An in situ detection method for improving RNA detection efficiency

Abstract

The present application relates to the technical field of in situ detection of nucleic acids, and specifically to an in situ detection method for improving the efficiency of RNA detection. In the in situ detection method, no RNase inhibitor is added to each enzyme reaction step. After multiple experimental verifications, the present application proposes a solution that does not require the use of RNase inhibitors compared to related technologies. On the one hand, it can improve the detection signal-to-noise ratio and detection efficiency of RNA in situ detection on tissues, which helps to improve the sensitivity of the method; on the other hand, since there is no need to use RNase inhibitors, it can effectively save reagent costs as a whole; furthermore, it can also simplify the operating procedures.

Description

Technical Field

[0001] The present application relates to the technical field of in situ detection of nucleic acids, and in particular to an in situ detection method for improving RNA detection efficiency. Background Art

[0002] Since RNA enzymes are widely present in the environment, RNA in ex vivo tissues is very easy to degrade. Therefore, in previous RNA in situ detection technologies, such as the earliest in situ sequencing technology, improved in situ sequencing and in situ hybridization, RNA enzyme inhibitors are required to inhibit the activity of endogenous RNA enzymes in tissues or exogenous RNA enzymes in the environment, prevent RNA from being rapidly degraded by RNA enzymes, thereby keeping RNA in the original tissue as much as possible and improving the detection efficiency of subsequent RNA to be tested.

[0003] In the in situ detection technology, RNase inhibitors are usually used in each enzyme reaction step. They are recombinant products expressed and purified in Escherichia coli in a soluble form. For example, RiboLock RNase inhibitor (manufacturer: Thermo, catalog number EO0384) can bind to RNases A, B, and C in a 1:1 ratio non-competitively, thereby inhibiting their activity, but will not inhibit eukaryotic RNase T1, T2, U1, U2, CL3 and prokaryotic RNase I and H, and therefore has been widely used.

[0004] However, on the one hand, the detection efficiency of the in-situ detection method in the related technology is low; on the other hand, RNA enzyme inhibitors need to be added to each enzyme reaction in the related technology, and the RNA enzyme requires a trace amount, which is inconvenient to operate; furthermore, due to the use of RNA enzyme inhibitors, the reagent cost of the in-situ detection technology has been increased to a certain extent. Therefore, how to maintain a high detection efficiency while ensuring low cost has been a research hotspot in recent years. Summary of the invention

[0005] The present application provides an in situ detection method for improving RNA detection efficiency.

[0006] After multiple experimental verifications, the present application proposes a solution that does not require the use of RNase inhibitors compared to related technologies. On the one hand, it can improve the detection signal-to-noise ratio and detection efficiency of in situ RNA detection on tissues, which helps to improve the sensitivity of the method; on the other hand, since there is no need to use RNase inhibitors, it can effectively save reagent costs overall; furthermore, it can also simplify the operating procedures.

[0007] Figure 1 The technical roadmap for in situ sequencing methods is shown in Figure 2. Figure 1As shown, the technical route is: first use the double-linked probe and the target RNA to hybridize, and then perform rolling circle amplification after linking into a ring; then use the generated rolling circle amplification product as a sequencing template, and after multiple rounds of fluorescence imaging and decoding, obtain the expression level and spatial position information of each target RNA. The related technology requires the addition of RNase inhibitors in multiple steps such as probe ring formation and rolling circle amplification, while the present application does not need to add RNase inhibitors in the above corresponding steps, and the other steps can remain consistent with the related technical solutions.

[0008] The present application provides an in situ detection method for improving RNA detection efficiency, which adopts the following technical solutions:

[0009] An in-situ detection method for improving RNA detection efficiency, wherein no RNA enzyme inhibitor is added in each enzyme reaction step in the in-situ detection method.

[0010] Optionally, the in situ detection method first uses a double-ligated probe to hybridize with the target RNA, and then performs rolling circle amplification after ligation into a circle; then the generated rolling circle amplification product is used as a sequencing template, and after multiple rounds of fluorescence imaging and decoding, the expression level and spatial position information of each target RNA are obtained.

[0011] Optionally, the in situ detection method comprises the following steps: double ligated probe hybridization, double ligated probe circularization, rolling circle amplification and fluorescent probe detection; the double ligated probe circularization uses a ligation reaction mixture and a circularization mixture; the rolling circle amplification uses a rolling circle amplification reaction solution.

[0012] Optionally, no RNase inhibitor is added to the ligation reaction mixture used in the in situ detection method.

[0013] Optionally, no RNase inhibitor is added to the ring-forming mixture used in the in situ detection method.

[0014] Optionally, no RNase inhibitor is added to the rolling circle amplification reaction solution used in the in situ detection method.

[0015] Optionally, no RNase inhibitor is added to the ligation reaction mixture, the circularization mixture and the rolling circle amplification reaction solution used in the in situ detection method.

[0016] Optionally, the sample of the in situ detection method is a paraffin sample or a frozen sample.

[0017] In summary, the present application includes at least one of the following beneficial technical effects:

[0018] The related technology requires the addition of RNase inhibitors in multiple steps such as probe circularization and rolling circle amplification, while the present application does not require the addition of RNase inhibitors in the above-mentioned corresponding steps, and the other steps can remain consistent with the related technical solutions.

[0019] The present application proposes a solution that does not require the use of RNase inhibitors compared to related technologies. On the one hand, it can improve the detection signal-to-noise ratio and detection efficiency of in situ RNA detection on tissues, which helps to improve the sensitivity of the method; on the other hand, since there is no need to use RNase inhibitors, it can effectively save reagent costs overall; furthermore, it can also simplify the operating procedures. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 A technology roadmap for in situ sequencing methods.

[0021] Figure 2 The results of detecting the PPIB gene on Hela FFPE (A is Example 1; B is Comparative Example 1).

[0022] Figure 3 The results of HER2 gene detection on Hela FFPE (A is Example 1; B is Comparative Example 1). DETAILED DESCRIPTION

[0023] Before describing the embodiments of the present application in detail, it should be understood that the terms used herein are only for the purpose of describing specific embodiments. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by ordinary technicians in the field to which the terms belong.

[0024] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features. Further, in the description of this application, unless otherwise specified, the meaning of "plurality" is two or more.

[0025] The endpoints and any values ​​of the ranges disclosed in this application are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0026] In the present application, the terms "include" or "comprising" are open expressions, that is, including the contents specified in the present application, but not excluding other contents.

[0027] The related technology requires the addition of RNase inhibitors in multiple steps such as probe circularization and rolling circle amplification, while the present application does not require the addition of RNase inhibitors in the above-mentioned corresponding steps, and the other steps can remain consistent with the related technical solutions.

[0028] The present application proposes a solution that does not require the use of RNase inhibitors compared to related technologies. On the one hand, it can improve the detection signal-to-noise ratio and detection efficiency of in situ RNA detection on tissues, which helps to improve the sensitivity of the method; on the other hand, since there is no need to use RNase inhibitors, it can effectively save reagent costs overall; furthermore, it can also simplify the operating procedures.

[0029] In order to make the purpose, technical scheme and advantages of the present application clearer, the technical scheme in the embodiments of the present application will be clearly and completely described below in conjunction with the accompanying drawings. Based on the embodiments of the present application, all other embodiments obtained by those skilled in the art without making creative work belong to the scope of protection of the present application. The embodiments described below are exemplary and are only used to explain the present application, and cannot be understood as limiting the present application.

[0030] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0031] On common paraffin samples FFPE, fresh frozen samples FF, frozen after fixation, and cell wax slides, the addition and non-addition of RNase inhibitor (RI) in each enzyme reaction step were compared and tested. The results of all sample types were similar, that is, the signal detection amount and signal intensity in each enzyme reaction without RI were higher than those with RI.

[0032] The present application is further described in detail below in conjunction with the embodiments, drawings and test results.

[0033] RNA in situ co-detection of PPIB and HER2 genes on Hela FFPE was performed to compare the effects of adding (comparative example) or not adding (example) RNase inhibitor (RI, Thermo, catalog number EO0384) to each enzyme reaction on signal detection.

[0034] Example

[0035] Example 1

[0036] This embodiment provides an in-situ detection method.

[0037] The method specifically comprises the following steps:

[0038] 1. Tissue pretreatment of paraffin samples

[0039] (1) Baking: Bake the FFPE tissue sections in an oven at 60°C for 30 min.

[0040] (2) Dewaxing and rehydration: Immerse the sections in two cylinders of xylene at room temperature to ensure that the tissue is fully covered. Dewax for 15 min and 10 min respectively. Then immerse the sections in two cylinders of 100% alcohol for 2 min each. Wash the tissue three times with PBST (1× PBS containing 0.1% Tween-20).

[0041] (3) Fixation: Add 4% PFA (Biyuntian) to the tissue, discard the liquid after fixation for 10 minutes, and wash the tissue three times with PBST.

[0042] (4) Permeabilization: 0.1 M hydrochloric acid containing 0.3 mg / mL pepsin (Sigma) was added to the tissue and permeabilized at 37°C for 30 min. The tissue was then removed and washed three times with PBST.

[0043] (5) Dehydration and drying: Immerse the sections in 70%, 85% and 100% ethanol for gradient dehydration, each time for 1 min.

[0044] (6) Draw the hydrophobic circle: After the slices are dried, use Imm Edge TM Use a pen to draw a hydrophobic circle with a diameter of 1 cm around the tissue. After the hydrophobic circle is dry, wash the tissue inside the hydrophobic circle three times with PBST.

[0045] (II) In-situ testing process

[0046] (1) Dual-ligation probe hybridization

[0047] Add 50 μL of hybridization mixture containing 0.1 μM dual-ligation probe (Shanghai Bioengineering, the same probe below), 6×SSC (Sigma), and 10% formamide (Sigma) to the tissue, and hybridize at 46°C for 4 h to allow the probes designed for different target genes to fully bind to their targets, then wash the tissue three times with PBST; then use a probe washing solution containing 2×SSC and 20% formamide to wash the tissue three times at 46°C for 5 min each time, and then wash the tissue three times with PBST.

[0048] The probe sequences used are shown in Table 1, specifically the nucleotide sequences shown in SEQ ID NOs 1-20.

[0049] Table 1 Probe sequences used

[0050]

[0051]

[0052] (2) Double-ligation probe ring formation

[0053] 1) First step of ligation of dual ligation probe

[0054] 50 μL of a ligation reaction mixture containing 25% glycerol (Sigma), 0.2 μg / μL BSA, 1×SplintR buffer (NEB), and 0.25 U / μL SplintR ligase (NEB) was added to the tissue and incubated at 37°C for 30 min, and then the tissue was washed three times with PBST.

[0055] 2) Double-ligation probe circularization

[0056] 50 μL of a looping mixture containing 0.5 μM looping splint ST, 2 mM ATP, 0.2 μg / μL BSA, 1xT4 DNA Ligase buffer and 1 U / μL T4 DNA Ligase was added to the tissue and incubated at 37°C for 30 min, followed by washing the tissue three times with PBST. The looping splint sequence is the nucleotide sequence shown in SEQ ID NO: 31, specifically: TCTTAAACAGCTTGATACCG.

[0057] (3) Rolling circle amplification

[0058] Add 50 μL of rolling circle amplification reaction solution containing 1 mM dNTP (Thermo), 5% glycerol, 0.2 μg / μL BSA, 1×phi29 buffer, and 1U / μL phi29 DNA polymerase to the tissue, incubate at 30°C for 12-16 hours, and then wash the tissue three times with PBST.

[0059] (4) Fluorescent probe detection

[0060] Add 50 μL of the detection reaction solution containing 2×SSC, 20% formamide, and 0.1 μM of each fluorescent detection probe to the tissue and incubate at room temperature for 30 min; then wash the tissue three times with PBST. After the tissue is naturally air-dried, add Slowfade anti-fluorescence quencher (Thermo) containing 0.5 μg / mL DAPI and incubate at room temperature for about 5 min before fluorescence microscopy imaging.

[0061] The fluorescence detection probe sequence is shown in Table 2. Specifically, it is the nucleotide sequence shown in SEQ ID NO: 42-43.

[0062] Table 2 Fluorescence detection probe sequences

[0063] SEQ ID NO: Name Sequence Information (5' to 3') 5' Modification 42 DP-1-Cy3 AGTAGCCGTGACTATCGACT Cy3 43 DP-2-Cy5 GAGAGGCCGTCGCTATACAT Cy5

[0064] Example 2

[0065] This embodiment provides an in situ detection method. The difference between this embodiment and embodiment 1 is that in the in situ detection process, in the first step of the ligation of the double ligation probes (2) 1) in which the double ligation probes are ringed, 1U / μL RiboLock RNase inhibitor (Thermo) is added to the formula of the ligation reaction mixture. The rest of the operation steps are consistent with those of embodiment 1.

[0066] Example 3

[0067] This embodiment provides an in situ detection method. The difference between this embodiment and embodiment 1 is that in the in situ detection process, in (2) double ligation probe ring formation, 1U / μL RiboLock RNase inhibitor (Thermo) is added to the formula of the ring formation mixture. The rest of the operation steps are consistent with those of embodiment 1.

[0068] Example 4

[0069] This embodiment provides an in situ detection method. The difference between this embodiment and embodiment 1 is that in the rolling circle amplification (3) of the in situ detection process, 1U / μL RiboLock RNase inhibitor (Thermo) is added to the formula of the rolling circle amplification reaction solution. The rest of the operation steps are consistent with those of embodiment 1.

[0070] Comparative Example

[0071] Comparative Example 1

[0072] This comparative example provides an in situ detection method. The difference between this comparative example and Example 1 is that an RNase inhibitor is added in each enzyme reaction step, as shown below, and the rest of the operation steps are consistent with those of Example 1.

[0073] The specific differences are as follows: In the in situ detection process, in the steps of (2) double-ligation probe circularization and (3) rolling circle amplification, 1U / μL RiboLock RNase inhibitor (Thermo) was added to the formula of the ligation reaction mixture, circularization mixture, and rolling circle amplification reaction solution, respectively.

[0074] Test result 1

[0075] The test results of Example 1 and Comparative Example 1 are as follows: Figure 2-3 shown.

[0076] in, Figure 2 The detection results of PPIB gene on Hela FFPE, A is the detection result of Example 1; B is the detection result of Comparative Example 1.Figure 3 The detection results of HER2 gene on Hela FFPE, A is the detection result of Example 1; B is the detection result of Comparative Example 1.

[0077] Depend on Figure 2 and Figure 3 It can be seen that by comparing the results of the two gene co-detection in Example 1 and Comparative Example 1, it is shown that in each enzyme reaction step, the scheme of the present application without adding the RNase inhibitor RI can make the signal point intensity higher and the signal detection amount more. For example, in the comparison of the signal detection amount of the HER2 gene in each cell in Example 1 and Comparative Example 1, the scheme without adding the RNase inhibitor RI (signal detection amount 2.21 / cell) is 31.5% higher than the scheme of adding the RNase inhibitor RI in the related art (signal detection amount 1.68 / cell). In addition, in the schemes of Examples 2-4, the signal detection amounts of the HER2 gene are 1.80, 1.93, and 1.72 / cell, respectively, which are also better than the scheme of adding the RNase inhibitor RI in the related art (signal detection amount 1.68 / cell). The signal detection amount of the PPIB gene is even higher, but because the signal is too crowded, the signal detection amount cannot be accurately counted, so the specific counting results of the gene are not displayed.

[0078] In addition, omitting the RNase inhibitor in any step of the enzyme reaction can reduce the reagent cost. Since the volume of the reagent required is very small, omitting it is conducive to simple operation.

[0079] RNA in situ co-detection of Ppib and Tmsb4x genes was performed on frozen mouse kidney tissues, and the effects of adding (comparative example) or not adding (example) RNase inhibitor (RI, Thermo, catalog number EO0384) to each enzyme reaction on signal detection were compared.

[0080] Example 5

[0081] This embodiment provides an in-situ detection method.

[0082] The method specifically comprises the following steps:

[0083] 1. Tissue pretreatment of frozen samples

[0084] (1) Fixation: After the frozen sections were taken out from -80°C, 4% PFA (Biyuntian) was added at room temperature and fixed for 5 min. The tissues were then washed three times with PBST.

[0085] (2) Dehydration and drying: The sections were sequentially immersed in 70%, 85% and 100% ethanol for gradient dehydration, each time for 1 min.

[0086] (3) Draw the hydrophobic circle: After the slices are dried, use ImmEdge TM Use a pen to draw a hydrophobic circle with a diameter of 1 cm around the tissue. After the hydrophobic circle is dry, wash the tissue inside the hydrophobic circle three times with PBST.

[0087] (4) Permeabilization: Add 0.1 M hydrochloric acid to the tissue and permeabilize at 37°C for 5 min. Then remove the slices and wash the tissue three times with PBST.

[0088] (II) In-situ testing process

[0089] In this process, only the probe sequence used in (1) double-ligation probe hybridization is different from that in Example 1, and the rest of the steps are consistent with Example 1. The probe sequences used are shown in Table 3, specifically the nucleotide sequences shown in SEQ ID NOs 21-41.

[0090] Table 3 Probe sequences used

[0091] SEQ ID NO: Name Sequence Information (5' to 3') 21 Mmu-DLP-PPIB-L1 ATTGCGCTCCGAGAGGTCTCGTTTTCTGAACTGCTACGGTATCAAG 22 Mmu-DLP-PPIB-R1 CTGTTTAAGAAGTAGCCGTGACTATCGACTCGAAGAGCACCTTCAT 23 Mmu-DLP-PPIB-L2 TTCTTCTTATCGTTGGTCTCGTTTTCTGAACTGCTACGGTATCAAG 24 Mmu-DLP-PPIB-R2 CTGTTTAAGAAGTAGCCGTGACTATCGACTTGTGACTTTAGGTCCC 25 Mmu-DLP-PPIB-L3 TCCTGTAGCTAAGGCTTCTCGTTTTCTGAACTGCTACGGTATCAAG 26 Mmu-DLP-PPIB-R3 CTGTTTAAGAAGTAGCCGTGACTATCGACTAGCCAAATCCTTTCTC 27 Mmu-DLP-PPIB-L4 ACTCCTTGGCAATGGCTCTCGTTTTCTGAACTGCTACGGTATCAAG 28 Mmu-DLP-PPIB-R4 CTGTTTAAGAAGTAGCCGTGACTATCGACTGTCCCCCAGGCTCTCT 29 Mmu-DLP-PPIB-L5 AGGGCCAGGGTGGCACTCTCGTTTTCTGAACTGCTACGGTATCAAG 30 Mmu-DLP-PPIB-R5 CTGTTTAAGAAGTAGCCGTGACTATCGACTATCAGATGGAAGCACT 32 Mmu-DLP-Tmsb4x-L1 TGATCTGCTCAGAAGCTCTCGTTTTCTGAACTTAGCCGGTATCAAG 33 Mmu-DLP-Tmsb4x-R1 CTGTTTAAGAGAGAGGCCGTCGCTATACATGCGAACGAGGAGAGTC 34 Mmu-DLP-Tmsb4x-L2 TTGCTTCTCTTGTTCATCTCGTTTTCTGAACTTAGCCGGTATCAAG 35 Mmu-DLP-Tmsb4x-R2 CTGTTTAAGAGAGAGGCCGTCGCTATACATATTACGATTCGCCAGC 36 Mmu-DLP-Tmsb4x-L3 ACAGTGCATATTGGCGTCTCGTTTTCTGAACTTAGCCGGTATCAAG 37 Mmu-DLP-Tmsb4x-R3 CTGTTTAAGAGAGAGGCCGTCGCTATACATAATGCTCGTGGAATGT 38 Mmu-DLP-Tmsb4x-L4 AAACTTGATCCAACCTTCTCGTTTTCTGAACTTAGCCGGTATCAAG 39 Mmu-DLP-Tmsb4x-R4 CTGTTTAAGAGAGAGGCCGTCGCTATACATGGCAGCACAGTCATTT 40 Mmu-DLP-Tmsb4x-L5 TTCACCAACATGCAAGTCTCGTTTTCTGAACTTAGCCGGTATCAAG 41 Mmu-DLP-Tmsb4x-R5 CTGTTTAAGAGAGAGGCCGTCGCTATACATCCACCCAGCTTTTTCC

[0092] Example 6

[0093] This embodiment provides an in situ detection method. The difference between this embodiment and embodiment 5 is that in the in situ detection process, in the first step of the ligation of the double ligation probes (2) 1) in which the double ligation probes are formed into a ring, 1U / μL RiboLock RNase inhibitor (Thermo) is added to the formula of the ligation reaction mixture. The rest of the operation steps are consistent with those of embodiment 5.

[0094] Example 7

[0095] This embodiment provides an in situ detection method. The difference between this embodiment and embodiment 5 is that in the in situ detection process, in (2) double ligation probe ring formation, 1U / μL RiboLock RNase inhibitor (Thermo) is added to the formula of the ring formation mixture. The rest of the operation steps are consistent with those of embodiment 5.

[0096] Example 8

[0097] This embodiment provides an in situ detection method. The difference between this embodiment and embodiment 5 is that in the rolling circle amplification (3) of the in situ detection process, 1U / μL RiboLock RNase inhibitor (Thermo) is added to the formula of the rolling circle amplification reaction solution. The rest of the operation steps are consistent with those of embodiment 5.

[0098] Comparative Example 2

[0099] This comparative example provides an in situ detection method. The difference between this comparative example and Example 5 is that an RNase inhibitor is added in each enzyme reaction step, as shown below, and the rest of the operation steps are consistent with those of Example 5.

[0100] The specific differences are as follows: In the in situ detection process, in the steps of (2) double-ligation probe circularization and (3) rolling circle amplification, 1U / μL RiboLock RNase inhibitor (Thermo) was added to the formula of the ligation reaction mixture, circularization mixture, and rolling circle amplification reaction solution, respectively.

[0101] Test result 2

[0102] The test results of the above-mentioned Examples 5-8 and Comparative Example 2 are shown in Table 4.

[0103] Table 4 Signal detection amount of Ppib gene and Tmsb4x gene in each cell

[0104]

[0105] As shown in Table 4, by comparing the results of the two gene co-detection in Examples 5-8 and Comparative Example 2, it is shown that in each enzyme reaction step, the scheme of the present application without adding the RNase inhibitor RI can make the signal point intensity higher and the signal detection amount more. For example, in Comparative Example 5 and Comparative Example 2, the signal detection amount of the Ppib gene in each cell, the scheme without adding the RNase inhibitor RI (signal detection amount 1.29 / cell) is 50% higher than the scheme with the addition of the RNase inhibitor RI in the related art (signal detection amount 0.86 / cell); the signal detection amount of the Tmsb4x gene in each cell, the scheme without adding the RNase inhibitor RI (signal detection amount 2.08 / cell) is 35.1% higher than the scheme with the addition of the RNase inhibitor RI in the related art (signal detection amount 1.54 / cell). It can be seen that not adding RI has a better signal detection performance.

[0106] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example" or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present application. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0107] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit it. Although the present application has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. An in situ detection method for improving RNA detection efficiency, characterized in that: No RNase inhibitor is added in each enzyme reaction step in the in situ detection method.

2. The in-situ detection method according to claim 1, characterized in that: The in situ detection method first uses double-ligated probes to hybridize with target RNA, and then performs rolling circle amplification after ligation into a ring; then the generated rolling circle amplification product is used as a sequencing template, and after multiple rounds of fluorescence imaging and decoding, the expression level and spatial position information of each target RNA are obtained.

3. The in-situ detection method according to claim 1, characterized in that: The in-situ detection method comprises the following steps: Dual ligation probe hybridization, dual ligation probe circularization, rolling circle amplification, and fluorescent probe detection; The double ligation probe circularization uses a ligation reaction mixture and a circularization mixture; The rolling circle amplification reaction solution is used in the rolling circle amplification.

4. The in-situ detection method according to claim 1, characterized in that: No RNase inhibitor is added to the ligation reaction mixture used in the in situ detection method.

5. The in-situ detection method according to claim 1, characterized in that: No RNase inhibitor is added to the ring-forming mixture used in the in situ detection method.

6. The in-situ detection method according to claim 1, characterized in that: No RNase inhibitor is added to the rolling circle amplification reaction solution used in the in situ detection method.

7. The in-situ detection method according to claim 1, characterized in that: No RNase inhibitor is added to the ligation reaction mixture, the circularization mixture and the rolling circle amplification reaction solution used in the in situ detection method.

8. The in-situ detection method according to claim 1, characterized in that: The sample of the in-situ detection method is a paraffin sample or a frozen sample.

Images