cluster analysis.

[0092] According to the results of population genetic structure analysis, the variation and differentiation between and within each population were calculated and significance tests were performed using the GenAlEx version 6.501 software. The genetic differentiation coefficient (Fst) and gene flow (Nm) were calculated using the Wright (1931) formula: Nm=0.25(1-Fst) / Fst. Principal coordinate analysis (PCoA) was performed using the GenALEx v6.3 software.

[0093] The principal coordinates of the Oryza melongena germplasm resources were analyzed using GenAIex software. The distance of the material on the two-dimensional plane represents the degree of its genetic relationship. The 201 Oryza melongena germplasm resources were analyzed in the following ways: Figure 3 As shown in the figure, the relationship between group 1 and group 2 can be clearly seen. A small number of germplasms in the two groups cannot be clearly separated, and the relationship is close. Most of the germplasms can be clearly separated, and the relationship is distant, which verifies the analysis results of the genetic structure; and it is found that the first principal coordinate and the second principal coordinate account for 67.7% and 8.58% of the total genetic variation, respectively ( Figure 3 ). This shows that the results of PCoA analysis are basically consistent with those of cluster analysis.

[0094] In order to reflect the effectiveness of SSR fluorescent primers in the analysis of genetic diversity of Oryza sativa, the polymorphism analysis of primers was performed. Table 11 shows the polymorphism information of 24 pairs of SSR fluorescent primers in 201 samples. A total of 103 alleles (Na) were detected in 201 samples, of which the allele range was 2-18 and the average was 4.478. N e) The total number is 52.698, the value range is 1.595 (YLYSD084)-8.816 (YLYSD186), and the average number of effective alleles per site is 2.291; Shannon index ( I ) ranged from 0.569 (YLYSD167) to 2.374 (YLYSD186), with an average of 0.903; the observed heterozygosity ( Ho) ranged from 0.1 (YLYSD006) to 0.746 (YLYSD282), with an average of 0.107; the expected heterozygosity ( He ) ranged from 0.373 (YLYSD084) to 0.887 (YLYSD186), with an average value of 0.496; the polymorphic information content ( PIC ) ranged from 0.308 (YLYSD167) to 0.876 (YLYSD186), among which the highly polymorphic markers ( PIC≧ 0.5) has 5, medium polymorphic markers (0.25≦ PIC< 0.5) with 19, low polymorphic markers ( PIC< The above results show that the 24 pairs of SSR fluorescent primers have different degrees of allelic variation in Oryza melongena germplasm and can reflect the heterozygosity of individuals, indicating that the 24 pairs of SSR fluorescent primers have good polymorphism and can be used for genetic diversity analysis.

[0095] Table 11: Polymorphism of 24 pairs of SSR primers

[0096] Note: Prob : P value; Signif : Significance (ns means not significant, that is, the group conforms to HWE; * means significant difference P<0.05, ** means significant difference P<0.01, *** means significant difference P<0.001) Observed alleles ( N a): The number of observed alleles is an important indicator for measuring genetic diversity. The more alleles there are, the more different alleles there are at the locus, which means that the genetic variation between individuals is richer. On the contrary, a smaller number of alleles means that the genetic differences between individuals are relatively small. Effective alleles (Ne): The more evenly the alleles are distributed in the population, the closer Ne is to the number of alleles actually detected. Shannon index ( I ): A measure of biodiversity index, indicating how evenly individuals are distributed across many categories. The more species there are, the more evenly the number of individuals is, and the greater the biodiversity. H o): The probability that the alleles of two randomly selected samples are different. This includes determining the distribution of genes and genetic diversity in a population, thereby reflecting the genetic distance between different individuals in the population. Expected heterozygosity ( H e): refers to the distribution under the heterozygosity assumption, which is based on the assumption of measuring the genetic diversity of the species group. F ): An indicator for evaluating the degree of deviation between the actual observed value and the theoretical value. PIC): A marker relies on the number of detectable alleles and their distribution frequency to obtain a value for the size of the polymorphism detected by the marker in a population.

[0097] The preferred specific embodiments of the present invention are described in detail above. It should be understood that a person skilled in the art can make many modifications and changes based on the concept of the present invention without creative work. Therefore, any technical solution that can be obtained by a person skilled in the art through logical analysis, reasoning or limited experiments based on the concept of the present invention on the basis of the prior art should be within the scope of protection determined by the claims.

Claims

1. Application of a set of Oryza granatum SSR primers in evaluating Oryza granatum resources, characterized in that: The primer sequences are one or more primer sequences in SEQ ID NO: 1-SEQ ID NO: 48, the GC content of the primers is between 50-60%, the length is between 18-23 bp, and the annealing temperature is between 57-63°C.

2. The use according to claim 1, characterized in that: The collection location of the Oryza vulgaris is Hainan Province and / or Yunnan Province.

3. The use according to claim 2, characterized in that: The collection locations of the tuberculate wild rice are Changjiang Li Autonomous County, Hainan Province, Dongfang City, Hainan Province, Wuzhishan City, Hainan Province, Ledong Li Autonomous County, Hainan Province, Sanya City, Hainan Province, Dongfang City, Hainan Province, Ledong Li Autonomous County, Hainan Province, Baoting Li and Miao Autonomous County, Hainan Province or Lincang City, Yunnan Province.

4. The use according to claim 3, characterized in that: The collection locations of the described tuberculous wild rice are Wangxia Township, Changjiang Li Autonomous County, Hainan Province, Banqiao Town, Dongfang City, Hainan Province, Tuolei Village, Tian'an Township, Dongfang City, Hainan Province, Watongwan Village, Tian'an Township, Dongfang City, Hainan Province, Wen Village, Tian'an Township, Dongfang City, Hainan Province, Changhao Township, Wuzhishan City, Hainan Province, Jianfengling Nature Reserve, Ledong Li Autonomous County, Hainan Province, Luhuitou Scenic Area, Jiyang District, Sanya City, Hainan Province, Gancheng Town, Dongfang City, Hainan Province, Liguo Town, Ledong Li Autonomous County, Hainan Province, Jianfengling Nature Reserve, Ledong Li Autonomous County, Hainan Province, Baocheng Town, Baoting Li and Miao Autonomous County, Hainan Province or Cangyuan County, Lincang City, Yunnan Province.

Images