SiRNA for targeting and inhibiting expression of chicken ULK2 and application thereof

By designing siRNA that targets and inhibits the expression of the chicken ULK2 gene, and transfecting chicken primary myoblasts, the problem of slow leg muscle development in chickens in existing technologies has been solved, achieving a highly efficient gene knockdown effect and promoting the progress of broiler breeding.

CN119752888BActive Publication Date: 2026-07-07JIANGSU INST OF POULTRY SCI

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JIANGSU INST OF POULTRY SCI
Filing Date
2024-11-25
Publication Date
2026-07-07

Smart Images

  • Figure CN119752888B_ABST
    Figure CN119752888B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of poultry breeding, and discloses siRNA for targeted inhibition of chicken ULK2 expression and application thereof; the siRNA comprises ULK2-1170; the siRNA for targeted inhibition of chicken ULK2 gene expression can effectively reduce the expression of the chicken ULK2 gene after being transferred into chicken primary myoblast cells, the inhibition efficiency is more than 50%, and the knockdown efficiency is very high; the siRNA can be used for identifying gene functions by specifically knocking down the expression of the chicken ULK2 gene in vitro, and can be applied to genetic selection of high-quality broiler leg muscle development as a molecular marker, and has great economic value and scientific research value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of poultry breeding technology, specifically relating to an siRNA that targets and inhibits the expression of ULK2 in chickens and its application. Background Technology

[0002] Poultry skeletal muscle (mainly pectoral and leg muscles) is not only the primary organ of locomotion but also a significant source of animal protein, accounting for approximately 40% of chicken meat production. The leg muscle weight / meat yield of high-quality local chickens in my country is far lower than that of large-scale broiler chickens both domestically and internationally. Therefore, identifying genes / molecular markers closely related to leg muscle development in high-quality broiler chickens has significant theoretical and practical implications. unc-51-like autophagy-activated kinase 2 (ULK2), a member of the serine / threonine kinase family, plays a crucial role in the initiation of autophagy in mammalian cells. It also participates in many other biological processes, including cell fate determination, metabolism, transcriptional control, and tumorigenesis. Research on the ULK2 gene in poultry is scarce, and current techniques lack reports on using siRNA to knock down chicken ULK2 gene expression. Therefore, using siRNA to knock down chicken ULK2 gene expression and confirm its role in chicken leg muscle development can serve as a molecular marker for molecular genetic selection of high-quality broiler chickens, shortening generation intervals and accelerating breeding progress. Summary of the Invention

[0003] To address the technical problems existing in the prior art, this invention provides an siRNA that can target and inhibit the expression of the chicken ULK2 gene. When transformed into chicken primary myoblasts, it can effectively reduce the expression of the chicken ULK2 gene, with an inhibition efficiency of over 50% and a very high knockdown efficiency.

[0004] The objective of this invention is achieved through the following technical solution:

[0005] In a first aspect, the present invention provides a siRNA that targets and inhibits the expression of the chicken ULK2 gene, wherein the siRNA is ULK2-1170, ULK2-1332 or ULK2-1336;

[0006] The sequence of the sense strand of ULK2-1170 is shown in SEQ ID NO: 1, and the sequence of the antisense strand is shown in SEQ ID NO: 2. Each siRNA sequence is suffixed with TT bases.

[0007] The sequence of the sense strand of ULK2-1332 is shown in SEQ ID NO: 3, and the sequence of the antisense strand is shown in SEQ ID NO: 4. Each siRNA sequence is suffixed with TT bases.

[0008] The sequence of the sense strand of ULK2-1336 is shown in SEQ ID NO: 5, and the sequence of the antisense strand is shown in SEQ ID NO: 6. Each siRNA sequence is suffixed with TT bases.

[0009] Secondly, this invention provides the application of the siRNA that targets and inhibits the expression of chicken ULK2 in the genetic selection of high-quality broiler leg muscle development.

[0010] The specific application involves: designing siRNA for chicken ULK2 gene expression, transfecting the siRNA into chicken primary myoblasts, and using the siRNA to knock down chicken ULK2 gene expression.

[0011] Further, each 1 OD siRNA was diluted with 125 μL of DEPC water to a final concentration of 20 μM / μL and stored at -20°C for later use.

[0012] Furthermore, the specific steps for transfecting chicken primary myoblasts with siRNA are as follows:

[0013] Chicken primary myoblasts isolated from leg muscle tissue of 13-year-old chickens were used as transfection cells. The isolated chicken primary myoblasts were seeded into 12-well culture plates. When the cell density reached 60%, the original culture medium in the culture plate was aspirated and replaced with serum-free fresh culture medium. siRNA was transfected into the chicken primary myoblasts using the transfection reagent Lipofectamine 3000.

[0014] The specific transfection system is as follows: 162uL opti-MEM medium, 5ul siRNA with a final concentration of 20uM, 8ul Hiperfect transfection, incubated for 9 minutes to form a transfection complex, and then transfected into the medium.

[0015] This invention offers the following advantages: It provides a siRNA capable of targeting and inhibiting the expression of the chicken ULK2 gene. When transformed into primary chicken myoblasts, it effectively reduces the expression of the chicken ULK2 gene, achieving an inhibition efficiency of over 50%, demonstrating a high knockdown efficiency. This siRNA identifies gene function by specifically knocking down the expression of the chicken ULK2 gene in vitro. It can be used as a molecular marker for the genetic selection of high-quality broiler leg muscle development, accelerating genetic progress and shortening generation intervals, thus possessing significant economic and scientific research value. Attached Figure Description

[0016] Figure 1 The expression of ULK2 in the leg muscle tissue of two chicken breeds (different letters represent significant differences (P < 0.05), the same letter represents no significant differences (P > 0.05); ** indicates significant differences (P < 0.01));

[0017] Figure 2 The expression of ULK2 in chicken primary myoblasts (different letters represent significant differences (P < 0.05));

[0018] Figure 3 The expression changes of the ULK2 gene after exogenous transfection with ULK2 siRNA are shown in the figure (different letters represent significant differences (P < 0.05), and the same letter represents no significant differences (P > 0.05)).

[0019] Figure 4 Changes in the proliferation of primary chicken myoblasts after exogenous transfection with ULK2 siRNA (* indicates significant difference (P<0.05));

[0020] Figure 5 This study describes the changes in the expression of myoblast differentiation marker genes (Myod and MyoMarker) after exogenous transfection with ULK2 siRNA. Detailed Implementation

[0021] The invention is further illustrated and defined by the following examples, but not limited thereto. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. The invention will be further described below with reference to the accompanying drawings.

[0022] Example 1: Detection of ULK2 gene expression in chicken leg muscle tissue by real-time quantitative PCR

[0023] 1.1 Expression of ULK2 in leg muscle tissue

[0024] The expression of the ULK2 gene in leg muscle tissue at different developmental stages of two chicken breeds was detected using qPCR. Figure 1 As shown, the expression level of the ULK2 gene in leg muscle tissue of different breeds and at different developmental stages exhibits significant differences based on breed and development, indicating that the ULK2 gene is involved in the regulation of chicken leg muscle development.

[0025] 1.2 Expression of ULK2 in myoblasts of leg muscle tissue

[0026] The expression of the ULK2 gene during the proliferation and differentiation phases of chicken primary myoblasts was detected using qPCR. Figure 2 As shown, the expression level of the ULK2 gene in chicken primary myoblasts was significantly higher during the proliferation phase than during the differentiation phase (P < 0.01). This preliminarily suggests that the ULK2 gene may play a role in inhibiting the development of chicken leg muscles.

[0027] Example 2: Screening of chicken ULK2 gene siRNA sequences

[0028] 2.1 ULK2 gene siRNA design

[0029] The chicken ULK2 gene mRNA sequence information (accession number: XM_040687342.2) was obtained from the NCBI online database. Using the siCatch™ siRNA design software, siRNA targeting the CDS region of the chicken ULK2 gene was designed, with the siRNA sequence suffixed with TT bases. The designed siRNA was synthesized by Suzhou Jima Biotechnology Co., Ltd. Each 1 OD of synthesized siRNA was diluted with 125 μL of DEPC water to a final concentration of 20 μM / μL and stored at -20℃ for later use. The sequences of the designed siRNA are shown in Table 1.

[0030] Table 1 siRNA sequences

[0031]

[0032] 2.2 siRNA transfection of primary chicken myoblasts

[0033] Chicken primary myoblasts isolated from leg muscle tissue of 13-year-old chickens were used as transfection cells. The isolated chicken primary myoblasts were seeded into 12-well culture plates. When the cell density reached 60%, the original culture medium in the culture plates was aspirated and replaced with serum-free fresh culture medium. Using the transfection reagent Lipofectamine 3000, siRNA targeting the chicken ULK2 gene and negative control siRNA (NC) were transfected into the chicken primary myoblasts, with 3 replicate wells for each group.

[0034] The specific transfection system is as follows: Experimental group: 162uL opti-MEM medium + 5ul siRNA with a final concentration of 20uM + 8ul Hiperfect transfection; Control group: 162uL opti-MEM medium + 5ul Megative with a final concentration of 20uM + 8ul Hiperfect transfection. Incubate for 9 minutes to form a transfection complex, and then transfect it into the medium.

[0035] 2.3 RNA extraction and cDNA preparation

[0036] 24 hours after transfection, each well was washed three times with PBS, and 0.6 ml of TROZL was added to the culture dish to collect cells. Total RNA was extracted from cells transfected with ULK2 siRNA and the control group using the RNA isolater and total RNA extraction reagent kit from Nanjing Novizan Biotechnology Co., Ltd. RNA concentration was measured using a nucleic acid quantification instrument. cDNA synthesis was performed according to the reverse transcription kit instructions from Dalian Takara Bio Co., Ltd.

[0037] 2.4 Real-time quantitative PCR detection efficiency of siRNA interference

[0038] The Hi Script III RT Super Mix for qPCR (+g DNA wiper) reagent from Nanjing Novizan Biotechnology Co., Ltd. was used. The SYBR Green I method was employed for real-time quantitative PCR to detect the efficiency of siRNA-specific interference with chicken ULK2 gene expression. Each sample was tested in triplicate. The qPCR reaction program was: 95℃ for 15 min; 40 cycles (94℃ for 15 s, 55℃ for 30 s, 70℃ for 30 s).

[0039] The nucleic acid sequences of the primer pair for ULK2 gene real-time PCR are as follows:

[0040] Upstream primer (SEQ ID NO: 7): 5'-CAGATCAGCCAACTAAGCAA-3'

[0041] Downstream primer (SEQ ID NO: 8): 5'-TTCAGTTTCCCCAATTTGACC-3'

[0042] The nucleic acid sequences of the primer pair for the internal control GAPDH gene in real-time PCR are as follows:

[0043] Upstream primer (SEQ ID NO: 9): 5'-AGAAGGCTGGGGCTCATCT-3'

[0044] Downstream primer (SEQ ID NO: 10): 5'-CAATGCCAAAGTTGTCATG-3'

[0045] The efficiency of siRNA-specific knockdown of chicken ULK2 gene expression is as follows: Figure 3 As shown. By Figure 3 It was found that, compared with the control group, ULK2-1170 siRNA significantly inhibited the expression of the ULK2 gene in cells (P<0.05), with an interference efficiency of over 50%. Subsequent experiments will continue to use ULK2-1170 to investigate the function of the ULK2 gene in chicken leg muscle development. The sense strand of ULK2-1170 is GCGUGAUUCAGAUUGUUCUTT, and the antisense strand is AGACAAUCUGAAUCACGCTT.

[0046] 2.5 Effects of ULK2 gene knockdown on cell proliferation and expression of myoblast differentiation marker genes

[0047] Changes in cell proliferation were detected using a CCK8 assay kit 24 h and 72 h after ULK2-1170 siRNA transfection. Figure 4As shown, transfection with ULK2-1170 siRNA significantly increased the proliferation of chicken primary myoblasts (P<0.05). Four days after transfection, qPCR was used to detect changes in the expression of myoblast differentiation marker genes Myod and Myomarker. Compared with the control group, the expression of Myod and Myomarker genes in the siRNA transfection group was significantly decreased (P<0.01). Figure 5 Experiments have shown that the ULK2 gene promotes the proliferation of primary chicken myoblasts and inhibits the development of chicken leg muscles.

[0048] Myod gene fluorescent quantitative PCR primer pair

[0049] Upstream primer (SEQ ID NO: 11): GCTACTACACGGAATCACCAAAT

[0050] Downstream primer (SEQ ID NO: 12): CTGGGCTCCACTGTCACTCA

[0051] MyoMarker gene fluorescent quantitative PCR primer pair

[0052] Upstream primer (SEQ ID NO: 13): TGGGTGTCCCTGATGGC

[0053] Downstream primer (SEQ ID NO: 14): CCCGATGGGTCCTGAGTAG

[0054] The above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention. Those skilled in the art can make possible changes and modifications to the present invention based on the above-disclosed technical content without departing from the scope of the technical solution of the present invention, or modify it into equivalent embodiments with equivalent changes. Any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention shall fall within the protection scope of the technical solution of the present invention.

Claims

1. The application of siRNA targeting and inhibiting chicken ULK2 gene expression in promoting primary myoblast proliferation, characterized in that, The application involves inhibiting ULK2 gene expression in primary chicken myoblasts to study the gene's regulatory role in cell proliferation and differentiation.

2. The application according to claim 1, characterized in that, The siRNA is ULK2-1170, ULK2-1332, or ULK2-1336; The sequence of the positive chain of the ULK2-1170 is shown in SEQ ID NO: 1, and the sequence of the negative chain is shown in SEQ ID NO: 2; The sequence of the positive chain of ULK2-1332 is shown in SEQ ID NO: 3, and the sequence of the negative chain is shown in SEQ ID NO: 4; The sequence of the positive chain of ULK2-1336 is shown in SEQ ID NO: 5, and the sequence of the negative chain is shown in SEQ ID NO:

6.

3. The application according to claim 1, characterized in that, The specific application involves: designing siRNA for chicken ULK2 gene expression, transfecting the siRNA into chicken primary myoblasts, and using the siRNA to knock down chicken ULK2 gene expression.

4. The application according to claim 1, characterized in that, The specific steps for this application are as follows: Chicken primary myoblasts isolated from leg muscle tissue of 13-year-old chickens were used as transfection cells. The isolated chicken primary myoblasts were seeded into 12-well culture plates. When the cell density grew to 60%, the original culture medium in the culture plate was aspirated and replaced with fresh serum-free culture medium. The siRNA was transfected into the chicken primary myoblasts using the transfection reagent Hiperfect Transfection. The specific transfection system is as follows: 162 uL opti-MEM medium, 5ul of siRNA with a final concentration of 20uM, 8ul of Hiperfect transfection, incubated for 9 minutes to form a transfection complex, and then transfected into the medium.