Key miRNA and application thereof in regulation and control of Liancheng white duck melanogenesis

Abstract

The invention relates to a key miRNA and application thereof in regulation and control of Liancheng white duck melanogenesis, the miRNA is miR-290, the nucleotide sequence of the miRNA is 5 '-CGGGAGCGGAGCUCGGCC-3' (SEQ ID NO: 1), the key miRNA is applied in regulation and control of Liancheng white duck melanogenesis, the miR-290 regulates and controls protein expression of ILK, JAK1, GSK3beta, MC1R, TRP1 and TRP2 in a targeted mode through a PI3K / Akt signal channel, and the key miRNA is applied in breeding of Liancheng white duck melanogenesis. And breeding melanin characters such as black beaks, green feet and the like of Liancheng white ducks. Differential key miRNAs are screened out to serve as regulatory factors for studying proliferation or apoptosis of melanocytes, the effect of the key miRNAs on duck melanocytes and the regulation mode of the key miRNAs on target genes are studied, and meaningful candidate target genes are screened out.

Description

Technical Field

[0001] The present invention belongs to the technical field of agriculture and animal husbandry, and more specifically relates to the screening of key miRNA that affects the melanin production of Liancheng white ducks and the application of the miRNA in regulating the melanin production of Liancheng white ducks. Background Art

[0002] Liancheng White Duck, also known as Baiwu Duck, is one of the precious and rare local waterfowl germplasm resources in China. It is a variant of the small white-feathered Mallard that is characteristic of Fujian Province. It was included in the "Fujian Livestock and Poultry Varieties and Atlas" in 1985 and in the "China Poultry Varieties" in 1989. It was included in the "National Livestock and Poultry Genetic Resources Protection List" in 2000. Liancheng White Duck is known as the "only medicinal duck in the country" because of its effects of clearing away heat and detoxification, nourishing yin and reducing fire, appetizing and strengthening the spleen. The "white feathers, black beak, and green feet" characteristics of Liancheng White Duck are unique among domestic ducks, and it is an ideal model for studying the pigment traits of waterfowl and birds. The applicant's previous research found that when Liancheng White Duck was hybridized with other white-feathered domestic duck breeds such as Beijing Duck and Lijia Duck, all the F1 generations were gray or black, which was clearly different from other white-feathered domestic duck breeds. The specificity and complexity of melanin deposition in Liancheng White Ducks make it difficult to select and breed the melanin traits of Liancheng White Ducks through phenotype. Therefore, analyzing the mechanism of melanin formation at the molecular level can provide a certain reference for the selection and breeding of Liancheng White Duck pigment traits.

[0003] At present, more than 120 genes that regulate melanocyte development and migration, melanosome formation and melanin deposition have been discovered. In addition to these known genes, studies have found that although many miRNAs have been identified in the study and analysis of melanoma cells or samples, and more and more miRNAs are targeting genes or pathways involved in melanocyte biology, the role of most miRNAs in melanocyte biology or melanocyte development has not yet been clarified. In the process of melanogenesis, many miRNAs play a vital role in regulating melanin. In melanocytes, overexpression or inhibition of miR-145 can reduce or increase the expression levels of related genes such as Sox9, MITF, TYR, TRP1, MYO5A, Rab27a and Fscn1. The results show that miR-145 plays an important role in regulating melanogenesis when stimulated by external stimuli. In addition, microRNAs can regulate the proliferation, apoptosis and migration of melanocytes. The upregulation of miR-21 leads to reduced apoptosis and increased proliferation of melanocytes. In alpaca melanocytes, transfection of miR-143-5p reduced the expression level of the target gene TAK1, thereby increasing the migration and proliferation of melanocytes and down-regulating the expression of MITF, thereby regulating the production of melanin.

[0004] The present invention selects Liancheng white duck as the research object, screens out differential key miRNAs as regulatory factors for studying melanocyte proliferation or apoptosis through transcriptome sequencing, studies the effects of key miRNAs on duck melanocytes and the regulatory modes of target genes, screens meaningful candidate target genes, further clarifies the molecular mechanism of melanin deposition in Liancheng white ducks, and provides a certain reference for the breeding of Liancheng white ducks with melanin traits such as black beaks and green feet. Summary of the invention

[0005] The purpose of the present invention is to screen out the key miRNA that affects the melanin production of Liancheng white ducks, and to study the application of miRNA in regulating the melanin production of Liancheng white ducks.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] A key miRNA that affects melanin production in Liancheng white ducks, wherein the miRNA is miR-290, and the nucleotide sequence thereof is: 5'-CGGGAGCGGAGCUCGGCC-3' (SEQ ID NO: 1).

[0008] The key miRNA is used in regulating the melanin production of Liancheng Liancheng white duck, and the miR-290 targets and regulates the protein expression of ILK, JAK1, GSK3β, MC1R, TRP1 and TRP2 through the PI3K / Akt signaling pathway.

[0009] The application of the key miRNA in the breeding of Liancheng white duck melanin traits, such as the breeding of Liancheng white duck melanin traits such as black beak and green feet.

[0010] A detection primer for the key miRNA, wherein the detection primer is:

[0011] Forward primer miR-290-F: 5'-TTCGGGAGCGGAGCTCGG-3' (SEQ ID NO: 2),

[0012] Universal reverse primer: 5'-AGTGCAGGGTCCGAGGTATT-3' (SEQ ID NO: 3).

[0013] The detection primer is used in the breeding of Liancheng white duck melanin traits.

[0014] A kit for detecting the key miRNA comprises the detection primers.

[0015] The kit also includes a reverse transcription primer for miR-290, a reverse transcription reagent, an internal reference primer, and a fluorescent quantitative PCR reaction solution.

[0016] The reverse transcription primer for miR-290 is miR-290-RT, and its sequence is as follows: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCC GA-3' (SEQ ID NO: 4).

[0017] The internal reference primers include the internal reference gene duck U6 reverse transcription primer U6-RT and the internal reference gene duck U6 fluorescence quantitative forward primer U6-F; the sequences of the U6-RT and U6-F are respectively:

[0018] U6-RT:

[0019] 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAA ATATG-3' (SEQ IDNO: 5),

[0020] U6-F: 5'-CTCGCTTCGGCAGCACA-3' (SEQ ID NO: 6).

[0021] The kit is used in the breeding of melanin traits of Liancheng white duck.

[0022] Compared with the prior art, the advantages of the present invention are:

[0023] (1) The present invention screens out differential key miRNAs as regulatory factors for studying melanocyte proliferation or apoptosis, studies the effects of key miRNAs on duck melanocytes and the regulatory modes of target genes, and screens meaningful candidate target genes.

[0024] (2) The present invention screened out the key miRNA that affects duck melanin production through transcriptome sequencing, predicted the target gene, verified the target gene, and studied the application of miR-290, a key factor in melanin production, in duck melanocytes, further elucidating the molecular mechanism of regulating duck melanin production, and providing a certain reference for the breeding of Liancheng white ducks with melanin traits such as black beaks and green feet.

[0025] (3) The present invention separates duck primary melanocytes, transfects miR-290 into duck melanocytes, and then transfects duck melanocytes with mimics-NC, miR-290mimics, inhibitor-NC, and miR-290inhibitor to perform overexpression and interference effect analysis. Fluorescence quantitative PCR was used to detect the expression levels of the target gene PI3K and the key genes AKT, ILK, JAK1, GSK3β, MC1R, TRP1, TRP2, and TYR that affect melanin formation after miR-290 overexpression and interference. The total protein of melanocytes was separated and extracted by protein lysate, and the protein level was analyzed by Western Blot. The results showed that compared with the miR-NC group, the PI3K, AKT, ILK and JAK1 indices in the miR-290 mimics group were significantly downregulated, and the GSK3β, MC1R, TRP1 and TRP2 indices were significantly upregulated (P<0.01, P<0.001, P<0.0001); compared with the inhibitor-NC group, the PI3K, AKT, ILK and JAK1 indices in the miR-290 inhibitor group showed a significant upregulation trend, and the GSK3β, MC1R, TRP1 and TRP2 indices were significantly downregulated (P<0.05, P<0.0001). This suggests that miR-290 may target and regulate the protein expressions of ILK, JAK1, GSK3β, MC1R, TRP1 and TRP2 through the PI3K / Akt signaling pathway.

[0026] (4) The technical solution of the invention is complete and comprehensive, the data is detailed, and the experimental results are reliable. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 It is a targeted relationship verification diagram;

[0028] Figure 2 This is a morphological observation of duck melanocytes;

[0029] Figure 3 The qPCR results after overexpression and interference of miR-290 in duck melanocytes

[0030] Figure 4 These are the qPCR detection results of PI3K, AKT, ILK, JAK1, GSK3β, MC1R, TRP1, TRP2 and TYR genes after overexpression and interference of miR-290 in duck melanocytes.

[0031] Figure 5 The results of WB detection of PI3K, AKT, ILK, JAK1, GSK3β, MC1R, TRP1 and TRP2 after overexpression and interference of miR-290 in duck melanocytes DETAILED DESCRIPTION

[0032] The present invention is described in detail below with reference to the accompanying drawings and embodiments:

[0033] The purpose of the present invention is to screen out the key miRNA that affects the melanin production of Liancheng white ducks, and to study the application of miRNA in regulating the melanin production of Liancheng white ducks. To achieve the above purpose, the present invention adopts the following technical scheme:

[0034] 1.1 Experimental animals and materials

[0035] Six healthy 130-day-old Liancheng white ducks raised under the same feeding conditions were selected and slaughtered after 12 hours of fasting. A portion of skin and mouth skin tissue was quickly put into liquid nitrogen and then placed in a -80℃ ultra-low temperature refrigerator for transcriptome sequencing analysis. Informatics analysis of sequencing data and differentially expressed genes was performed using FastQC, Trinity, HTSeq and other software.

[0036] 1.2 Bioinformatics analysis

[0037] The original data were sequenced and filtered for quality assessment, sRNA length screening, and the reference genome was http: / / www.ensembl.org / Anas_platyrhynchos / Info / Index, BGI_duck_1.0 (GCA_000355885.1). The known mi RNA analysis (mirdeep2_0_0_5), novel mi RNA prediction (miREvo_v1.1), sRNA classification and annotation statistics, mi RNA sequencing copy number conversion to standard expression, and expression difference analysis (DEG Seq 1.2.2) were performed. Differentially expressed miRNAs were screened using the R package of SAM software, and Cluster analysis was performed. miRanda-3.3a, PITA and RNAhybrid were used to predict mi RNA target genes and obtain the correspondence between mi RNA and target genes. Finally, GeneOntology (Release 2.12, GO, http: / / www.geneontology.org / ) and KEGG (Kyoto Encyclopedia of Genes and Genomes) functional annotation analysis of candidate target genes was performed.

[0038] 1.3 Duck melanocyte transfection and total RNA extraction and quality identification

[0039] After cell recovery, the cells were revived in a special culture medium and cultured at 37°C until the confluence reached about 90%. The cells were trypsinized and passaged in a six-well plate at a density of 5×10^5 cells / ml.

[0040] 5 nmol or more of the dissolved miR-290 mimics / NC and miR-290 inhibitor / NC (purchased from Guangzhou Ruibo Biotechnology) were diluted to 50 μM by adding 250 μl RNase-Free ddH2O.

[0041] When the cell confluence reached about 70%, the cells were replaced with fresh serum-free medium; then Lipofectamine TM The cells were transfected with 3000 Transfection Reagent and divided into 5 groups, each with 3 parallel samples. The 5 groups included the control group (untreated group) and groups A, B, C, and D shown in Table 1, wherein group A was the miR-mimics-NC group (transfected with mimics-NC), group B was the miR-290mimics group (transfected with miR-290mimics), group C was the miR-inhibitor-NC group (transfected with inhibitor-NC), and group D was the miR-290-inhibitor group (transfected with miR-290inhibitor). The cell transfection reaction system and reaction conditions are shown in Table 2.

[0042] Table 1 Experimental groups

[0043]

[0044] Table 2 Cell transfection reaction system and conditions

[0045]

[0046] On the second day, the culture medium was changed to a special melanocyte complete culture medium and culture was continued for 72 hours, and samples were collected for quantitative PCR and Western Blot analysis.

[0047] Total RNA was extracted from cells in each group using TRIzol Regent, and the RNA concentration and purity were detected using NanoDrop2000 ultra-micro spectrophotometer, while its integrity was detected using 1% agarose electrophoresis.

[0048] 1.4 Detection of miR-290 expression level by quantitative PCR

[0049] 1) miRNA reverse transcription: The miRNA 1st Strand cDNA Synthesis Kit was used for stem-loop reverse transcription. The primers are shown in Table 3. The reaction system and conditions were as follows: 500 ng total RNA, 2 μl gDNA Wiperbuffer, RNase-free H2O was added to 8 μl, and the mixture was treated at 42°C for 2 min; then 2 μl HiScript II Enzyme Mix, 2 μl RTBuffer, 1 μl miR-290-RT (2 μM) or U6-RT (2 μM) (internal reference) were added, and finally RNase-free H2O was added to 20 μl. The mixture was placed in a PCR instrument at 25°C for 5 min, 50°C for 15 min, and 85°C for 5 min; then stored at 4°C for later use.

[0050] 2) Fluorescence quantitative PCR detection: duck U6 was used as the internal reference gene, and the forward primer sequence is shown in Table 4. Fluorescence quantitative PCR was performed using PowerUp SYBR TM Green MasterMix Kit, reaction system: 10 μl PowerUpSYBR TM GreenMasterMix, 4μl cDNA (cDNA stock solution was diluted 1:10), 0.5μl forward primer (10μM), 0.5μl universal reverse primer (10μM) (sequence: 5'AGTGCAGGGTCCGAGGTATT 3', SEQ ID NO:3), and finally H2O was added to 20μl. The reaction conditions were: 95℃, 1min; 95℃, 15sec, 60℃, 25sec, a total of 40 cycles. Three replicates were set for each sample, and the relative expression was measured using 2 -ΔΔCt Method for computational analysis.

[0051] Table 3 miRNA reverse transcription stem-loop primer sequences, quantitative PCR forward primers

[0052]

[0053] Wherein, the nucleotide sequence of miR-290 is: 5'-cgggagcggagcucggcc-3' (SEQ ID NO: 1).

[0054] 1.5 Isolation and culture of primary duck beak melanocytes

[0055] Soak the duck beak in alcohol for 10 minutes, remove the duck beak with tweezers and place it in a culture dish, and wash it with PBS several times. Carefully remove the epidermis on the duck beak with tweezers, put the skin containing melanocytes into a culture dish containing 3% double antibody Hanks solution, use ophthalmic scissors to cut the skin containing melanocytes into 1mm×1mm fragments, wash it with Hanks solution without double antibody, discard the supernatant, and repeat the washing 3 times. Digest with 2% DispaseⅡ, digest for 110 minutes, and then digest with trypsin for 10 minutes. After digestion, add complete culture medium to terminate digestion, centrifuge to remove supernatant, repeat 2 times, pass through a 200 mesh sieve, and finally resuspend with complete culture medium and culture in a six-well plate. After 12 hours of culture, discard the culture medium, and then replace the culture medium every 2-3 days until the cells are completely fused. After the cells are full, use 0.25% trypsin containing EDTA to digest the cells at a ratio of 1:2, and cell identification is performed after the 5th generation.

[0056] 1.6 Detection of PI3K, AKT, ILK, JAK1, GSK3β, MC1R, TRP1, TRP2 and TYR gene expression levels by fluorescence quantitative PCR

[0057] cDNA synthesis: Reverse Transcription Kit was used to reverse transcribe the extracted total RNA into cDNA. The reaction system and conditions were as follows: 500 ng total RNA, 2 μl gDNA Wiper buffer, 14 μl RNase-free H2O was added and the mixture was incubated at 42°C for 10 min and stored at 4°C for later use.

[0058] Fluorescence quantitative PCR detection: duck β-actin was used as the internal reference gene. The specific primer sequences of the internal reference gene and the target gene fluorescence quantitative PCR are shown in Table 4. Fluorescence quantitative PCR was performed using PowerUp SYBR TM Green Master Mix Kit, reaction system: 10 μl PowerUp SYBR TM Green Master Mix, 1 μl cDNA, 0.5 μl forward primer (10 μM), 0.5 μl reverse primer (10 μM), add H2O to 20 μl. Reaction conditions: 95°C, 1 min; 95°C, 15 sec, 63°C, 25 sec, 40 cycles in total. Three replicate wells were set for each sample, and the relative expression was calculated using 2 (Ct内参基因－Ct目的基因) Perform computational analysis.

[0059] Table 4 Quantitative PCR gene name, gene sequence number, primer sequence and amplification length

[0060]

[0061]

[0062] Statistical processing

[0063] SPSS 19.0 software was used for statistical analysis. The results were expressed as mean ± standard deviation (Mean ± SD). The independent sample t test was used for comparison between the groups. When P < 0.05 (*), the difference was considered significant, and when P < 0.01 (**), the difference was considered extremely significant.

[0064] 1.7 Western Blot detection of protein levels

[0065] Take the cells after 72 hours of transfection, lyse them with RIPA cell lysis buffer, extract total protein and quantify. Take 60 μg of total protein, add 5× protein loading buffer (containing DTT), treat with boiling water for 10 minutes, then load for SDS-PAGE electrophoresis, transfer to PVDF membrane, and then block with 5% skim milk powder at room temperature for 1 hour, add primary antibody, shake at 4°C overnight, rinse with T-TBS, add secondary antibody, incubate at room temperature for 1 hour, rinse with T-TBS several times, and finally add ECL chemiluminescent reagent to expose and develop in the dark room. After scanning, use Image Pro Plus 6.0 software to analyze the optical density of each band. Each band is repeated 3 times. The relative expression of the target protein = {target protein (optical density value) / internal reference (optical density value)}×10 is expressed, and the results are expressed as mean ± standard deviation.

[0066] Table 5 Western Blotting primary and secondary antibody information

[0067]

[0068]

[0069] The present invention screens out differential key miRNAs as regulatory factors for studying melanocyte proliferation or apoptosis, studies the effects of key miRNAs on duck melanocytes and the regulatory modes of target genes, screens meaningful candidate target genes, further clarifies the molecular mechanism of melanin deposition in Liancheng white ducks, and provides a certain reference for the breeding of Liancheng white ducks with melanin traits such as black beaks and green feet.

[0070] 2. Experimental results

[0071] 2.1 Transcriptome sequencing to screen differential miRNAs, functional annotation, and prediction of miRNA target genes

[0072] RNA-Seq sequencing was performed on the skin and skin tissues of Liancheng white ducks by Illumina PE150. A total of 12 differential miRNAs were screened out in the skin and skin tissues of Liancheng white ducks, of which 7 were upregulated and 5 were downregulated. Some KEGG annotation data of differentially expressed miRNAs target genes showed that the herpes simplex virus type 1 infection pathway, MAPK signaling pathway, focal adhesion signaling pathway, NOD-like receptor pathway, and RIG-I-like receptor signaling pathway in the LCZvsLCP group were significantly different (P<0.05). The miRNAs novel_144, novel_146, novel_197, novel_201, novel_290 (miR-290), novel_351, and novel_353 corresponding to the target gene PI3K on the herpes simplex virus type 1 infection pathway may inhibit the production of tissue melanin.

[0073] 2.2 Validation of the relationship between miR-novel-290 (miR-290) and PI3K targeting

[0074] The potential interaction sites between miR-290 and PI3K were predicted. By constructing a reporter plasmid for the potential interaction sites of PI3K, the interaction between PI3K and miR-290 was further verified using the dual luciferase reporter system. The results are as follows Figure 1 shown.

[0075] The results showed that compared with the miR-NC / miR-290-Wt co-transfection group, the relative fluorescence value of the miR-290 / PI3K-Wt co-transfection group was decreased (P<0.01); compared with miR-NC / PI3K-Mut, the relative fluorescence value of miR-290 / PI3K-Mut was decreased, with no significant difference (P<0.05); compared with miR-290 / PI3K-Wt, the relative fluorescence value of miR-290 / PI3K-Mut was significantly increased (P<0.01). These results indicate that miR-290 effectively binds to the 3-UTR region of the PI3K gene, and the mutation affects the binding ability between the two.

[0076] 2.3 Observation of duck melanocyte morphology

[0077] One week after primary cell separation, the cells were photographed under an inverted microscope and observed to be long spindle-shaped, connected in a network-like interweaving distribution, and the cells could be passaged (see Figure 2 ).

[0078] 2.4 Analysis of miR-290 overexpression and interference effects in duck melanocytes

[0079] According to the results of 1.4 fluorescence quantitative PCR, compared with the mimics-NC transfection group, the miR-290 mimics transfection group was upregulated by 1.88 times, and the difference was statistically significant (P<0.001); similarly, compared with the inhibitor-NC transfection group, the miR-290 inhibitor transfection group was downregulated by 0.46 times, and the difference was statistically significant (P<0.01). For specific results, see Figure 3 .

[0080] 2.5 Detection of PI3K, AKT, ILK, JAK1, GSK3β, MC1R, TRP1, TRP2 and TYR gene expression levels in duck melanocytes

[0081] In part 1.6, fluorescence quantitative PCR was used to detect the expression levels of PI3K, AKT, ILK, JAK1, GSK3β, MC1R, TRP1, TRP2 and TYR after miR-290 overexpression and interference. The results showed that compared with their respective controls, the expression levels of PI3K and AKT genes in the miR-290 mimics group were downregulated (P<0.05, P<0.01), and the expression levels of ILK, GSK3β, MC1R, TRP1, TRP2 and TYR genes were upregulated (P<0.001, P<0.0001), and there was no difference in the JAK1 index; in the miR-290 inhibitor group, the expression levels of PI3K and AKT genes were upregulated (P<0.05, P<0.01), and the expression levels of ILK, GSK3β, MC1R, TRP1, TRP2 and TYR genes were downregulated (P<0.05, P<0.01), and there was no difference in the JAK1 index. For specific results, see Figure 4 The original data are shown in the attachment. It is inferred that the expression of miR-290 is negatively correlated with PI3K and AKT, positively correlated with ILK, GSK3β, MC1R, TRP1, TRP2 and TYR, and may not be correlated with JAK1.

[0082] 2.6 Detection of PI3K, AKT, ILK, JAK1, GSK3β, MC1R, TRP1 and TRP2 protein expression levels in duck melanocytes

[0083] In part 1.7, Western Blot was used to analyze the protein expression levels of PI3K, AKT, ILK, JAK1, GSK3β, MC1R, TRP1 and TRP2 in the mimics-NC, miR-290mimics, inhibitor-NC and miR-290inhibitor groups. The results showed that compared with the mimics-NC group, the PI3K and AKT indicators in the miR-290mimics group were significantly downregulated (P<0.001, P<0.0001), there was no difference in the JAK1 indicator, and the ILK, GSK3β, MC1R, TRP1 and TRP2 indicators were significantly upregulated (P<0.05, P<0.01, P<0.001, P<0.0001). Compared with the inhibitor-NC group, the PI3K and AKT indexes in the miR-290inhibitor group showed a significant up-regulation trend (P<0.01, P<0.0001), the JAK1 index had no difference, and the ILK, GSK3β, MC1R, TRP1 and TRP2 indexes were significantly down-regulated (P<0.05, P<0.01, P<0.001). Figure 5 The original data are shown in the attachment. This suggests that miR-290 may target and regulate the protein expressions of ILK, GSK3β, MC1R and TYR through the PI3K / Akt signaling pathway.

[0084] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A key miRNA that affects melanin production in Liancheng white duck, characterized by: The miRNA is miR-290, and its nucleotide sequence is: 5'-CGGGAGCGGAGCUCGGCC-3' (SEQ ID NO: 1).

2. The use of the key miRNA as claimed in claim 1 in regulating the melanin production of Liancheng Liancheng white duck, characterized in that: The miR-290 targets and regulates the protein expressions of ILK, JAK1, GSK3β, MC1R, TRP1 and TRP2 through the PI3K / Akt signaling pathway.

3. Application of the key miRNA as described in claim 1 in the breeding of Liancheng white duck melanin traits.

4. A detection primer for a key miRNA as claimed in claim 1, characterized in that: The detection primers are: Forward primer miR-290-F: 5′-TTCGGGAGCGGAGCTCGG-3′, Universal reverse primer: 5'-AGTGCAGGGTCCGAGGTATT-3'.

5. Use of the detection primer as claimed in claim 4 in the breeding of Liancheng white duck melanin trait.

6. A kit for detecting the key miRNA as claimed in claim 1, characterized in that: It comprises the detection primer described in claim 4.

7. The kit according to claim 6, characterized in that: The kit also includes a reverse transcription primer for miR-290, a reverse transcription reagent, an internal reference primer, and a fluorescent quantitative PCR reaction solution.

8. The kit according to claim 7, characterized in that: The reverse transcription primer for miR-290 is miR-290-RT, and its sequence is as follows: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCC GA-3'.

9. The kit according to claim 7, characterized in that: The internal reference primers include the internal reference gene duck U6 reverse transcription primer U6-RT and the internal reference gene duck U6 fluorescence quantitative forward primer U6-F; the sequences of the U6-RT and U6-F are respectively: U6-RT: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAA ATATG-3', U6-F: 5'-CTCGCTTCGGCAGCACA-3'.

10. Use of the kit as described in any one of claims 6 to 9 in the breeding of Liancheng white duck melanin traits.

Images