A soluble expression vector of a steroid C14 alpha hydroxylase and its construction method and application

Abstract

The application relates to a soluble expression vector of a steroid C14 alpha hydroxylase and a construction method and application thereof, and belongs to the technical field of biotechnology. A nucleic acid sequence coding a steroid C14 alpha hydroxylase and a nucleic acid sequence coding a soluble label maltose binding protein are expressed in a vector, the nucleic acid sequence coding the steroid C14 alpha hydroxylase is shown as SEQ ID NO. 1, and the amino acid sequence of the steroid C14 alpha hydroxylase is shown as SEQ ID NO. 2. The application establishes a soluble expression vector and a method of a fungus-derived enzyme in Escherichia coli, and provides a new idea for obtaining solubility of other CYP enzymes in the heterologous expression of Escherichia coli. The application significantly improves the electron transfer efficiency of the hydroxylation process by constructing an intramolecular hydrogen delivery system, and partially solves the problem of low overall catalytic rate caused by low electron transfer efficiency in the catalytic reaction of P450 monooxygenase.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a soluble expression vector for steroidal C14α hydroxylase, its construction method, and its application. Background Technology

[0002] Steroids are a large class of natural or synthetic terpenoid lipids, including bile acids, sex hormones, and adrenocortical hormones, possessing various physiological and pharmacological activities. Their applications in the medical field are constantly expanding and they are widely used in clinical practice. In recent years, more than 300 steroid molecules have been approved for drug development. Based on the structural differences and different arrangements of the functional groups attached to the steroid nucleus, steroid molecules possess complex structures and specific physiological functions. Among these, the hydroxylated structure is often a key functional group for active steroid drugs. Therefore, achieving selective hydroxylation of steroid drugs is a crucial step in the synthesis of active steroid drugs. Biocatalytic hydroxylation is one of the important transformations in steroid nucleocyclic functionalization, but it remains a very challenging task in organic synthesis.

[0003] Among various steroid hydroxylation sites, C14-OH endows steroids with specific anti-gonadotropic and carcinogenic biological activities. Fungal cell-catalyzed C14 hydroxylation reactions of steroids have been widely used over the past few decades. Strains with 14α-hydroxylation capabilities were first discovered in fungi, including *Curvularia lunata*, *Mucor piriformis*, *Gongronella butleri*, *Chaetomium*, and *Absidia coerulea*. However, it wasn't until 2019 that the cytochrome P450 (CYP) family protein P450 from *Cochliobolus lunatus* was first reported. lun The enzyme was identified as having 14α-hydroxylation capacity. Heterologous expression of this enzyme and its electron transport chain cytochrome P450 reductase (CPR) in *Saccharomyces cerevisiae* resulted in the conversion of substrates AD and RSS into 14α-AD and 14α-RSS, respectively. Carmen will subsequently report on the previously reported P450... lun Heterologous expression in Mycobacterium smegmatis enabled the 14-position hydroxylation of AD and ADD.

[0004] Escherichia coli (E. coli) possesses advantages such as rapid growth, low culture medium cost, high cell density, ease of genetic manipulation, and extensive knowledge of its genetics and physiology, making it a preferred bacterial host for exogenous protein expression. Furthermore, unlike other fungi (such as Streptomyces), E. coli does not possess endogenous CYP proteins, thus avoiding interference with exogenous CYP expression. However, all reported enzymes with C14α-hydroxylation activity are fungal in origin and are membrane-bound proteins. Due to the lack of membrane structure and post-translational modification functions in E. coli, complex proteins are often expressed non-functionally as inclusion bodies. Moreover, because the E. coli system lacks a reductase system for CYP-catalyzed hydroxylation, soluble expression and catalytic function of C14 hydroxylases in E. coli have not yet been achieved.

[0005] This invention aims to develop a soluble expression method for fungal steroid C14 hydroxylase, and to construct a self-sufficient electron transport system and coenzyme cycle system through genetic engineering strategies to achieve functional expression of Escherichia coli chassis and selective hydroxylation of steroidal compounds at C14, thereby expanding the biotransformation route for active steroidal drug intermediates. Summary of the Invention

[0006] To address the problems existing in the prior art, the present invention aims to design and provide a soluble expression vector for steroidal C14α hydroxylase, its construction method, and its application. To solve the problem of insoluble, non-functional expression of fungal membrane-bound CYP proteins in *E. coli*, this invention improves the soluble expression of CYP enzymes by truncating the N-terminus of the protein sequence and replacing it with a soluble tag, maltose-binding protein. An intramolecular electron transport system is constructed through screening the linker sequence of the fusion protein, significantly improving the electron transport efficiency of the hydroxylation reaction. Furthermore, a coenzyme NADPH cycle system is established by coupling glucose dehydrogenase, reducing the dependence on exogenous coenzyme addition and the reaction cost. Through the soluble expression strategy established by this invention, the soluble expression and intramolecular electron transport of fungal C14α hydroxylase and its electron transport components are achieved. The catalytic activity of C14α hydroxylase is significantly enhanced through multi-enzyme in vitro cascade catalysis, resulting in a significantly higher product yield.

[0007] The present invention is specifically implemented using the following technical solutions:

[0008] The first aspect of this invention provides a method for constructing a soluble expression vector for steroidal C14α hydroxylase. The method involves expressing the nucleic acid sequence encoding steroidal C14α hydroxylase and the nucleic acid sequence encoding a soluble tag maltose-binding protein (MBP) in the vector. The nucleic acid sequence encoding steroidal C14α hydroxylase is shown in SEQ ID NO.1, and the amino acid sequence of steroidal C14α hydroxylase is shown in SEQ ID NO.2.

[0009] A second aspect of the present invention provides a soluble expression vector for steroidal C14α hydroxylase obtained by the above construction method.

[0010] A third aspect of the present invention provides an intramolecularly coupled artificial electron transport system, which is obtained by constructing a CYP-linker-CPR fusion protein in a soluble expression vector of the aforementioned steroidal C14α hydroxylase, wherein the linker sequence used to construct the fusion protein is one of the following:

[0011] (1) ARA;

[0012] (2) LPPPP;

[0013] (3)STEQSAKKVRKKA.

[0014] The fourth aspect of the present invention provides the application of the above-described artificial electron transport system in promoting the P450 enzyme-catalyzed steroid hydroxylation reaction.

[0015] The fifth aspect of the present invention provides a method for the hydroxylation reaction of P450 enzyme, which utilizes the above-described artificial electron transport system for catalytic reaction.

[0016] The sixth aspect of the present invention provides a genetically engineered bacterium, comprising Escherichia coli and a target gene transferred into Escherichia coli, wherein the target gene is fused to express a fusion protein in the form of CYP-linker-CPR.

[0017] The seventh aspect of this invention provides the application of genetically engineered bacteria in promoting the hydroxylation reaction of steroids catalyzed by P450 enzymes.

[0018] Furthermore, this application uses the wet bacterial cells obtained by fermentation culture of the genetically engineered bacteria, or the crude enzyme solution extracted after ultrasonic disruption of the wet bacterial cells, or the purified enzyme solution as a catalyst, and progesterone as a substrate to carry out the catalytic reaction.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] 1) This invention establishes a soluble expression vector and method for fungal enzymes in Escherichia coli, providing a new approach for obtaining soluble components when heterologously expressing other CYP enzymes in Escherichia coli.

[0021] 2) By constructing an intramolecular hydrogen transfer system, this invention significantly improves the electron transfer efficiency of the hydroxylation process (by 2.5-3 times), partially solving the problem of low overall catalytic rate caused by low electron transfer efficiency in the P450 monooxygenase catalytic reaction.

[0022] 3) This invention also established an in vitro multi-enzyme reaction system. Combined with a coenzyme coupling system, the reducing power in the P450 monooxygenation reaction achieved efficient cycling. The yield of 14α-OH-PG in a 10 mL reaction system was measured to be 34.9 mg / L, with a conversion rate of 26.5%. Attached Figure Description

[0023] Figure 1 This is a diagram of the plasmid for the recombinant expression vector.

[0024] Figure 2 SDS-PAGE analysis for Example 3. M: Protein Marker; I: MBP-P450 aq Upper cleaning; 2: MBP-P450 aq Precipitation; 3: MBP-P450 bo Upper cleaning; 4: MBP-P450 bo Precipitation; 5: MBP-P450 bm Upper purifier; 6: MBP-P450 bm Precipitation; 7: MBP-P450 lun Shangqing; 8: MBP-P450 lun precipitation.

[0025] Figure 3 SDS-PAGE analysis of the purified enzyme. M: Protein Marker; 1: Whole-cell CYP expression; 2: Miscellaneous proteins; 3: CYP purified enzyme.

[0026] Figure 4 The electron transfer efficiency of the fusion protein.

[0027] Figure 5 High-performance liquid chromatography (HPLC) chromatograms of the selective hydroxylation of progesterone to synthesize the target product using the supernatant of recombinant Escherichia coli cell lysate. Detailed Implementation

[0028] The present invention will be further described in detail below with reference to specific embodiments, but the present invention is not limited to the following embodiments. The implementation conditions used in the embodiments can be further adjusted according to different requirements of specific use, and the implementation conditions not specified are those in conventional experiments.

[0029] Example 1: Construction of Recombinant Vector

[0030] The enzyme gene sequence selected from *Bipolaris oryzae* was codon-optimized, and then synthesized as a whole gene (nucleotide sequence as shown in SEQ ID NO.1, amino acid sequence as shown in SEQ ID NO.2). This synthesized gene was then transferred into the vector pET28a(+) between the NcoI and XhoI sites to obtain pET28a(+)-P450. boThe plasmid was transferred into E. coli BL21(DE3) to obtain E. coli BL21(DE3) / P450. bo .

[0031] Example 2: Construction of soluble steroidal C14α-hydroxylase

[0032] With P450 bo Using the enzyme gene as a template, primers 1 and 2 were designed and ligated into the pET28a(+) plasmid by PCR to obtain the recombinant vector pET28a(+)-P450. bo .

[0033] Primer 1 gene sequence: CCGAAACTGCAGCTGAACGC

[0034] Primer 2 gene sequence: TTACACAACAACGCGTTTAA

[0035] Using the MBP enzyme gene from *E. coli* as a template (nucleotide sequence shown in SEQ ID NO.3), a TEV restriction site was added, and primers 3, 4, and 5 were designed to obtain the MBP-TEV target fragment.

[0036] Primer 3 gene sequence:

[0037]

[0038] Primer 4 gene sequence:

[0039]

[0040] Primer 5 gene sequence:

[0041]

[0042] The recombinant vector pET-28a(+)-P450 bo Linearization was performed, and the target fragment MBP-TEV was added to obtain the recombinant vector pET-28a(+)-MBP-TEV-P450. bo The construction process is as follows Figure 1 As shown.

[0043] The recombinant vector pET28a+-MBP-TEV-P450 bo The recombinant vector pET-28a(+)-MBP-TEV-P450 was transformed into *Escherichia coli* BL21(DE3) strain and plated onto LB agar containing kanamycin, then incubated overnight. Sequencing revealed the recombinant vector pET-28a(+)-MBP-TEV-P450. bo Successfully transformed into Escherichia coli BL21(DE3) strain.

[0044] Example 3: Induced and soluble expression of recombinant bacteria

[0045] Select a verified single colony and inoculate it into a test tube for overnight culture. Inoculate 1% of the colony into 100 mL of fresh LB medium and add 100 μL of kanamycin. Incubate at 37 °C and 160 rpm with shaking for 2 h. Then add 100 μL of IPTG (concentration of 500 mg / mL) and induce for 24 h at 20 °C and 150 rpm. Collect the bacterial culture.

[0046] Routine protein soluble expression analysis was performed on the recombinant bacteria. The cells were centrifuged at 8000 rpm for 10 min, the supernatant was discarded, and the cells were resuspended in Tris-HCl buffer at a concentration of 25 g / L. The cells were then sonicated on ice for 15 min, with a 2-second sonication time followed by a 4-second rest interval. 200 μL of the lysate was centrifuged at 12000 rpm for 10 min to separate the supernatant and precipitate. The precipitate was washed twice with an equal volume of buffer and resuspended. The supernatant and precipitate samples were then subjected to SDS-PAGE protein electrophoresis. The soluble expression of the target protein was determined based on the gel electrophoresis results. Figure 2 As shown, using this strategy, soluble expression of fungal-derived hydroxylases can be achieved in Escherichia coli, with the content of soluble proteins increasing to 40-60%.

[0047] Example 4: Enzyme isolation and purification

[0048] Preparation of the crude enzyme solution according to the present invention: The recombinant genetically engineered bacteria prepared by the method of Example 3 were resuspended in 9.8 mL of 100 mM potassium phosphate buffer solution (pH 7.0) at a concentration of 0.2 g of wet bacterial cells. The cells were then ultrasonically disrupted under ice bath conditions (20 W, 40% power, continuous for 2 s, intermittent for 4 s, continuous disruption for 15 min) to obtain cell lysate. The cell lysate obtained after ultrasonic disruption was centrifuged at 12000 rpm and 4℃ for 10 min, and the supernatant obtained was the crude enzyme solution.

[0049] Pure enzyme solution: The strain was fermented in a 2L shake flask containing 600mL LB medium until OD reached. 600 When the bacterial growth rate reaches 0.6-0.8, IPTG is added to a final concentration of 0.5 mM, and expression is induced at 28℃ for 24 h. Wet cells are collected by centrifugation, then sonicated, centrifuged again, and filtered to remove impurities to obtain a crude enzyme solution. The crude enzyme solution is then purified by affinity chromatography using an AKTA protein separator to obtain a pure enzyme solution. Figure 3 As shown, the SDS-PAGE results indicate that after purification, CPR... lun The protein is approximately 72 kDa, consistent with the theoretical size. (CPR) lun After deleting the N-terminal transmembrane region and expressing it, CPR can be observed.lun Most of it exists in the soluble form.

[0050] Example 5: Self-sufficient fusion protein P450 bo -linker-CPR lun Construction and screening

[0051] The purified linker-CPR lun The amplified fragment and the linearized pET28a-MBP-P450 plasmid were cloned in one step and verified by colony PCR. The fragment was approximately 2000 bp, i.e., linker-CPR. lun The target gene was successfully inserted into the linearized plasmid. Single colonies were picked and sequenced, and the insertion into the vector was confirmed.

[0052] The linker sequence can be one of the following:

[0053] (1) ARA;

[0054] (2) LPPPP;

[0055] (3)STEQSAKKVRKKA.

[0056] CPR lun The nucleotide sequence is shown in SEQ ID NO.4.

[0057] The primer designs are shown in the table below:

[0058]

[0059] The collected wet bacterial cells were resuspended in buffer, sonicated, and diluted to a concentration of 1 g / L. 1 mM PG and 10 mM NADPH were prepared, and 180 μL of linker fusion protein disruption buffer and 10 μL of PG were added to bring the total reaction volume to 200 μL. After adding NADPH, the rate of decrease in absorbance at 340 nm over 3 minutes was rapidly detected using a microplate reader, and comparisons were made between different groups. The results are shown below. Figure 4 As shown, when the molar ratio of CPR to CYP is 3:1, the electron transfer efficiency is significantly improved, which is twice that of the control group of 1:1. Constructing an intramolecular transfer system by linker can also significantly improve the electron transfer efficiency, among which linker3 has the most obvious effect, with the overall efficiency increasing by 2.8 times.

[0060] Example 6: P450 bo Analysis of catalytic progesterone production products

[0061] The induced expression of the recombinant bacteria was carried out as shown in Example 3. A 10 mL whole-cell catalytic reaction was performed in a 50 mL Erlenmeyer flask. The components were added according to Table 1. During the reaction, the enzyme solution and substrate were added first, and the coenzyme was added last to start the reaction. The catalytic conditions were 30 °C, 160 rpm, and 96 h. Samples were taken every 24 h, extracted with an equal volume of ethyl acetate, mixed with a shaker, and the supernatant was dried in an oven and dissolved in an equal volume of methanol. The solution was filtered into a liquid chromatography bottle using a 0.22 μm microporous membrane. The ability of the strain to generate 14α-OH-PG was detected using high performance liquid chromatography.

[0062] Table 1: Whole-cell catalytic reactions

[0063]

[0064] Sample preparation and HPLC detection: The liquid chromatography instrument was an Agilent G7115A. The product 14α-OH-PG was dissolved in methanol. The mobile phase was methanol:water = 80:20. The column temperature was 42℃, the detection wavelength was 254nm, the flow rate was 1mL / min, and the injection time was 12min. Figure 5 As shown, the HPLC results indicate the presence of the target product 14α-OH-PG at 4.0 min, with the elution time corresponding to that of the standard. An accumulation of byproduct peaks is observed at 4.2 min, which may be hydroxylation products from other sites.

[0065] Example 7: Construction of a glucose dehydrogenase-coenzyme regeneration system

[0066] pET-28a-MBP-P450 bo pET-28a-CPR and pET-28a-GDH are expressed respectively. When glucose is used as a substrate, glucose dehydrogenase can convert NADP... + It is converted to NADPH and promotes normal hydroxylation reactions. Since glucose dehydrogenase generates acidic gluconolactone during the reaction, an appropriate amount of 3M NaOH needs to be added to stabilize the pH. Through single-factor optimization, the components of the three-enzyme cycling system were added as shown in Table 2, with a total volume of 10 mL. The molar ratio of CYP-CPR to GDH was 3:1, and the pH was adjusted every 6 hours to maintain it at 7.2-7.4. The cumulative concentration of the product was finally detected by liquid chromatography. The results showed that using this reaction system, the cumulative concentration of the final product 14α-OH-PG was 34.9 mg / L.

[0067] Table 2: Coenzyme Regeneration Cycle System

[0068]

Claims

1. The application of a soluble expression vector for steroid C14α hydroxylase in catalyzing the hydroxylation reaction of steroid C14α, characterized in that, The nucleic acid sequence encoding steroid C14α hydroxylase and the nucleic acid sequence encoding a soluble tag maltose-binding protein were expressed in the soluble expression vector. The nucleic acid sequence encoding steroid C14α hydroxylase is shown in SEQ ID NO.1, and the amino acid sequence of steroid C14α hydroxylase is shown in SEQ ID NO.

2.

2. The application of an intramolecularly coupled artificial electron transport system in the catalytic C14α hydroxylation reaction of steroids, characterized in that, The artificial electron transport system is obtained by constructing a CYP-linker-CPR fusion protein in a soluble expression vector of the steroidal C14α hydroxylase as described in claim 1, wherein the amino acid sequence of the linker used to construct the fusion protein is any of the following: (1) ARA; (2) LPPPP; (3) STEQSAKKVRKKA; The CPR is cytochrome P450 reductase, and the CYP is the steroidal C14α hydroxylase described in claim 1.

3. The application of a genetically engineered bacterium in catalyzing the C14α hydroxylation reaction, wherein the genetically engineered bacterium comprises *Escherichia coli* and a target gene transferred into *E. coli*, characterized in that... The target gene is fused to express the CYP-linker-CPR fusion protein of claim 2.

4. The application as described in claim 3, characterized in that, The reaction is carried out using the wet bacterial cells obtained by fermentation culture of the genetically engineered bacteria, or the crude enzyme solution extracted by ultrasonic disruption of the wet bacterial cells, or the purified enzyme solution as a catalyst and progesterone as a substrate.

Images