An aldose reductase mutant and its use in producing d-tagatose

Abstract

The application discloses an aldose reductase mutant and application thereof in production of D-tagatose, and belongs to the technical field of genetic engineering. The aldose reductase mutant has high catalytic activity, can be coupled with galactitol 2-dehydrogenase, realizes NADH cyclic regeneration, and greatly reduces the preparation cost of D-tagatose. The aldose reductase mutant is used to prepare D-tagatose, 98.2g / L of D-tagatose can be obtained within 5h, and the yield is as high as 98.2%, which is superior to the conversion effect of wild type and other mutant enzymes, so that the aldose reductase mutant has a good industrial application prospect.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to an aldose reductase mutant and application thereof in the production of D-tagatose. Background Art

[0002] D-tagatose is a rare ketohexose found in nature. It is an isomer of D-galactose and also a diastereomer of fructose. Its sweetness is similar to that of sucrose, but the calories it provides are only 30% of sucrose. It can be used as a low-calorie sweetener and will not cause a rapid increase in blood sugar after consumption. It can be used as a special sweetener for diabetics and is widely used in low-sugar health foods and various weight-loss foods.

[0003] D-tagatose is extremely rare in nature, making it difficult to obtain via natural extraction methods. The yields are extremely limited, unable to meet market demand, and the extraction cost is high. Chemical synthesis methods have harsh reaction conditions and produce numerous byproducts, which complicate subsequent isolation and purification, resulting in low D-tagatose yields. Biotransformation methods have garnered significant attention due to their high specificity, environmental friendliness, mild reaction conditions, and the elimination of multiple isolation and purification steps.

[0004] Currently, domestic and international researchers have reported various bio-based production routes for D-tagatose. For example, Zheng Xu co-expressed L-arabinose isomerase from Lactobacillus fermentum CGMCC2921 and β-D-galactosidase from Thermus thermophilus HB27 in Escherichia coli. By optimizing the SD sequence and its distance from the start codon to balance the expression levels of the two enzymes, the recombinant bacteria was able to convert lactose to 101 g / L of D-tagatose after 16 hours of reaction, with a yield and time-space productivity of 20.2% and 6.3 g / L / h, respectively. Chinese patent CN103045575 constructed a recombinant L-arabinose isomerase from Bacillus subtilis and investigated the expression of L-arabinose isomerase and the conditions for converting galactose to D-tagatose. Using 100 g / L galactose as a substrate, the conversion rate was only about 40% after 10 hours of conversion.

[0005] The D-tagatose preparation methods reported above are isomerization reactions, which are subject to thermodynamic limitations and low substrate conversion efficiency, significantly increasing raw material costs and downstream separation and purification costs. Jing-Jing Liu et al. heterologously expressed xylose reductase and galactitol dehydrogenase in Saccharomyces cerevisiae to convert galactose into D-tagatose. This reaction is thermodynamically free and has a theoretical conversion rate of 100%. However, because the two enzymes require different coenzymes, they cannot complement each other to achieve coenzyme regeneration. This requires additional coenzymes or live bacterial fermentation, which significantly increases raw material costs and reaction cycles. Therefore, it would be of great significance to obtain a D-tagatose preparation method with low raw material costs and high conversion efficiency.

[0006] In view of this, the present invention is proposed. Summary of the Invention

[0007] The present invention aims to provide an aldose reductase mutant and its application in the production of D-tagatose. By performing site-directed mutagenesis on aldose reductase, the aldose reductase mutant obtained can be coupled with galactitol 2-dehydrogenase to cyclically regenerate NADH, without the need to add expensive coenzymes NADPH and NAD + , which greatly reduces the preparation cost of D-tagatose.

[0008] The present invention is achieved in that:

[0009] The existing route for preparing D-tagatose is: using galactose as substrate, D-tagatose is prepared by coupling the wild-type aldose reductase (AR) and galactitol 2-dehydrogenase (GDH). However, wild-type AR is an NADPH-dependent enzyme and cannot complement GDH to achieve coenzyme regeneration. Therefore, additional coenzymes need to be added during the production process, which increases the cost of raw materials and prolongs the reaction cycle. In order to improve this problem, the present invention changes the coenzyme preference of AR from NADPH to NADH by site-directed mutagenesis, and combines with NADPH to form NADH. + The D-tagatose is prepared by the GDH-dependent coupled conversion, and the recycling of the coenzyme NADH is achieved. The optimized synthesis route of D-tagatose of the present invention is as follows: Figure 1 shown.

[0010] For wild-type AR, the present invention first screened AR with higher enzymatic activity from various sources (derived from Candidaboidinii, Genbank accession number AAL47846.2, amino acid sequence shown in SEQ ID NO. 1, nucleotide sequence shown in SEQ ID NO. 2). Site-directed mutagenesis was then performed on the screened AR to obtain AR mutants. Specifically, the AR mutants were mutated at at least one of positions 24, 50, 81, 130, and 225.

[0011] Among them, the mutation mode at position 24 is: valine mutates to any one of alanine, serine or threonine, namely V24A, V24S and V24T.

[0012] The mutation pattern at position 50 is: tyrosine is mutated to any one of phenylalanine, leucine, isoleucine or histidine, namely Y50F, Y50L, Y50I and Y50H.

[0013] The mutation pattern at position 81 is: tryptophan is mutated to any one of phenylalanine, tyrosine, proline, histidine or methionine, namely W81F, W81Y, W81P, W81H and W81M.

[0014] The mutations at position 130 are: phenylalanine mutates to any one of histidine, lysine or glutamine, namely F130H, F130K and F130Q.

[0015] The mutation pattern at position 225 is: glutamic acid is mutated to any one of glutamine, asparagine, aspartic acid or arginine, namely E225Q, E225N, E225D and E225R.

[0016] The mutations at positions 24, 50, 81, 130, and 225 can convert AR into an NADH-dependent enzyme. + The GDH-dependent coupling can efficiently prepare D-tagatose.

[0017] Furthermore, the mutation mode of the AR mutant is any one or a combination of V24S, Y50L, W81Y, F130K and E225R.

[0018] Furthermore, the AR mutant with the amino acid sequence shown in SEQ ID NO. 7 has higher enzyme activity and better D-tagatose production efficiency. The amino acid sequence shown in SEQ ID NO. 7 is based on the amino acid sequence shown in SEQ ID NO. 1, with five mutations: V24S, Y50L, W81Y, F130K, and E225R.

[0019] Related biological materials can be obtained through the above-mentioned AR mutants, which include: nucleic acid molecules encoding the above-mentioned AR mutants; expression cassettes containing the above-mentioned nucleic acid molecules; recombinant vectors containing the above-mentioned nucleic acid molecules, or recombinant vectors containing the above-mentioned expression cassettes; recombinant bacteria containing the above-mentioned nucleic acid molecules, or recombinant bacteria containing the above-mentioned expression cassettes, or recombinant bacteria containing the above-mentioned recombinant vectors.

[0020] In some embodiments, the method for constructing a recombinant bacterium expressing the above-mentioned AR mutant includes: connecting the nucleotide sequence of the AR mutant to an expression vector, then transforming the obtained recombinant vector into a host cell, culturing the host cell, and inducing expression of the AR mutant.

[0021] The expression vector and host cell can be selected conventionally in the art. In some embodiments, the expression vector is pET28a(+) and the host cell is E. coli BL21(DE3). By using the above method to induce protein expression and disrupt the cells to obtain a crude enzyme solution, the catalytic activity of the obtained AR mutant is superior to that of the wild-type enzyme.

[0022] In the present invention, the nucleotide sequence encoding the above AR mutant is shown in SEQ ID NO.8.

[0023] The AR mutant can be used in combination with GDH to synthesize D-tagatose. Based on this, the present invention also provides a whole-cell catalyst, which includes the recombinant bacteria.

[0024] At the same time, the present invention also provides a method for producing D-tagatose, comprising: crushing the recombinant bacteria expressing the above-mentioned AR mutant and the recombinant bacteria expressing GDH, and then adding the supernatant thereof to a transformation system for reaction to obtain D-tagatose.

[0025] In the present invention, GDH is derived from Agrobacterium fabrum, and its amino acid sequence is shown in SEQ ID NO.9, and its nucleotide sequence is shown in SEQ ID NO.10.

[0026] In some embodiments, the host of the recombinant bacteria expressing the AR mutant and GDH includes Escherichia coli.

[0027] In some embodiments, the transformation system comprises: galactose, NADH, K2HPO4-KH2PO4 buffer (pH 7.5-8.0) and recombinant bacteria.

[0028] In some embodiments, the transformation system is: 50-200 mM K2HPO4-KH2PO4 buffer (pH = 8.0), 1-20 g / L galactose, 1-5 mM NADH, 2-20 g / L of recombinant bacteria expressing aldose reductase mutant, and 2-20 g / L of recombinant bacteria expressing galactitol 2-dehydrogenase.

[0029] In some embodiments, the reaction conditions are: pH 6.5-8.5, temperature 20-40° C., shaker speed 150-250 rpm, and reaction time 1-10 h.

[0030] The present invention has the following beneficial effects:

[0031] The present invention provides a highly active NADH-dependent aldose reductase mutant and its use in catalyzing the production of D-tagatose from galactose. The mutant has high catalytic activity and can be coupled with galactitol 2-dehydrogenase (GDH) to achieve NADH regeneration, significantly reducing the production cost of D-tagatose. Using the aldose reductase mutant of the present invention to produce D-tagatose, 98.2 g / L of D-tagatose can be converted within 5 hours, with a yield of up to 98.2%. This is superior to the conversion efficiency of the wild-type and other mutant enzymes. Therefore, the aldose reductase mutant of the present invention has good prospects for industrial application. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0033] Figure 1 The diagram is a roadmap for synthesizing D-tagatose according to the present invention. DETAILED DESCRIPTION

[0034] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.

[0035] The features and performance of the present invention are further described in detail below with reference to the embodiments.

[0036] The present invention analyzes the substrate concentration and product concentration by high performance liquid chromatography (HPLC), and the specific analysis method is as follows:

[0037] The conversion solution was analyzed by Shimadzu LC-20AT high performance liquid chromatography (HPLC) with a differential detector RID-20A. The chromatographic conditions were:

[0038] A BioRad chromatographic column (Aminex HPX-87H 7.8×300 mm, 5 μm) was used; the mobile phase was a 5 mM aqueous sulfuric acid solution; the flow rate was 0.6 mL / min, the column temperature was 60° C., and the injection volume was 20 μL.

[0039] Example 1

[0040] This example is the screening of enzymes, which is as follows:

[0041] 1. Enzyme Source and Construction of Recombinant Bacteria

[0042] Aldose reductases were obtained from the NCBI database and were derived from Candida boidinii (Genbank No. AAL47846.2), Cryptococcus deuterogattii (Genbank No. XP_062884251.1), and Wickerhamomyces ciferrii (Genbank No. XP_011276858.1), respectively. They were named CbAR, CdAR, and WcAR, respectively. Based on the amino acid sequences, codon optimization was performed according to the codon preference of Escherichia coli, and three nucleotide sequences were synthesized by total synthesis using conventional genetic engineering procedures, as shown in SEQ ID NO. 2, SEQ ID NO. 4, and SEQ ID NO. 6, respectively. The amino acid sequences encoding the enzymes are shown in SEQ ID NO. 1, SEQ ID NO. 3, and SEQ ID NO. 5, respectively. A 6×His-tag was added to the end of the nucleotide sequence, and restriction sites NdeI and XhoI were added at both ends. The genes were cloned into the corresponding NdeI and XhoI sites of pET28a(+) to obtain recombinant expression plasmids pET28a-CbAR, pET28a-CdAR and pET28a-WcAR. These three plasmids were transformed into Escherichia coli BL21(DE3) competent cells to obtain recombinant bacteria Escherichia coli BL21(DE3) / pET28a-CbAR, Escherichia coli BL21(DE3) / pET28a-CdAR and Escherichia coli BL21(DE3) / pET28a-WcAR, respectively.

[0043] 2. Inducible expression of aldose reductase and galactitol 2-dehydrogenase from different sources

[0044] The galactitol 2-dehydrogenase gene GDH (derived from Agrobacterium fabrum, with a nucleotide sequence as shown in SEQ ID No. 10 and an amino acid sequence as shown in SEQ ID No. 9) was synthesized to obtain a recombinant galactitol 2-dehydrogenase strain E. coli BL21 (DE3) / pET28a-GDH.

[0045] The recombinant E. coli was inoculated into LB medium containing 50 mg / L kanamycin and cultured at 37°C and 200 rpm for 12 h to obtain seed solution. The seed solution was inoculated into fresh LB medium at a 2% inoculum volume and cultured at 37°C and 200 rpm until the bacterial concentration OD 600nmWhen the pH reaches 0.7, 0.5 mM IPTG was added and induced at 28 °C for 15 h. The cells were centrifuged at 8000 rpm for 10 min, and the supernatant was discarded. The wet cells were washed twice with 0.9% saline, centrifuged, and set aside.

[0046] 3. Comparison of recombinant bacterial enzyme activities

[0047] Enzyme activity determination method: NADH has a maximum absorption peak at 340nm, NAD + The absorption peak at 340 nm is zero. By measuring the absorbance of NADH standards with different concentration gradients at 340 nm, the relationship curve between different concentrations of NADH and absorbance is obtained.

[0048] The wet cells were ultrasonically disrupted. 1 g of the prepared wet cells were resuspended in 50 mL of 50 mM K2HPO4-KH2PO4 buffer (pH 8.0). The suspension was ultrasonically disrupted at 35 W for 15 min to obtain a suspension after ultrasonic disruption. The suspension was centrifuged and the supernatant was collected. 1 mL of the supernatant was used for the reaction.

[0049] Reaction system: 50 mM K2HPO4-KH2PO4 buffer (pH 8.0), 2 g / L galactose, 2 mM NADH and 100 μL AR crushing supernatant, a total of 1 mL system.

[0050] Reaction conditions: react at 35°C for 5 min, and measure the absorbance of the system at 340 nm using a SpectraMax M5 microplate reader.

[0051] Enzyme activity definition: 1 μmol NADH is oxidized to NAD per minute at 35°C and pH 8.0 + The amount of enzyme required.

[0052] Table 1 Comparison of the activities of various recombinant enzymes

[0053] strain / plasmid Enzyme activity (U / mL) E. coli BL21(DE3) 0 E. coli BL21(DE3) / pET28a 0 E. coli BL21(DE3) / pET28a-CdAR 0 E. coli BL21(DE3) / pET28a-WcAR 0.01 E. coli BL21(DE3) / pET28a-CbAR 0.03

[0054] As can be seen from Table 1, the aldose reductase from Candida boidinii has a higher enzyme activity.

[0055] Example 2

[0056] This example is the construction and screening of single-site mutants of the CbAR screened in Example 1, specifically as follows:

[0057] 1. Construction of mutants

[0058] Site-directed mutagenesis primers were designed based on the CbAR parent sequence (amino acid sequence shown in SEQ ID NO. 1, nucleotide sequence shown in SEQ ID NO. 2). Rapid PCR was used to introduce a single mutation at position 225 using recombinant pET28a-CbAR as a template. The primers were:

[0059] Forward primer 225E: TGTT NNN CTGGACCACCCAAAGGTAAAAGACT(SEQ ID No.11);

[0060] Reverse primer 225E: GGTGGTCCAG NNN AACAAAGCTCTGCGGACCG (SEQ ID No. 12).

[0061] PCR reaction system: 2×FastPfu Fly Reaction Mix 25 μL, forward primer 225E (10 μM) 2 μL, reverse primer 225E (10 μM) 2 μL, template DNA 1 μL, FastPfu Fly DNA Polymerase 1 μL, add ddH2O to 50 μL.

[0062] PCR amplification conditions: 95°C for 5 min; 30 cycles of (95°C for 20 s, 60°C for 15 s, 72°C for 1.5 min); 72°C for 10 min.

[0063] 2. Mutant Transformation and Expression

[0064] The PCR results were verified by agarose gel electrophoresis. The PCR products were digested with DpnI enzyme template, digested at 37°C for 1 hour, and inactivated at 65°C for 1 minute. 10 μL of PCR product was added to E. coli BL21 (DE3) competent cells, heat-shocked and transformed, and cultured at 37°C and 200 rpm for 1 hour. The bacterial solution was plated and cultured at 37°C for 12 hours.

[0065] 3. High-throughput screening of positive transformants

[0066] The reaction mixture consisted of 50 mM K₂HPO₄-KH₂PO₄ buffer (pH 8.0), 2 g / L galactose, and 2 mM NADH. 200 μL of LB medium containing 50 mg / L kanamycin was added to each well of a 96-well plate. Individual colonies were picked and incubated at 37°C and 200 rpm until the OD₀₀ reached 0.5-0.6. IPTG was added to the culture at a final concentration of 0.5 mM. Expression was induced at 28°C for 12 h. The mixture was centrifuged at 20°C and 4200 rpm for 10 min, and the supernatant was discarded. 100 μL of the reaction mixture was added to the 96-well plate containing the cells, mixed, and incubated at 35°C for 5 min. The absorbance was measured at 340 nm using a SpectraMax M5 microplate reader. The reaction of the recombinant bacteria E. coli BL21 (DE3) / pET28a-CbAR was used as a control, and the mutant strain with lower absorbance than the reaction of E. coli BL21 (DE3) / pET28a-CbAR was used for accurate determination of enzyme activity.

[0067] 4. Accurate determination of enzyme activity of positive transformants

[0068] The operation was the same as that in Example 1 "Comparison of recombinant bacterial enzyme activity".

[0069] The results of this example are as follows: 522 recombinant transformants were initially screened, and four mutants with improved enzyme activity were selected. These mutants were then subjected to precise enzyme activity measurements, as shown in Table 2. Analysis determined that the reason the enzyme activity of the remaining 518 recombinant strains remained unchanged or decreased was due to the mutation of glutamic acid (E) at position 225 to an amino acid other than Q, N, D, or R.

[0070] Table 2 Enzyme activity determination of single-point mutation recombinant bacteria

[0071] Original enzyme or mutant Enzyme activity (U / mL) E. coli BL21(DE3) without CbAR 0 CbAR proenzyme 0.03 CbAR mutant-E225Q 0.05 CbAR mutant-E225N 0.1 CbAR mutant-E225D 0.08 CbAR mutant-E225R 0.13

[0072] The CbAR mutant E225R with the greatest improvement in enzyme activity was designated as CbAR-1, and the recombinant E. coli BL21 (DE3) / pET28a-CbAR-1 was obtained.

[0073] Example 3

[0074] This example is the construction and screening of CbAR double-site mutants, as follows:

[0075] Site-directed mutagenesis primers were designed based on the sequence of the single mutant CbAR-1 constructed in Example 2. Rapid PCR technology was used to introduce a single mutation at position 81 using recombinant pET28a-CbAR-1 as a template. The primers were:

[0076] Forward primer 81W: CCAAACTG NNNAACAACTTCCATCATCCAGATAGCG(SEQ ID No.13);

[0077] Reverse primer 81W: GTTGTT NNN CAGTTTGGATACGATAAACAGTCCC (SEQ ID No. 14).

[0078] PCR reaction system: 2×FastPfu Fly Reaction Mix 25 μL, forward primer 81W (10 μM) 2 μL, reverse primer 81W (10 μM) 2 μL, template DNA 1 μL, FastPfu Fly DNA Polymerase 1 μL, add ddH2O to 50 μL.

[0079] PCR amplification conditions: 95°C for 5 min; 30 cycles of (95°C for 20 s, 60°C for 15 s, 72°C for 1.5 min); 72°C for 10 min.

[0080] Positive PCR results were verified by agarose gel electrophoresis. The PCR product was digested with DpnI at 37°C for 1 hour and inactivated at 65°C for 1 minute. 10 μL of the PCR product was added to competent E. coli BL21 (DE3) cells for heat shock transformation. The cells were incubated at 37°C and 200 rpm for 1 hour. The culture was plated and incubated at 37°C for 12 hours. Initial screening of mutants was performed (the same procedure as in "High-throughput screening of positive transformants" in Example 2).

[0081] The wet cells were ultrasonically disrupted and the enzyme activity was accurately determined (the operation was the same as the "Comparison of enzyme activity of recombinant bacteria" in Example 1).

[0082] The results of this example are as follows: 625 recombinant transformants were initially screened, and 5 mutants with improved enzyme activity were selected. The enzyme activity of these mutants was then accurately measured, and the specific results are shown in Table 3. Analysis determined that the reason for the unchanged or decreased enzyme activity in the remaining 620 recombinant strains was that the tryptophan (W) at position 81 was mutated to an amino acid other than F, Y, P, H, and M.

[0083] Table 3 Enzyme activity determination of double-point mutation recombinant bacteria

[0084] Original enzyme or mutant Enzyme activity (U / mL) E. coli BL21(DE3) without CbAR 0 CbAR mutant-E225R 0.13 CbAR mutant-E225R-W81F 0.35 CbAR mutant-E225R-W81Y 0.76 CbAR mutant-E225R-W81P 0.52 CbAR mutant-E225R-W81H 0.43 CbAR mutant-E225R-W81M 0.28

[0085] The CbAR mutant E225R-W81Y with the greatest enzyme activity improvement was designated as CbAR-2, and the recombinant E. coli BL21 (DE3) / pET28a-CbAR-2 was obtained.

[0086] Example 4

[0087] This example is the construction and screening of three-point mutants of CbAR, as follows:

[0088] Site-directed mutagenesis primers were designed based on the sequence of the single mutant CbAR-2 constructed in Example 3. Rapid PCR technology was used to introduce a single mutation at position 24 using recombinant pET28a-CbAR-2 as a template. The primers were:

[0089] Forward primer 24V:

[0090] CGGCTGTTGGAAA NNN GACAACGCAACTTGTGCTGAGA(SEQ IDNo.15);

[0091] Reverse primer 24V:C NNN TTTCCAACAGCCGAAACCGATCTGAGGC (SEQ ID No. 16).

[0092] PCR reaction system: 2×FastPfu Fly Reaction Mix 25 μL, forward primer 24V (10 μM) 2 μL, reverse primer 24V (10 μM) 2 μL, template DNA 1 μL, FastPfu Fly DNA Polymerase 1 μL, add ddH2O to 50 μL.

[0093] PCR amplification conditions: 95°C for 5 min; 30 cycles of (95°C for 20 s, 60°C for 15 s, 72°C for 1.5 min); 72°C for 10 min.

[0094] Positive PCR results were verified by agarose gel electrophoresis. The PCR product was digested with DpnI at 37°C for 1 hour and inactivated at 65°C for 1 minute. 10 μL of the PCR product was added to competent E. coli BL21 (DE3) cells for heat shock transformation. The cells were incubated at 37°C and 200 rpm for 1 hour. The culture was plated and incubated at 37°C for 12 hours. Initial screening of mutants was performed (the same procedure as in "High-throughput screening of positive transformants" in Example 2).

[0095] The wet cells were ultrasonically disrupted and the enzyme activity was accurately determined (the operation was the same as the "Comparison of enzyme activity of recombinant bacteria" in Example 1).

[0096] The results of this example are as follows: 471 recombinant transformants were initially screened, and three mutants with improved enzyme activity were selected. These mutants were then subjected to precise enzyme activity measurements, as shown in Table 4. Analysis determined that the reason the enzyme activity of the remaining 468 recombinant strains remained unchanged or decreased was due to the mutation of valine (V) at position 24 to amino acids other than A, S, and T.

[0097] Table 4 Enzyme activity determination of triple-point mutation recombinant bacteria

[0098] Original enzyme or mutant Enzyme activity (U / mL) E. coli BL21(DE3) without CbAR 0 CbAR mutant-E225R-W81Y 0.76 CbAR mutant-E225R-W81Y-V24A 1.2 CbAR mutant-E225R-W81Y-V24S 5.4 CbAR mutant-E225R-W81Y-V24T 3.5

[0099] The CbAR mutant E225R-W81Y-V24S with the greatest improvement in enzyme activity was designated CbAR-3, and the recombinant strain E. coli BL21 (DE3) / pET28a-CbAR-3 was obtained.

[0100] Example 5

[0101] This example is the construction and screening of CbAR four-site mutants, as follows:

[0102] Site-directed mutagenesis primers were designed based on the sequence of the single mutant CbAR-3 constructed in Example 4. Rapid PCR technology was used to introduce a single mutation at position 50 using recombinant pET28a-CbAR-3 as a template. The primers were:

[0103] Forward primer 50Y:TGGAC NNN GGTAACGAGAAGGAAGTTGGTGAA (SEQ ID No. 17);

[0104] Reverse primer 50Y: CTCGTTACC NNN GTCCATTGCGCCGTCGAACA (SEQ ID No. 18).

[0105] PCR reaction system: 2×FastPfu Fly Reaction Mix 25 μL, forward primer 50Y (10 μM) 2 μL, reverse primer 50Y (10 μM) 2 μL, template DNA 1 μL, FastPfu Fly DNA Polymerase 1 μL, add ddH2O to 50 μL.

[0106] PCR amplification conditions: 95°C for 5 min; 30 cycles of (95°C for 20 s, 60°C for 15 s, 72°C for 1.5 min); 72°C for 10 min.

[0107] Positive PCR results were verified by agarose gel electrophoresis. The PCR product was digested with DpnI at 37°C for 1 hour and inactivated at 65°C for 1 minute. 10 μL of the PCR product was added to competent E. coli BL21 (DE3) cells for heat shock transformation. The cells were incubated at 37°C and 200 rpm for 1 hour. The culture was plated and incubated at 37°C for 12 hours. Initial screening of mutants was performed (the same procedure as in "High-throughput screening of positive transformants" in Example 2).

[0108] The wet cells were ultrasonically disrupted and the enzyme activity was accurately determined (the operation was the same as the "Comparison of enzyme activity of recombinant bacteria" in Example 1).

[0109] The results of this example are as follows: 588 recombinant transformants were initially screened, and four mutants with improved enzyme activity were selected. These mutants were then subjected to precise enzyme activity measurements, as shown in Table 5. Analysis determined that the reason the enzyme activity of the remaining 584 recombinant strains remained unchanged or decreased was due to the mutation of tyrosine (Y) at position 50 to amino acids other than F, L, I, and H.

[0110] Table 5 Enzyme activity determination of four-point mutation recombinant bacteria

[0111] Original enzyme or mutant Enzyme activity (U / mL) E. coli BL21(DE3) without CbAR 0 CbAR mutant-E225R-W81Y-V24S 5.4 CbAR mutant-E225R-W81Y-V24S-Y50F 8.9 CbAR mutant-E225R-W81Y-V24S-Y50L 21.3 CbAR mutant-E225R-W81Y-V24S-Y50I 18.5 CbAR mutant-E225R-W81Y-V24S-Y50H 12.3

[0112] The CbAR mutant E225R-W81Y-V24S-Y50L with the greatest enzyme activity improvement was designated as CbAR-4, and the recombinant E. coli BL21 (DE3) / pET28a-CbAR-4 was obtained.

[0113] Example 6

[0114] This example is the construction and screening of CbAR five-site mutants, as follows:

[0115] Site-directed mutagenesis primers were designed based on the sequence of the single mutant CbAR-4 constructed in Example 5. Rapid PCR technology was used to introduce a single mutation at position 130 using recombinant pET28a-CbAR-4 as a template. The primers were:

[0116] Forward primer 130F: GCCGAAT NNN TACTGCGGGTGACGGTGACAAAT (SEQ ID No. 19);

[0117] Reverse primer 130F: CGCAGTA NNN ATTCGGCGGATACTTTTTTTCG (SEQ ID No. 20).

[0118] PCR reaction system: 2×FastPfu Fly Reaction Mix 25 μL, forward primer 130F (10 μM) 2 μL, reverse primer 130F (10 μM) 2 μL, template DNA 1 μL, FastPfu Fly DNA Polymerase 1 μL, add ddH2O to 50 μL.

[0119] PCR amplification conditions: 95°C for 5 min; 30 cycles of (95°C for 20 s, 60°C for 15 s, 72°C for 1.5 min); 72°C for 10 min.

[0120] Positive PCR results were verified by agarose gel electrophoresis. The PCR product was digested with DpnI at 37°C for 1 hour and inactivated at 65°C for 1 minute. 10 μL of the PCR product was added to competent E. coli BL21 (DE3) cells for heat shock transformation. The cells were incubated at 37°C and 200 rpm for 1 hour. The culture was plated and incubated at 37°C for 12 hours. Initial screening of mutants was performed (the same procedure as in "High-throughput screening of positive transformants" in Example 2).

[0121] The wet cells were ultrasonically disrupted and the enzyme activity was accurately determined (the operation was the same as the "Comparison of enzyme activity of recombinant bacteria" in Example 1).

[0122] The results of this example are as follows: 350 recombinant transformants were initially screened, and three mutants with improved enzyme activity were selected. These mutants were then subjected to precise enzyme activity measurements, as shown in Table 6. Analysis determined that the reason the enzyme activity of the remaining 347 recombinant strains remained unchanged or decreased was due to the mutation of phenylalanine (F) at position 130 to an amino acid other than H, K, or Q.

[0123] Table 6 Enzyme activity determination of five-point mutation recombinant bacteria

[0124]

[0125]

[0126] The CbAR mutant E225R-W81Y-V24S-Y50L-F130K with the greatest enzyme activity improvement was designated as CbAR-5, and the recombinant E. coli BL21 (DE3) / pET28a-CbAR-5 was obtained.

[0127] Example 6

[0128] This example is a dual-enzyme coupling of aldose reductase CbAR and galactitol 2-dehydrogenase GDH to convert galactose to produce D-tagatose

[0129] According to the induction expression method described in Example 1, E. coli BL21 (DE3) / pET28a-CbAR and E. coli BL21 (DE3) / pET28a-GDH were induced to express and the cells were collected. According to the ultrasonic disruption method described in Example 1, the two cells were ultrasonically disrupted to obtain CbAR supernatant and GDH supernatant. In a 50 mL system, the wet weight of bacterial CbAR (added in the form of the supernatant) was 10 g / L, the wet weight of bacterial GDH (added in the form of the supernatant) was 10 g / L, galactose was 100 g / L, pH 8.0, temperature was 30°C, the shaking speed was 200 rpm, and the conversion time was 5 h.

[0130] The results of HPLC determination showed that the residual amount of galactose was 99.5 g / L, the accumulated amount of galactitol was 0.5 g / L, the output of D-tagatose was 0.1 g / L, and the yield of D-tagatose was 0.1%.

[0131] Example 7

[0132] This example is a dual-enzyme coupling of aldose reductase CbAR-1 and galactitol 2-dehydrogenase GDH to convert galactose to produce D-tagatose

[0133] According to the induction expression method described in Example 1, E. coli BL21 (DE3) / pET28a-CbAR-1 and E. coli BL21 (DE3) / pET28a-GDH were induced to express and the cells were collected. According to the ultrasonication method described in Example 1, the two cells were ultrasonically disrupted to obtain CbAR-1 supernatant and GDH supernatant. In a 50 mL system, the wet weight of bacterial CbAR-1 (added in the form of the supernatant) was 10 g / L, the wet weight of bacterial GDH (added in the form of the supernatant) was 10 g / L, galactose was 100 g / L, pH 8.0, temperature was 30°C, the shaking speed was 200 rpm, and the transformation time was 5 h.

[0134] The results of HPLC determination showed that the residual amount of galactose was 98.7 g / L, the accumulated amount of galactitol was 1.1 g / L, the output of D-tagatose was 0.39 g / L, and the yield of D-tagatose was 0.39%.

[0135] Example 8

[0136] This example is a dual-enzyme coupling of aldose reductase CbAR-2 and galactitol 2-dehydrogenase GDH to convert galactose to produce D-tagatose

[0137] According to the induction expression method described in Example 1, E. coli BL21 (DE3) / pET28a-CbAR-1 and E. coli BL21 (DE3) / pET28a-GDH were induced to express and the cells were collected. According to the ultrasonication method described in Example 1, the two cells were ultrasonically disrupted to obtain CbAR-2 supernatant and GDH supernatant. In a 50 mL system, the wet weight of bacterial CbAR-2 (added in the form of the supernatant) was 10 g / L, the wet weight of bacterial GDH (added in the form of the supernatant) was 10 g / L, galactose was 100 g / L, pH 8.0, temperature was 30°C, the shaking speed was 200 rpm, and the transformation time was 5 h.

[0138] The results of HPLC determination showed that the residual amount of galactose was 94.7 g / L, the accumulated amount of galactitol was 3.3 g / L, the output of D-tagatose was 2.2 g / L, and the yield of D-tagatose was 2.2%.

[0139] Example 9

[0140] This example is a dual-enzyme coupling of aldose reductase CbAR-3 and galactitol 2-dehydrogenase GDH to convert galactose to produce D-tagatose

[0141] According to the induction expression method described in Example 1, E. coli BL21 (DE3) / pET28a-CbAR-3 and E. coli BL21 (DE3) / pET28a-GDH were induced to express and the cells were collected. According to the ultrasonication method described in Example 1, the two cells were ultrasonically disrupted to obtain CbAR-3 supernatant and GDH supernatant. In a 50 mL system, the wet weight of bacterial CbAR-3 (added in the form of the supernatant) was 10 g / L, the wet weight of bacterial GDH (added in the form of the supernatant) was 10 g / L, galactose was 100 g / L, pH 8.0, temperature was 30°C, the shaking speed was 200 rpm, and the transformation time was 5 h.

[0142] The results of HPLC determination showed that the residual amount of galactose was 66.4 g / L, the accumulated amount of galactitol was 19.7 g / L, the yield of D-tagatose was 15.5 g / L, and the yield rate of D-tagatose was 15.5%.

[0143] Example 10

[0144] This example is a dual-enzyme coupling of aldose reductase CbAR-4 and galactitol 2-dehydrogenase GDH to convert galactose to produce D-tagatose

[0145] According to the induction expression method described in Example 1, E. coli BL21 (DE3) / pET28a-CbAR-4 and E. coli BL21 (DE3) / pET28a-GDH were induced to express and the cells were collected. According to the ultrasonication method described in Example 1, the two cells were ultrasonically disrupted to obtain CbAR-4 supernatant and GDH supernatant. In a 50 mL system, the wet weight of CbAR-4 (added in the form of the supernatant) was 10 g / L, the wet weight of GDH (added in the form of the supernatant) was 10 g / L, galactose was 100 g / L, pH 8.0, temperature was 30°C, the shaking speed was 200 rpm, and the transformation time was 5 h.

[0146] The results of HPLC determination showed that the residual amount of galactose was 15.3 g / L, the accumulated amount of galactitol was 21.2 g / L, the output of D-tagatose was 65.3 g / L, and the yield of D-tagatose was 65.3%.

[0147] Example 11

[0148] This example is a dual-enzyme coupling of aldose reductase CbAR-5 and galactitol 2-dehydrogenase GDH to convert galactose to produce D-tagatose

[0149] According to the induction expression method described in Example 1, E. coli BL21 (DE3) / pET28a-CbAR-5 and E. coli BL21 (DE3) / pET28a-GDH were induced to express and the cells were collected. According to the ultrasonication method described in Example 1, the two cells were ultrasonically disrupted to obtain CbAR-5 supernatant and GDH supernatant. In a 50 mL system, the wet weight of CbAR-5 (added in the form of the supernatant) was 10 g / L, the wet weight of GDH (added in the form of the supernatant) was 10 g / L, galactose was 100 g / L, pH 8.0, temperature was 30°C, the shaking speed was 200 rpm, and the transformation time was 5 h.

[0150] The results of HPLC determination showed that the residual amount of galactose was 0.7 g / L, the accumulated amount of galactitol was 1.12 g / L, the yield of D-tagatose was 98.2 g / L, and the yield rate of D-tagatose was 98.2%.

[0151] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. An aldose reductase mutant, characterized in that The aldose reductase mutant undergoes amino acid mutation in the amino acid sequence shown in SEQ ID NO.

1. The mutation pattern of the aldose reductase mutant is as follows: Single point mutations: E225Q, E225N, E225D, E225R; Double point mutations: E225R-W81F, E225R-W81Y, E225R-W81P, E225R-W81H, E225R-W81M; Three point mutations: E225R-W81Y-V24A, E225R-W81Y-V24S, and E225R-W81Y-V24T; Four point mutations: E225R-W81Y-V24S-Y50F, E225R-W81Y-V24S-Y50L, E225R-W81Y-V24S-Y50I, and E225R-W81Y-V24S-Y50H; Five point mutations: E225R-W81Y-V24S-Y50L-F130H, E225R-W81Y-V24S-Y50L-F130K, and E225R-W81Y-V24S-Y50L-F130Q.

2. The aldose reductase mutant according to claim 1, characterized in that The amino acid sequence of the aldose reductase mutant is shown in SEQ ID NO.

7.

3. The biomaterial related to the aldose reductase mutant according to claim 1 or 2, characterized in that: Any of the following (1)-(4): (1) A nucleic acid molecule encoding the aldose reductase mutant according to claim 1 or 2; (2) an expression cassette containing the nucleic acid molecule described in (1); (3) A recombinant vector containing the nucleic acid molecule described in (1) or the expression cassette described in (2); (4) A recombinant bacterium containing the nucleic acid molecule described in (1), the expression cassette described in (2), or the recombinant vector described in (3).

4. A whole-cell catalyst, characterized in that The whole-cell catalyst includes the recombinant bacteria described in claim 3.

5. Use of the aldose reductase mutant according to claim 1 or 2 or the biomaterial according to claim 3 in synthesizing D-tagatose.

6. A method for synthesizing D-tagatose, characterized in that: include: The recombinant bacteria expressing the aldose reductase mutant according to claim 1 or 2 and the recombinant bacteria expressing galactitol 2-dehydrogenase are disrupted, and then the supernatants thereof are added to the conversion system for reaction to obtain D-tagatose.

7. The method according to claim 6, characterized in that The amino acid sequence of the galactitol 2-dehydrogenase is shown in SEQ ID NO.

9.

8. The method according to claim 6, characterized in that The transformation system comprises: galactose, NADH, a K2HPO4-KH2PO4 buffer solution with a pH of 8.0 and recombinant bacteria.

9. The method according to claim 8, characterized in that The transformation system includes: 50-200 mM K2HPO4-KH2PO4 buffer with a pH of 8.0, 1-20 g / L galactose, 1-5 mM NADH, 2-20 g / L recombinant bacteria expressing aldose reductase mutant, and 2-20 g / L recombinant bacteria expressing galactitol 2-dehydrogenase.

10. The method according to claim 9, characterized in that The reaction conditions are: pH 6.5-8.5, temperature 20-40° C., shaker speed 150-250 rpm, and reaction time 1-10 h.

Images