Biomolecular probe and method for detecting gene and protein expression

Abstract

The invention relates to a biomolecular probe and a method for detecting gene and protein expression. The present invention relates, among other things, to probes, compositions, methods and kits for simultaneous, multiplex detection and quantification of protein and / or nucleic acid expression in user-defined tissue regions, user-defined cells and / or subcellular structures within user-defined cells, which are adapted for use with existing sequencing techniques.

Description

Background of the Invention This application is a divisional application of the invention patent application entitled "Biomolecular Probe and Method for Detecting Gene and Protein Expression" with international application number 201980025119.5, which entered China with international application date of February 11, 2019. This application claims priority and benefits of U.S. Provisional Application No. 62 / 629,180 filed on February 12, 2018 and U.S. Provisional Application No. 62 / 771,212 filed on November 26, 2018. The contents of each of the aforementioned patent applications are incorporated herein by reference in their entirety.

[0002] Sequence Listing This application contains a sequence listing, which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. The ASCII copy was created on February 1, 2019, is named "NATE-037_001WO.txt", and is 48.4KB in size.

[0003] Technical Field and Background Art Standard immunohistochemistry and in situ hybridization methods allow for simultaneous detection of up to six to ten protein or nucleic acid targets, while three to four targets are typical. There is a need for probes, compositions, methods and kits for simultaneous, multiplexed detection and quantification of protein and / or nucleic acid expression in user-defined tissue regions, user-defined cells and / or user-defined intracellular subcellular structures. In addition, there is a need for such systems to be adaptable for use with existing sequencing technologies that are already available to a large number of end users. Summary of the invention

[0004] The present disclosure relates to probes, compositions, methods and kits for simultaneous, multiplexed, spatial detection and quantification of protein and / or nucleic acid expression in user-defined tissue regions, user-defined cells and / or user-defined intracellular subcellular structures.

[0005] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) providing a force sufficient to release the identifier oligonucleotide to the position of the tissue sample; (3) collecting the released identifier oligonucleotide; (4) ligating at least one nucleic acid adapter to the released identifier oligonucleotide, wherein the nucleic acid adapter comprises a nucleic acid sequence that identifies a specific position of the tissue sample from which the identifier oligonucleotide is released, a nucleic acid sequence comprising a unique molecular identifier, a first amplification primer binding site, a second amplification primer binding site, and optionally a constant nucleic acid sequence that minimizes ligation bias; (5) amplifying the ligation product produced in step (4); and (6) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (5), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0006] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) providing a force sufficient to release the identifier oligonucleotide to a position in the tissue sample; (3) collecting the released identifier oligonucleotide; (4) connecting at least one nucleic acid adapter to the released identifier oligonucleotide, wherein the nucleic acid adapter comprises: a nucleic acid sequence comprising a unique molecular identifier, a first amplification primer binding site, a second amplification primer binding site, and optionally a constant nucleic acid sequence that minimizes ligation bias, and wherein at least one of the first or second amplification primer binding sites identifies a specific position in the tissue sample from which the identifier oligonucleotide is released; (5) amplifying the ligation product produced in step (4); and (6) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (5), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0007] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force sufficient to release the identifier oligonucleotide to a position in the tissue sample; (3) collecting the released identifier oligonucleotide; and (4) attaching at least one nucleic acid adapter to the released identifier oligonucleotide, wherein the nucleic acid adapter comprises: a nucleic acid sequence comprising a unique molecular identifier; (5) amplifying the extension product produced in step (4) using a first amplification primer capable of binding to the first amplification primer binding site and a second amplification primer capable of binding to the second amplification primer binding site, wherein at least one of the amplification primers contains a nucleic acid sequence that identifies a specific position of the tissue sample from which the identifier oligonucleotide is released; and (6) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (5), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0008] The nucleic acid adaptor of step (4) may be a partially double-stranded nucleic acid molecule. The partially double-stranded nucleic acid adaptor may include a double-stranded annealing region, a first single-stranded mismatch region, and a second single-stranded mismatch region. The first single-stranded mismatch region and the second single-stranded mismatch region may be present on opposite sides of the double-stranded annealing region.

[0009] The nucleic acid sequence that identifies the specific location of the tissue sample from which the identifier oligonucleotide is released can be present in the double-stranded annealing region of the partially double-stranded nucleic acid adaptor.

[0010] A constant nucleic acid sequence that minimizes ligation bias can be present in the double-stranded annealing region of a partially double-stranded nucleic acid adaptor.

[0011] The unique molecular identifier can be present in at least one of the first or second single-stranded mismatch regions of the partially double-stranded nucleic acid adaptor.

[0012] A first amplification primer binding site can be present in a first single-stranded mismatch region of a partially double-stranded nucleic acid adaptor and a second amplification primer binding site can be present in a second single-stranded mismatch region of the same partially double-stranded nucleic acid adaptor.

[0013] The method of the present disclosure described above may further include performing an end repair reaction before step (4). The method may further include performing a tailing reaction to attach the single nucleotide overhang to the 3' end of the identifier oligonucleotide before step (4). The method may further include performing an end repair reaction and a tailing reaction to attach the single nucleotide overhang to the 3' end of the identifier oligonucleotide before step (4). The tailing reaction and the end repair reaction may be performed sequentially or simultaneously.

[0014] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a first amplification primer binding site and a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) providing a force sufficient to release the identifier oligonucleotide to the position of the tissue sample; (3) collecting the released identifier oligonucleotide; (4) connecting at least one nucleic acid adapter to the released identifier oligonucleotide, wherein the nucleic acid adapter comprises a nucleic acid sequence that identifies a specific position of the tissue sample from which the identifier oligonucleotide was released, a nucleic acid sequence comprising a unique molecular identifier, a second amplification primer binding site, and optionally a constant nucleic acid sequence that minimizes connection bias; (5) amplifying the connection product produced in step (4); and (6) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (5), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0015] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises: a first amplification primer binding site and a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) providing a force sufficient to release the identifier oligonucleotide to a position in the tissue sample; (3) collecting the released identifier oligonucleotide; and (4) attaching at least one nucleic acid adapter to the released identifier oligonucleotide, wherein the nucleic acid adapter The method comprises: a nucleic acid sequence comprising a unique molecular identifier, a second amplification primer binding site, and optionally a constant nucleic acid sequence that minimizes ligation bias; (5) amplifying the extension product produced in step (4) using a first amplification primer capable of binding to the first amplification primer binding site and a second amplification primer capable of binding to the second amplification primer binding site, wherein at least one of the amplification primers comprises a nucleic acid sequence that identifies a specific position of the tissue sample from which the identifier oligonucleotide is released; and (6) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (5), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0016] The nucleic acid adaptor in step (4) may be a partially double-stranded nucleic acid molecule. The partially double-stranded nucleic acid adaptor may include a double-stranded annealing region and a single-stranded mismatch region.

[0017] The nucleic acid sequence that identifies the specific location of the tissue sample from which the identifier oligonucleotide is released can be present in the double-stranded annealing region of the partially double-stranded nucleic acid adaptor.

[0018] The constant nucleic acid sequence that minimizes the connection bias can be present in the double-stranded annealing region of the partially double-stranded nucleic acid adapter. The constant nucleic acid sequence can also include a cleavable portion. The cleavable portion can be an enzymatically cleavable portion. The enzymatically cleavable portion can be a USER sequence.

[0019] The unique molecular identifier can be present in a single-stranded mismatch region of a partially double-stranded nucleic acid adaptor.

[0020] The second amplification primer binding site can be present in the single-stranded mismatch region of the partially double-stranded nucleic acid adaptor.

[0021] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a first amplification primer binding site and a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) providing a force sufficient to release the identifier oligonucleotide to a position in the tissue sample; (3) collecting the released identifier oligonucleotide; and (4) hybridizing a single-stranded nucleic acid template to the released identifier oligonucleotide, wherein the nucleic acid template comprises a region complementary to the unique nucleic acid sequence of the identifier oligonucleotide, a nucleic acid sequence comprising a unique molecular identifier, and a second amplification primer binding site. (5) extending the identifier oligonucleotide of step (4) to form an extension product complementary to the single-stranded nucleic acid template, wherein the extension product comprises the identifier oligonucleotide, a nucleic acid sequence complementary to the unique molecular identifier, and a second amplification primer binding site; (6) amplifying the extension product produced in step (5) using a first amplification primer capable of binding to the first amplification primer binding site and a second amplification primer capable of binding to the second amplification primer binding site, wherein at least one of the amplification primers comprises a nucleic acid sequence that identifies a specific position of the tissue sample from which the identifier oligonucleotide is released; and (7) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (6), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0022] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a first amplification primer binding site and a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force sufficient to release the identifier oligonucleotide to a position in the tissue sample; (3) collecting the released identifier oligonucleotide; (4) hybridizing a single-stranded nucleic acid template to the released identifier oligonucleotide, wherein the nucleic acid template comprises a region complementary to the unique nucleic acid sequence of the identifier oligonucleotide, an identifier sequence from which the identifier oligonucleotide is released; and (5) extending the identifier oligonucleotide of step (4) to form an extension product complementary to the single-stranded nucleic acid template, wherein the extension product comprises the identifier oligonucleotide, the nucleic acid sequence complementary to the nucleic acid sequence of the specific position of the tissue sample from which the identifier oligonucleotide is released, the nucleic acid sequence complementary to the unique molecular identifier, and the second amplification primer binding site; (6) amplifying the extension product produced in step (5); and (7) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (6), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0023] The single-stranded nucleic acid template may further comprise an affinity molecule. In the aspect where the single-stranded nucleic acid template comprises an affinity molecule, the method of the present disclosure described above may further comprise an affinity purification step between steps (4) and (5).

[0024] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force sufficient to release the identifier oligonucleotide to a position in the tissue sample; (3) collecting the released identifier oligonucleotide; (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide, wherein the first nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide, an identifier oligonucleotide from which the identifier oligonucleotide is released; and (5) performing nick repair so that the hybridized first and second nucleic acid probes are connected together; (6) amplifying the connection product produced in step (5); and (7) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (6), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0025] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force sufficient to release the identifier oligonucleotide to a position in the tissue sample; (3) collecting the released identifier oligonucleotide; (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide, wherein the first nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide and a first amplification primer binding site, and wherein the second nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide and a first amplification primer binding site, and wherein the second nucleic acid probe comprises a nucleic acid complementary to the identifier oligonucleotide (5) performing nick repair so that the hybridized first and second nucleic acid probes are ligated together; (6) amplifying the ligation product produced in step (5); and (7) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (6), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0026] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) providing a force sufficient to release the identifier oligonucleotide to a position in the tissue sample; (3) collecting the released identifier oligonucleotide; (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide, wherein the first nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide, and the identifier oligonucleotide is released from the identifier oligonucleotide; (5) performing a gap extension and a nick repair reaction, thereby connecting the hybridized first and second nucleic acid probes together; (6) amplifying the connection product produced in step (5); and (7) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (6), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0027] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force sufficient to release the identifier oligonucleotide to a position in the tissue sample; (3) collecting the released identifier oligonucleotide; (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide, wherein the first nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide and a first amplification primer binding site, and wherein the second nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide and a first amplification primer binding site; (5) performing a gap extension and a nick repair reaction, thereby ligating the hybridized first and second nucleic acid probes together; (6) amplifying the ligation product produced in step (5); and (7) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (6), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0028] In aspects where the nucleic acid sequence identifying the specific location of the tissue sample from which the identifier oligonucleotide is released is located on the first nucleic acid probe, the nucleic acid sequence identifying the specific location of the tissue sample from which the identifier oligonucleotide is released may be located 5' to the first amplification primer binding site.

[0029] In aspects where the unique molecular identifier is located on the second nucleic acid probe, the unique molecular identifier can be located 3' to the second amplification primer binding site.

[0030] In aspects where a nucleic acid sequence and a unique molecular identifier that identify a specific location of a tissue sample from which the identifier oligonucleotide is released are present in the first nucleic acid probe, the nucleic acid sequence and the unique molecular identifier that identify a specific location of a tissue sample from which the identifier oligonucleotide is released can be located 5' of the first amplification primer binding site.

[0031] In aspects where a nucleic acid sequence and a unique molecular identifier identifying a specific location of a tissue sample from which the identifier oligonucleotide is released are present in the second nucleic acid probe, the nucleic acid sequence and the unique molecular identifier identifying a specific location of a tissue sample from which the identifier oligonucleotide is released can be located 3' to the second amplification primer binding site.

[0032] In aspects where a unique molecular identifier is present in the first nucleic acid probe and a nucleic acid sequence that identifies a specific location of a tissue sample from which the identifier oligonucleotide is released is present in the second nucleic acid probe, the unique molecular identifier can be located 5' of the first amplification primer binding site and the nucleic acid sequence that identifies the specific location of the tissue sample from which the identifier oligonucleotide is released can be located 3' of the second amplification binding site.

[0033] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force sufficient to release the identifier oligonucleotide to a location in the tissue sample; (3) collecting the released identifier oligonucleotide; (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide, wherein the first nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide, a nucleic acid sequence that identifies a specific location in the tissue sample from which the identifier oligonucleotide was released, a first amplification primer binding site, a nucleic acid sequence comprising a first unique molecular identifier, and a first flow cell; (5) performing nick repair so that the hybridized first and second nucleic acid probes are ligated together; (6) amplifying the ligation product produced in step (5); and (7) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (6), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0034] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) providing a force sufficient to release the identifier oligonucleotide to a position of the tissue sample; (3) collecting the released identifier oligonucleotide; (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide, wherein the first nucleic acid probe comprises a nucleic acid complementary to a portion of the identifier oligonucleotide, a first amplification primer binding site, a nucleic acid sequence comprising a first unique molecular identifier, and a first flow cell binding site, and wherein the second nucleic acid probe comprises a nucleic acid complementary to the identifier oligonucleotide; (5) performing nick repair so that the hybridized first and second nucleic acid probes are ligated together; (6) amplifying the ligation product produced in step (5); and (7) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (6), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0035] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force sufficient to release the identifier oligonucleotide to a location in the tissue sample; (3) collecting the released identifier oligonucleotide; (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide, wherein the first nucleic acid probe comprises a nucleic acid complementary to the identifier oligonucleotide, a nucleic acid sequence that identifies a specific location in the tissue sample from which the identifier oligonucleotide was released, and a first amplification primer; binding site, a nucleic acid sequence comprising a first unique molecular identifier, and a first flow cell binding site, wherein the second nucleic acid probe comprises a nucleic acid complementary to the identifier oligonucleotide, a nucleic acid sequence comprising a second unique molecular identifier, a nucleic acid sequence comprising a third unique molecular identifier, and a second flow cell binding site, and wherein the first and second nucleic acid probes hybridize to the identifier oligonucleotide such that the first and second nucleic acid probes are not adjacent and do not overlap; (5) performing a gap extension and a nick repair reaction such that the hybridized first and second nucleic acid probes are ligated together; (6) amplifying the ligation product produced in step (5); and (7) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (6), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0036] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) providing a force sufficient to release the identifier oligonucleotide to a position of the tissue sample; (3) collecting the released identifier oligonucleotide; (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide, wherein the first nucleic acid probe comprises a nucleic acid complementary to the identifier oligonucleotide, a first amplification primer binding site, a nucleic acid sequence comprising a first unique molecular identifier, and a first flow cell binding site, and wherein the second nucleic acid probe comprises a nucleic acid complementary to the identifier oligonucleotide, a first amplification primer binding site, a nucleic acid sequence comprising a first unique molecular identifier, and a first flow cell binding site, and wherein the second nucleic acid probe comprises a nucleic acid complementary to the identifier oligonucleotide. (5) performing a gap extension and a nick repair reaction, thereby ligating the hybridized first and second nucleic acid probes together; (6) amplifying the ligation product produced in step (5); and (7) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (6), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0037] In aspects where a nucleic acid sequence identifying a specific location of a tissue sample from which the identifier oligonucleotide is released and a first unique molecular identifier are present in the first nucleic acid probe, the nucleic acid sequence identifying a specific location of a tissue sample from which the identifier oligonucleotide is released and the first unique molecular identifier may be located 5' of the first flow cell binding site.

[0038] In aspects where a second and third unique molecular identifier are present in the second nucleic acid probe, the second and third unique molecular identifiers can be located 3' to the second flow cell binding site.

[0039] In some aspects, the first unique molecular identifier can be present in the first nucleic acid probe and can be located 5' of the first flow cell binding site. In other aspects, the second unique molecular identifier can be present in the second nucleic acid probe and can be located 3' of the second flow cell binding site.

[0040] In some aspects, the nucleic acid sequence identifying the specific location of the tissue sample from which the identifier oligonucleotide was released and the third unique molecular identifier can be present in the first nucleic acid probe and can be located 5' to the first flow cell binding site.

[0041] In some aspects, a nucleic acid sequence identifying a specific location of the tissue sample from which the identifier oligonucleotide was released and a third unique molecular identifier can be present in the second nucleic acid probe and can be located 3' to the second flow cell binding site.

[0042] In some aspects, the third unique molecular identifier can be present in the first nucleic acid probe and can be located 5' of the first flow cell binding site. In the same aspects, a nucleic acid sequence that identifies a specific location of the tissue sample from which the identifier oligonucleotide is released can be present in the second nucleic acid probe and can be located 3' of the second flow cell binding site.

[0043] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain, a nucleic acid sequence comprising a unique molecular identifier, a first amplification primer binding site, and a second amplification primer binding site; (2) providing a force sufficient to release the identifier oligonucleotide to a position in the tissue sample; (3) collecting the released identifier oligonucleotide; (4) amplifying the released identifier oligonucleotide using a first amplification primer capable of binding to the first amplification primer binding site and a second amplification primer capable of binding to the second amplification primer binding site, wherein at least one of the amplification primers comprises a nucleic acid sequence that identifies a specific position of the tissue sample from which the identifier oligonucleotide was released; and (5) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (4), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0044] The present disclosure also provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain, a first amplification primer binding site, and a second amplification primer binding site; (2) providing a force sufficient to release the identifier oligonucleotide to the position of the tissue sample; (3) collecting the released identifier oligonucleotide; (4) amplifying the released identifier oligonucleotide using a first amplification primer capable of binding to the first amplification primer binding site and a second amplification primer capable of binding to the second amplification primer binding site, wherein at least one of the amplification primers comprises a nucleic acid sequence that identifies a specific position of the tissue sample from which the identifier oligonucleotide was released, and wherein at least one of the amplification primers comprises: a nucleic acid sequence comprising a unique molecular identifier; and (5) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (4), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0045] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain and a capture probe binding site; (2) providing a force sufficient to release the identifier oligonucleotide to the position of the tissue sample; (3) collecting the released identifier oligonucleotide; (4) hybridizing a capture probe to the released identifier oligonucleotide, wherein the capture probe comprises an affinity molecule and a region complementary to the capture probe binding site; and (5) identifying the released identifier oligonucleotide by sequencing the amplified hybridization product produced in step (4), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0046] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain, a capture probe binding site, and a multiplexing probe binding site; (2) providing a force sufficient to release the identifier oligonucleotide to a location in the tissue sample; (3) collecting the released identifier oligonucleotide; (4) hybridizing a capture probe and a multiplexing probe to the released identifier oligonucleotide, wherein the capture probe comprises an affinity molecule and a region complementary to the capture probe binding site, and wherein the multiplexing probe comprises a nucleic acid sequence that identifies a specific location in the tissue sample from which the identifier oligonucleotide was released and a region complementary to the multiplexing probe binding site; and (5) identifying the released identifier oligonucleotide by sequencing the hybridization products produced in step (4), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0047] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain; (2) applying a force sufficient to release the identifier oligonucleotide to a position of the tissue sample; (3) collecting the released identifier oligonucleotide; (4) hybridizing a first nucleic acid probe and a second nucleic acid probe to the released identifier oligonucleotide, wherein the first nucleic acid probe comprises: The method comprises the steps of: (a) releasing a nucleic acid complementary to a portion of the identifier oligonucleotide, a nucleic acid sequence comprising a unique molecular identifier, and a first amplification primer binding site, wherein the second nucleic acid probe comprises: a nucleic acid complementary to a portion of the identifier oligonucleotide and a second amplification primer binding site, and wherein the first and second nucleic acid probes hybridize to the identifier oligonucleotide such that the first and second nucleic acid probes are adjacent but not overlapping; (5) ligating the hybridized first and second nucleic acid probes together; (6) amplifying the ligation product produced in step (5); and (7) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (6), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0048] The present disclosure provides a method for spatially detecting at least one target analyte in at least one cell from a tissue sample, comprising: (1) contacting at least one target analyte in at least one cell in the tissue sample with at least one probe comprising a target binding domain and an identifier oligonucleotide, wherein the identifier oligonucleotide comprises: a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain, a nucleic acid sequence comprising a unique molecular identifier, a first amplification primer binding site, and a second amplification primer binding site; (2) providing a force sufficient to release the identifier oligonucleotide to the position of the tissue sample; (3) collecting the released identifier oligonucleotide; (4) amplifying the collected identifier oligonucleotide; (5) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (4), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0049] In all methods of the present disclosure, the connection process may be an incision connection process. The incision connection process may be an incision repair process.

[0050] In all methods of the present disclosure, sequencing may be an enzyme-free sequencing method.

[0051] In all methods of the present disclosure, the identifier oligonucleotide may be double-stranded. In aspects where the identifier oligonucleotide is double-stranded, at least one of the two strands of the identifier oligonucleotide may comprise at least two separate nucleic acid molecules. In another aspect, at least one 3' end of the identifier oligonucleotide may comprise a single nucleotide overhang.

[0052] In all methods of the present disclosure, the identifier oligonucleotide may be single-stranded.

[0053] In all methods of the present disclosure, the unique nucleic acid sequence identifying the target analyte bound to the target binding domain may comprise about 5 nucleotides to about 40 nucleotides, preferably about 35 nucleotides, and more preferably about 10 nucleotides.

[0054] In all methods of the present disclosure, the nucleic acid sequence identifying the specific location of the tissue sample from which the identifier oligonucleotide is released may comprise about 6 nucleotides to about 15 nucleotides, preferably about 12 nucleotides, more preferably about 10 nucleotides.

[0055] In all methods of the present disclosure, at least one of the first nucleic acid probe or the second nucleic acid probe may comprise an affinity molecule. For example, at least one of the first nucleic acid probe or the second nucleic acid probe may comprise biotin.

[0056] In all methods of the present disclosure, the amplification primer binding site may comprise about 18 nucleotides to about 40 nucleotides, preferably about 32 nucleotides, and more preferably about 25 nucleotides. The amplification primer binding site may comprise an i7 sequence, wherein the i7 sequence comprises the sequence shown in SEQ ID NO: 1. The amplification primer binding site may comprise an i5 sequence, wherein the i5 sequence comprises the sequence shown in SEQ ID NO: 2.

[0057] In all methods of the present disclosure, the amplification primer may comprise a flow cell adapter sequence, wherein the flow cell adapter sequence is suitable for sequencing. The amplification primer may comprise a P5 flow cell adapter sequence, wherein the P5 flow cell adapter sequence comprises the sequence set forth in SEQ ID NO: 3. The amplification primer may comprise a P7 flow cell adapter sequence, wherein the P7 flow cell adapter sequence comprises the sequence set forth in SEQ ID NO: 4.

[0058] In all methods of the present disclosure, the flow cell binding site may comprise a flow cell adapter sequence, wherein the flow cell adapter sequence is suitable for sequencing. The flow cell binding site may comprise a P5 flow cell adapter sequence, wherein the P5 flow cell adapter sequence comprises the sequence set forth in SEQ ID NO: 3. The flow cell binding site may comprise a P7 flow cell adapter sequence, wherein the P7 flow cell adapter sequence comprises the sequence set forth in SEQ ID NO: 4.

[0059] In all methods of the invention, at least one of the amplification primers may comprise an affinity molecule. For example, at least one of the amplification primers may comprise biotin.

[0060] In all methods of the present disclosure, amplifying may include performing PCR. Performing PCR may include amplifying primers.

[0061] The amplification primer may comprise a flow cell binding site. The amplification primer may comprise a nucleic acid sequence that identifies a specific location of a tissue sample from which the identifier oligonucleotide is released. The amplification primer may comprise a nucleic acid sequence that is complementary to the amplification primer binding site.

[0062] Any of the above aspects may be combined with any other aspect.

[0063] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present disclosure belongs. In this specification, the singular also includes the plural, unless the context clearly dictates otherwise; for example, the terms "a", "an" and "the" are understood to be singular or plural, and the term "or" is understood to be inclusive. As an example, "an element" refers to one or more elements. Throughout the specification, the word "comprising" or variations such as "comprises" or "comprising" will be understood to mean including the stated elements, integers or steps, or elements, integers or step groups, but not excluding any other elements, integers or steps, or elements, integers or step groups. About can be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05% or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values ​​provided herein are modified by the term "about."

[0064] Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The references cited herein are not considered to be prior art of the invention claimed for protection. In the event of a conflict, this specification, including definitions, will prevail. In addition, materials, methods and embodiments are illustrative only and are not intended to be restrictive. Other features and advantages of the present disclosure will be apparent from the following detailed description and claims. BRIEF DESCRIPTION OF THE DRAWINGS When together with the attached Figure 1 The above and further features will be more clearly understood from the following detailed description when understood together.

[0066] Figure 1 is a schematic diagram of the two-ended adaptor ligation method of the present disclosure.

[0067] Figure 2 is a schematic diagram of the one-ended adaptor ligation method of the present disclosure.

[0068] Figure 3 is a schematic diagram of the templated primer extension method of the present disclosure.

[0069] Figure 4 is a schematic diagram of a template-extended identifier oligonucleotide of the present disclosure.

[0070] Figure 5 is a schematic diagram of the short probe hybridization method of the present disclosure.

[0071] Figure 6 is a schematic diagram of the short probe hybridization method of the present disclosure.

[0072] Figure 7 is a schematic diagram of the short probe hybridization method of the present disclosure.

[0073] Figure 8 is a schematic diagram of the long probe hybridization method of the present disclosure.

[0074] Fig. 9 is a schematic diagram of the long probe hybridization method of the present disclosure.

[0075] Fig.10 is a schematic diagram of the long probe hybridization method of the present disclosure.

[0076] Fig.11 is a schematic diagram of the direct-PCR method of the present disclosure.

[0077] Fig.12 is a schematic diagram of the enzyme-free method of the present disclosure.

[0078] Fig.13 is a schematic diagram of the multiplex enzyme-free method of the present disclosure.

[0079] Fig.14 is a schematic diagram of a probe of the present disclosure that indirectly binds to a target nucleic acid.

[0080] Fig.15 is a schematic diagram of an identifier oligonucleotide-short nucleic acid probe complex of the present disclosure.

[0081] Fig.16 is a schematic diagram of the short probe hybridization method of the present disclosure.

[0082] Fig.17 is a schematic diagram of an identifier oligonucleotide-short nucleic acid probe complex of the present disclosure.

[0083] Fig.18 is a schematic diagram of the short probe hybridization method of the present disclosure.

[0084] Fig.19 is a schematic diagram of the direct-PCR method of the present disclosure.

[0085] Fig. 20 is a schematic overview of the methods of the present disclosure.

[0086] Fig.21 Spatial detection of a protein target analyte using the methods of the present disclosure is shown.

[0087] Fig. 22 Spatial detection of RNA target analytes using the methods of the present disclosure is shown.

[0088] Fig.23 Spatial detection of a protein target analyte using the methods of the present disclosure is shown.

[0089] Fig.24 Spatial detection of RNA target analytes using the methods of the present disclosure is shown.

[0090] Fig.25 Spatial detection of a protein target analyte using the methods of the present disclosure is shown.

[0091] Fig.26 is a schematic diagram of a probe of the present disclosure.

[0092] Fig. 27 The use of probe tiling in the methods of the present disclosure is shown.

[0093] Fig.28 Regions of interest selected on the tissue microarray are shown.

[0094] Fig.29 is a series of graphs showing the read depth achieved using the methods of the present disclosure.

[0095] Fig.30 is a series of graphs showing spatial detection of RNA target analytes in negative control samples using the methods of the present disclosure.

[0096] Fig.31 is a series of graphs showing spatial detection of RNA target analytes in HEK293 samples (upper graph) and Jurkat cell samples (lower graph) using the methods of the present disclosure.

[0097] Fig.32 is a series of graphs showing spatial detection of RNA target analytes in sixteen FFPE samples using the methods of the present disclosure.

[0098] Fig.33 is a graph showing spatial detection of RNA target analytes in HEK293 samples using the methods of the present disclosure.

[0099] Fig.34 is a diagram showing spatial detection of RNA target analytes in a Jurkat cell sample using the methods of the present disclosure. DETAILED DESCRIPTION The present disclosure is based in part on probes, compositions, methods and kits for simultaneous, multiplexed spatial detection and quantification of protein and / or nucleic acid expression in user-defined tissue regions, user-defined cells and / or user-defined intracellular subcellular structures using existing sequencing methods.

[0101] The present disclosure provides a comparison of the properties and abundance of a target protein and / or target nucleic acid present in a first region of interest (e.g., tissue types, cells (including normal and abnormal cells), and subcellular structures within cells) with the properties and abundance of a target protein and / or target nucleic acid present in a second region of interest. There is no predetermined upper limit to the number of regions of interest and comparisons that can be made; the upper limit relates to the size of the region of interest relative to the size of the sample. For example, when a single cell represents a region of interest, then a slice may have hundreds to thousands of regions of interest; however, if a tissue slice includes only two cell types, then the slice may have only two regions of interest (each region includes only one cell type).

[0102] The present disclosure provides a higher degree of multiplexing than is possible with standard immunohistochemistry or in situ hybridization methods. Standard immunohistochemistry methods allow for simultaneous detection of up to 6 to 10 protein targets, while 3 to 4 protein targets are more typical. Similarly, in situ hybridization methods are limited to simultaneous detection of less than ten nucleic acid targets. The present disclosure provides for detection of large combinations of nucleic acid targets and / or protein targets from defined areas of a sample. The present disclosure provides an increase in objective measurements through digital quantification and increased reliability and consistency, thereby enabling comparison of results between multiple centers.

[0103] Various compositions and methods of the disclosure are described in detail herein.

[0104] In one aspect, the present disclosure provides compositions and methods for spatially detecting at least one target analyte in a sample using probes of the present disclosure in a method referred to herein as a "double-ended adaptor ligation method."

[0105] The double-end adapter ligation method of the present disclosure may include: (1) contacting at least one target analyte in a sample with at least one probe of the present disclosure. The probe and sample of the present disclosure are further described in detail herein. The at least one target analyte may be a target protein or a target nucleic acid. In the aspect that at least one target analyte is a target protein, the probe may include a target binding domain, which is a target protein binding region that can specifically bind to the target protein of interest. In the aspect that at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region, which can directly or indirectly hybridize with the target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain.

[0106] After contacting the at least one target analyte with the at least one probe, the double-end adaptor ligation method can further include: (2) providing a force sufficient to release the identifier oligonucleotide to the location of the sample. In a non-limiting example, in aspects where the probe comprises a photocleavable linker between the identifier oligonucleotide and the target binding domain, exciting the region of interest with light of sufficient wavelength to cleave the photocleavable linker.

[0107] After releasing the identifier oligonucleotide, the double-end adapter ligation method may further include: (3) collecting the released identifier oligonucleotide. By directing the force only to a specific position in step (2), the identifier oligonucleotide is released only from the probe within the position, and not from the probe outside the position. Thus, only the identifier oligonucleotide for the probe bound to the target within the position is collected, thereby allowing the detection of the characteristics and amount of the target (protein and / or nucleic acid) located only within the position.

[0108] After collecting the released identifier oligonucleotides, the double-end adaptor ligation method may further include: (4) ligating at least one nucleic acid adaptor to the released identifier oligonucleotides collected in step (3).

[0109] The nucleic acid adapter can comprise a nucleic acid sequence that identifies a specific location of the sample from which the identifier oligonucleotide was released. For example, if the identifier oligonucleotide was released from a location of the sample designated as "ROI #1," the nucleic acid adapter will comprise a nucleic acid sequence corresponding to "ROI #1."

[0110] Nucleic acid adaptors may also comprise a unique molecular identifier.

[0111] The nucleic acid adaptor may further comprise a first amplification primer binding site. In other aspects, the nucleic acid adaptor may further comprise a second amplification primer binding site.

[0112] In some aspects, nucleic acid adaptors can also comprise a constant nucleic acid sequence to minimize ligation bias caused by differences in the sequence of specific identifier oligonucleotides.

[0113] The nucleic acid adaptor can be a partially double-stranded nucleic acid molecule. In the aspect where the nucleic acid adaptor is partially double-stranded, the nucleic acid adaptor comprises a double-stranded annealing region, a first single-stranded mismatch region, and a second single-stranded mismatch region. The first single-stranded mismatch region and the second single-stranded mismatch region can be present on opposite sides of the double-stranded annealing region.

[0114] In aspects where the nucleic acid adaptor is partially double-stranded and comprises a nucleic acid sequence that identifies a specific position of a sample from which the identifier oligonucleotide is released, the nucleic acid sequence that identifies the specific position of a sample from which the identifier oligonucleotide is released can be present in a double-stranded annealing region of the nucleic acid adaptor.

[0115] In aspects where the nucleic acid adaptor is partially double-stranded and comprises a constant nucleic acid sequence that minimizes ligation bias, the constant nucleic acid sequence that minimizes ligation bias can be present in a double-stranded annealing region of the nucleic acid adaptor.

[0116] In aspects where the nucleic acid adaptor is partially double-stranded and comprises a unique molecular identifier, the unique molecular identifier can be present in at least one of the first or second single-stranded mismatch regions of the nucleic acid adaptor.

[0117] In aspects where the nucleic acid adaptor is partially double-stranded and comprises first and second amplification primer binding sites, the first amplification primer binding site can be present in a first single-stranded mismatch region of the nucleic acid adaptor and the second amplification primer binding site can be present in a second single-stranded mismatch region of the nucleic acid adaptor.

[0118] After connecting at least one nucleic acid linker, the double-end linker connection method may further include: (5) amplifying the connection product produced in step (4) using amplification primers that bind to the first and second amplification primer binding sites; and (6) identifying the released oligonucleotides by sequencing the amplification products produced in step (5), thereby spatially detecting at least one target analyte in the sample.

[0119] The double-end adapter ligation method of the present disclosure may further include, before step (4), performing an end repair reaction using methods known in the art. The method may further include, before step (4), performing a tailing reaction using methods known in the art to attach the single nucleotide overhang to the 3' end of the identifier oligonucleotide. In various aspects, the end repair reaction and the tailing reaction may be performed sequentially or simultaneously.

[0120] In a preferred aspect of the double-ended adaptor ligation method, nucleic acid adaptors are ligated to both ends of the released and collected identifier oligonucleotides.

[0121] In other aspects of the double-end adaptor ligation method, at least one of the amplification primers used in step (5) to amplify the ligation product produced in step (4) comprises a nucleic acid sequence that identifies a specific location of the tissue sample from which the identifier oligonucleotide was released. For example, if the identifier oligonucleotide was released from a location of the sample designated as "ROI #1", then at least one of the amplification primers will comprise a nucleic acid sequence corresponding to "ROI #1".

[0122] Figure 1 A schematic diagram of a preferred aspect of a double-end adapter connection method of the present disclosure is shown. In this aspect, the probe comprises a target binding domain comprising an antibody that binds to a target protein. In the upper left figure, the probe binds to the target protein. In the upper right figure, a UV-light-cleavable joint between the target binding domain and the identifier oligonucleotide is cut to release the identifier oligonucleotide. The identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target protein that is bound to the target binding domain. In the bottom figure, a nucleic acid adapter is connected to both ends of the identifier oligonucleotide. In the non-limiting example, the nucleic acid adapter is partially double-stranded and comprises a double-stranded annealing region, a first single-stranded mismatch region, and a second single-stranded mismatch region. Present in the double-stranded annealing region is a constant nucleic acid sequence that minimizes the connection deviation and a nucleic acid sequence that identifies a specific position of a sample from which the identifier oligonucleotide is released. Present in the first single-stranded mismatch region is a first amplification primer binding site. Present in the second single-stranded mismatch region is a unique molecular identifier and a second amplification primer binding site. Following ligation of the nucleic acid adaptor to the identifier oligonucleotide, the product is amplified using amplification primers that bind to the first and second amplification primer binding sites and sequenced to identify the target protein bound by the probe.

[0123] In one aspect, the present disclosure provides a composition of an identifier oligonucleotide that is dually connected to two nucleic acid adapters for spatial detection of at least one target analyte in a sample. The identifier oligonucleotide dually connected to two nucleic acid adapters comprises an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence capable of identifying a target analyte in a sample. Each end of the identifier oligonucleotide is attached to a nucleic acid adapter molecule, wherein the nucleic acid adapter molecule is partially double-stranded and comprises a double-stranded annealing region, a first single-stranded mismatch region, and a second single-stranded mismatch region. The first single-stranded mismatch region and the second single-stranded mismatch region are present on opposite sides of the double-stranded annealing region. The double-stranded mismatch region comprises a constant nucleic acid sequence that minimizes connection deviation and a nucleic acid sequence that can identify a specific position of the sample. The first single-stranded mismatch region comprises a first amplification primer binding site. The second single-stranded mismatch region comprises a second amplification primer binding site and a nucleic acid sequence comprising a unique molecular identifier. A schematic diagram of an identifier oligonucleotide dually connected to two nucleic acid adapters is shown in Figure 1in the bottom figure.

[0124] In another aspect, the present disclosure provides compositions and methods for spatially detecting at least one target analyte in a sample using probes of the present disclosure in a method referred to herein as a "single-end adaptor ligation method."

[0125] The single-end adapter ligation method of the present disclosure may include: (1) contacting at least one target analyte in a sample with at least one probe of the present disclosure. The at least one target analyte may be a target protein or a target nucleic acid. In the aspect that the at least one target analyte is a target protein, the probe may include a target binding domain, which is a target protein binding region that can specifically bind to the target protein of interest. In the aspect that the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region, which can directly or indirectly hybridize with the target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain. The identifier oligonucleotide may also include a first amplification primer binding site. In some aspects, the identifier oligonucleotide also includes at least one 3' end having a single nucleotide overhang.

[0126] After contacting at least one target analyte with at least one probe, the single-end adaptor ligation method can further include: (2) providing a force sufficient to release the identifier oligonucleotide to the location of the sample. In a non-limiting example, in aspects where the probe comprises a photocleavable linker between the identifier oligonucleotide and the target binding domain, exciting the region of interest (ROI) with light of sufficient wavelength to cleave the photocleavable linker.

[0127] After releasing the identifier oligonucleotide, the single-end adaptor ligation method may further include: (3) collecting the released identifier oligonucleotide. By directing the force only to a specific position in step (2), the identifier oligonucleotide is released only from the probe within the position, and not from the probe outside the position. Therefore, in step (3), only the identifier oligonucleotide for the probe bound to the target within the position is collected, thereby allowing the detection of the characteristics and amount of the target (protein and / or nucleic acid) located only within the position.

[0128] After collecting the released identifier oligonucleotides, the single-end adaptor ligation method may further include: (4) ligating at least one nucleic acid adaptor to the released oligonucleotides collected in step (3); The nucleic acid adapter can include a nucleic acid sequence that identifies a specific location of the sample from which the identifier oligonucleotide is released. For example, if the identifier oligonucleotide is released from a location of the sample designated as "ROI #1", the nucleic acid adapter will include a nucleic acid sequence corresponding to "ROI #1". The nucleic acid adapter can also include a unique molecular identifier. The nucleic acid adapter can also include a second amplification primer binding site.

[0129] In some aspects, the nucleic acid adaptor can also include a constant nucleic acid sequence to minimize the connection bias caused by the difference in the sequence of the specific identifier oligonucleotide. The constant nucleic acid sequence can include a cleavable portion. The cleavable portion can be enzymatically cleavable. In a non-limiting example, the enzymatically cleavable portion can be a USER sequence, wherein the USER sequence includes the sequence GUGUATUG.

[0130] Nucleic acid adaptors can comprise any combination of the above features.

[0131] The nucleic acid adaptor can be a partially double-stranded nucleic acid molecule. In aspects where the nucleic acid adaptor is partially double-stranded, the nucleic acid adaptor comprises a double-stranded annealing region and a single-stranded mismatch region.

[0132] In aspects where the nucleic acid adaptor is partially double-stranded and comprises a nucleic acid sequence that identifies a specific position of a sample from which the identifier oligonucleotide is released, the nucleic acid sequence that identifies the specific position of a sample from which the identifier oligonucleotide is released can be present in a double-stranded annealing region of the nucleic acid adaptor.

[0133] In aspects where the nucleic acid adaptor is partially double-stranded and comprises a constant nucleic acid sequence that minimizes ligation bias, the constant nucleic acid sequence that minimizes ligation bias can be present in a double-stranded annealing region of the nucleic acid adaptor.

[0134] In aspects where the nucleic acid adaptor is partially double-stranded and comprises a unique molecular identifier, the unique molecular identifier can be present in a single-stranded mismatch region.

[0135] In aspects where the nucleic acid adaptor is partially double-stranded and comprises a second amplification primer binding site, the second amplification primer binding site can be present in a single-stranded mismatch region of the nucleic acid adaptor.

[0136] After connecting at least one nucleic acid linker, the double-end linker connection method may further include: (5) amplifying the connection product produced in step (4); and (6) identifying the released oligonucleotides by sequencing the amplification product produced in step (5), thereby spatially detecting at least one target analyte in the sample.

[0137] In other aspects of the single-end adaptor ligation methods of the present disclosure, at least one of the amplification primers used in step (5) to amplify the ligation product produced in step (4) comprises a nucleic acid sequence that identifies a specific location of the tissue sample from which the identifier oligonucleotide was released. For example, if the identifier oligonucleotide is released from a location of the sample designated as "ROI #1", then at least one of the amplification primers will comprise a nucleic acid sequence corresponding to "ROI #1".

[0138] Figure 2 Schematic diagrams of preferred aspects of the single-end adapter ligation methods of the present disclosure are shown. In this aspect, the probe comprises a target binding domain, which is an antibody that binds to a target protein. In the upper left figure, the probe binds to the target protein. In the upper right figure, a UV-light-cleavable linker between the target binding domain and the identifier oligonucleotide is cleaved, thereby releasing the identifier oligonucleotide. The identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target protein and a first amplification primer binding site. In the non-limiting example, the identifier oligonucleotide is double-stranded, and one strand comprises three separate nucleic acid molecules. The identifier oligonucleotide also comprises a 3' end having a single nucleotide overhang.

[0139] exist Figure 2 In the bottom figure, the nucleic acid adapter is connected to the end of the identifier oligonucleotide comprising a 3' single nucleotide overhang. In the non-limiting example, the nucleic acid adapter is partially double-stranded and comprises a double-stranded annealing region and a single-stranded mismatch region. Present in the double-stranded annealing region is a constant nucleic acid sequence that minimizes the connection deviation and a nucleic acid sequence that identifies a specific position of the sample from which the identifier oligonucleotide is released. Present in the single-stranded mismatch region is a unique molecular identifier and a second amplification primer binding site. After the nucleic acid adapter is connected to the identifier oligonucleotide, an amplification primer amplification product is used that is bound to the first and second amplification primer binding sites, and sequencing is performed to identify the target protein bound by the probe.

[0140] In one aspect, the present disclosure provides a composition of an identifier oligonucleotide connected to a nucleic acid adapter for spatial detection of at least one target analyte in a sample. The identifier oligonucleotide connected to a nucleic acid adapter comprises an identifier oligonucleotide, wherein the identifier oligonucleotide comprises a unique nucleic acid sequence capable of identifying a target analyte in a sample and a first amplification primer binding site. One end of the identifier oligonucleotide is attached to a nucleic acid adapter molecule, wherein the nucleic acid adapter molecule is partially double-stranded and comprises a double-stranded annealing region and a single-stranded mismatch region and a second single-stranded mismatch region. The double-stranded mismatch region comprises a constant nucleic acid sequence that minimizes connection deviation and a nucleic acid sequence nucleic acid sequence capable of identifying a specific position of a sample. The single-stranded mismatch region comprises a second amplification primer binding site. A schematic diagram of an identifier oligonucleotide connected to a nucleic acid adapter is shown in Figure 2in the bottom figure.

[0141] In another aspect, the present disclosure provides compositions and methods for spatially detecting at least one target analyte in a sample using the probes of the present disclosure in a method referred to herein as a "templated primer extension method."

[0142] The templated primer extension method of the present disclosure may include: (1) contacting at least one target analyte in a sample with at least one probe of the present disclosure. The at least one target analyte may be a target protein or a target nucleic acid. In the aspect that the at least one target analyte is a target protein, the probe may include a target binding domain, which is a target protein binding region that can specifically bind to the target protein of interest. In the aspect that the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region, which can directly or indirectly hybridize with the target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain. The identifier oligonucleotide may also include a first amplification primer binding site.

[0143] After contacting at least one target analyte with at least one probe, the templated primer extension method can further include: (2) providing a force sufficient to release the identifier oligonucleotide to the location of the sample. In a non-limiting example, in aspects where the probe comprises a photocleavable linker between the identifier oligonucleotide and the target binding domain, exciting the region of interest (ROI) with light of sufficient wavelength to cleave the photocleavable linker.

[0144] After releasing the identifier oligonucleotide, the templated primer extension method may further include: (3) collecting the released identifier oligonucleotide. By directing the force only to a specific position in step (2), the identifier oligonucleotide is released only from the probe within the position, and not from the probe outside the position. Therefore, in step (3), only the identifier oligonucleotide for the probe bound to the target within the position is collected, thereby allowing the detection of the characteristics and amount of the target (protein and / or nucleic acid) located only within the position.

[0145] After collecting the released identifier oligonucleotide, the templated primer extension method may further include: (4) hybridizing the single-stranded nucleic acid template with the released identifier oligonucleotide collected in step (3).

[0146] The single-stranded nucleic acid template may contain a region that is complementary to the unique nucleic acid sequence of the identifier oligonucleotide, thereby allowing the single-stranded nucleic acid template to hybridize with the collected identifier oligonucleotides.

[0147] The single-stranded nucleic acid template may also comprise: a nucleic acid sequence comprising a unique molecular identifier.

[0148] The single-stranded nucleic acid template may also comprise a nucleic acid sequence that identifies a specific location in the sample from which the identifier oligonucleotide was released.

[0149] The single-stranded nucleic acid template may also include a nucleic acid sequence that is complementary to the second amplification primer binding site.

[0150] The single-stranded nucleic acid template may comprise any combination of the above-mentioned features.

[0151] After the identifier oligonucleotide hybridizes to the single-stranded nucleic acid template, the template primer extension method can further include: (5) extending the identifier oligonucleotide of step (4) to form an extension product complementary to the single-stranded nucleic acid template, wherein the extension product comprises the identifier oligonucleotide and a sequence complementary to the single-stranded nucleic acid template; (6) amplifying the extension product of step (6) using amplification primers that hybridize to the first and second amplification primer binding sites; and (7) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (6), thereby spatially detecting at least one target analyte in the sample.

[0152] In some aspects, the single-stranded nucleic acid template may comprise an affinity molecule. In aspects where the single-stranded nucleic acid template comprises an affinity molecule, the templated primer extension method may further comprise an affinity purification step between steps (4) and (5).

[0153] Figure 3 A schematic diagram of a preferred aspect of a template primer extension method of the present disclosure is shown. In this aspect, the probe comprises a target binding domain, which is an antibody that binds to a target protein. In the upper left figure, the probe binds to the target protein. In the upper right figure, a UV-light-cleavable joint between the target binding domain and the identifier oligonucleotide is cleaved to release the identifier oligonucleotide. The identifier oligonucleotide comprises a unique nucleic acid sequence that identifies the target protein and a first amplification primer binding site. In the lower right figure, the identifier oligonucleotide hybridizes with a single-stranded nucleic acid template. In the non-limiting example, the single-stranded nucleic acid template comprises an affinity molecule, a nucleic acid sequence complementary to the unique nucleic acid sequence of the identifier oligonucleotide, a first unique molecular identifier, and a sequence complementary to the second amplification primer binding site. The identifier oligonucleotide is extended to form an extension product complementary to the single-stranded nucleic acid template. As shown in the lower left figure, the extension product comprises an identifier oligonucleotide, a nucleic acid sequence complementary to the first unique molecular identifier, and a second amplification primer binding site. After the extension reaction, the primer extension product is amplified using an amplification primer that binds to the first and second amplification primer binding sites. In the non-limiting example, one of the amplification primers contains a nucleic acid sequence that identifies a specific location of the sample from which the identifier oligonucleotide is released. The amplification product is then sequenced to identify the target protein bound by the probe.

[0154] In one aspect, the present disclosure provides a composition of a template-extended identifier oligonucleotide for spatial detection of at least one target analyte in a sample. The template-extended identifier oligonucleotide comprises a first flow cell adapter sequence suitable for sequencing, followed by a first unique molecular identifier, followed by an identifier oligonucleotide, followed by a second unique molecular identifier, followed by a second amplification primer binding site, followed by a third unique molecular identifier, followed by a second flow cell adapter sequence suitable for sequencing. The identifier oligonucleotide comprises a first amplification primer binding site and a unique nucleic acid sequence capable of identifying a target analyte in a sample. A schematic diagram of the template-extended identifier oligonucleotide is shown in Figure 4 in the bottom figure.

[0155] In another aspect, the present disclosure provides compositions and methods for spatially detecting at least one target analyte in a sample using the probes of the present disclosure in a method referred to herein as a "short probe hybridization method."

[0156] The short probe hybridization method of the present disclosure may include: (1) contacting at least one target analyte in a sample with at least one probe of the present disclosure. The at least one target analyte may be a target protein or a target nucleic acid. In the aspect that the at least one target analyte is a target protein, the probe may include a target binding domain, which is a target protein binding region that can specifically bind to the target protein of interest. In the aspect that the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region, which can directly or indirectly hybridize with the target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain.

[0157] After contacting at least one target analyte with at least one probe, the short probe hybridization method can further include: (2) providing a force sufficient to release the identifier oligonucleotide to the location of the sample. In a non-limiting example, in an aspect where the probe comprises a photocleavable linker between the identifier oligonucleotide and the target binding domain, exciting the region of interest (ROI) with light of sufficient wavelength to cleave the photocleavable linker.

[0158] After releasing the identifier oligonucleotide, the short probe hybridization method may further include: (3) collecting the released identifier oligonucleotide. By directing the force only to a specific position in step (2), the identifier oligonucleotide is released only from the probe within the position, and not from the probe outside the position. Therefore, in step (3), only the identifier oligonucleotide for the probe bound to the target within the position is collected, thereby allowing the detection of the characteristics and amount of the target (protein and / or nucleic acid) located only within the position.

[0159] After collecting the released identifier oligonucleotide, the short probe hybridization method may further include: (4) hybridizing the first nucleic acid probe and the second nucleic acid probe to the released identifier oligonucleotide.

[0160] The first or second nucleic acid probe may comprise a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. The first or second nucleic acid probe may also comprise a nucleic acid sequence that identifies a specific location of a sample from which the identifier oligonucleotide is released. The first or second nucleic acid probe may also comprise: a nucleic acid sequence comprising a unique molecular identifier. The first nucleic acid probe may comprise a first amplification primer binding site. The second nucleic acid probe may comprise a second amplification primer binding site.

[0161] The first or second nucleic acid probe may comprise any combination of the above features. Figure 5 In the preferred aspect described in, the first nucleic acid probe comprises a first amplification primer binding site, a nucleic acid sequence that identifies a specific position of a sample from which the identifier oligonucleotide is released, and a nucleic acid sequence that is complementary to the identifier oligonucleotide. In the same preferred aspect, the second nucleic acid probe comprises a second amplification primer binding site, a nucleic acid sequence that includes a unique molecular identifier, and a nucleic acid sequence that is complementary to a portion of the identifier oligonucleotide. In the preferred aspect, the nucleic acid sequence that identifies a specific position of a sample from which the identifier oligonucleotide is released is located at 5' of the first amplification primer binding site, and the unique molecular identifier is located at 3' of the second amplification primer binding site.

[0162] exist Figure 6 In another preferred aspect described in, the first nucleic acid probe comprises a first amplification primer binding site, a nucleic acid sequence that identifies a specific position of a sample from which the identifier oligonucleotide is released, a nucleic acid sequence that includes a unique molecular identifier, and a nucleic acid sequence that is complementary to a portion of the identifier oligonucleotide. In the same preferred aspect, the second nucleic acid probe comprises a second amplification primer binding site and a nucleic acid sequence that is complementary to the identifier oligonucleotide. In the preferred aspect, the nucleic acid sequence that identifies a specific position of a sample from which the identifier oligonucleotide is released and the unique molecular identifier are located 5' of the first amplification primer binding site.

[0163] exist Figure 7 In another preferred aspect described in, the first nucleic acid probe comprises a first amplification primer binding site and a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. In the same preferred aspect, the second nucleic acid probe comprises a second amplification primer binding site, a nucleic acid sequence identifying a specific position of a sample from which the identifier oligonucleotide is released, a nucleic acid sequence comprising a unique molecular identifier, and a nucleic acid sequence complementary to the identifier oligonucleotide. In the preferred aspect, the nucleic acid sequence identifying a specific position of a sample from which the identifier oligonucleotide is released and the unique molecular identifier are located 3' of the second amplification primer binding site.

[0164] exist Fig.15 In another preferred aspect described in, the first nucleic acid probe comprises a first amplification primer binding site, a nucleic acid sequence comprising a unique molecular identifier and a nucleic acid sequence complementary to a portion of an identifier oligonucleotide. In the same preferred aspect, the second nucleic acid probe comprises a second amplification primer binding site and a nucleic acid sequence complementary to a portion of an identifier oligonucleotide. In the preferred aspect, the nucleic acid sequence comprising a unique molecular identifier is located 3' of the first amplification binding site.

[0165] exist Fig.17 In another preferred aspect described in, the first nucleic acid probe comprises a first amplification primer binding site, a nucleic acid sequence comprising a unique molecular identifier and a nucleic acid sequence complementary to a portion of an identifier oligonucleotide. In the same preferred aspect, the second nucleic acid probe comprises a second amplification primer binding site and a nucleic acid sequence complementary to a portion of an identifier oligonucleotide. In the preferred aspect, the nucleic acid sequence comprising a unique molecular identifier is located 5' of the first amplification binding site.

[0166] The first nucleic acid probe and the second nucleic acid probe can hybridize with the identifier oligonucleotide so that the first and second nucleic acid probes are adjacent and do not overlap. On the other hand, the first nucleic acid probe and the second nucleic acid probe can hybridize with the identifier oligonucleotide so that the first and second nucleic acid probes are not adjacent and do not overlap.

[0167] After the first and second nucleic acid probes are hybridized to the identifier oligonucleotide, the short probe hybridization method may further include: (5) in the aspect where the first and second nucleic acid probes are hybridized to the identifier oligonucleotide so that the first and second nucleic acid probes are adjacent and non-overlapping, for example, by performing a nick repair reaction to connect the first and second nucleic acid probes together. On the other hand, in the aspect where the first and second nucleic acid probes are hybridized to the identifier oligonucleotide so that the first and second nucleic acid probes are non-adjacent and non-overlapping, the method includes, for example, by performing a nick extension reaction and a nick repair reaction to connect the first and second nucleic acid probes together, so that the first and second nucleic acid probes are connected together.

[0168] After connecting the first and second nucleic acid probes, the short probe hybridization method can further include: (6) amplifying the connection product produced in step (5) using an amplification primer that hybridizes to the first and second amplification primer binding sites; and (7) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (6), thereby spatially detecting at least one target analyte in the sample.

[0169] In one aspect, the present disclosure provides a composition of an identifier oligonucleotide-short nucleic acid probe complex for spatial detection of at least one target analyte in a sample. The identifier oligonucleotide-short nucleic acid probe complex comprises an identifier oligonucleotide that hybridizes with a first nucleic acid probe and a second nucleic acid probe. The identifier oligonucleotide comprises a unique nucleic acid sequence capable of identifying a target analyte in a sample. The first nucleic acid probe comprises a first amplification primer binding site, followed by a unique nucleic acid sequence capable of identifying a specific position in the sample, followed by a region complementary to the identifier oligonucleotide. The second nucleic acid probe comprises a second amplification primer binding site, followed by a nucleic acid sequence comprising a unique molecular identifier, followed by a region complementary to the identifier oligonucleotide. A schematic diagram of the identifier oligonucleotide-short nucleic acid probe complex is shown in Figure 5 Depicted in.

[0170] In one aspect, the present disclosure provides a composition of an identifier oligonucleotide-short nucleic acid probe complex for spatial detection of at least one target analyte in a sample. The identifier oligonucleotide-short nucleic acid probe complex comprises an identifier oligonucleotide that hybridizes with a first nucleic acid probe and a second nucleic acid probe. The identifier oligonucleotide comprises a unique nucleic acid sequence capable of identifying a target analyte in a sample. The first nucleic acid probe comprises a first amplification primer binding site, followed by a nucleic acid sequence comprising a unique molecular identifier, followed by a region complementary to the identifier oligonucleotide, wherein the nucleic acid sequence comprising the unique molecular identifier is located 3' to the first amplification primer binding site. The second nucleic acid probe comprises a second amplification primer binding site, followed by a region complementary to the identifier oligonucleotide. A schematic diagram of the identifier oligonucleotide-short nucleic acid probe complex is shown in Fig.15 Depicted in.

[0171] In one aspect, the present disclosure provides a composition of an identifier oligonucleotide-short nucleic acid probe complex for spatial detection of at least one target analyte in a sample. The identifier oligonucleotide-short nucleic acid probe complex comprises an identifier oligonucleotide that hybridizes with a first nucleic acid probe and a second nucleic acid probe. The identifier oligonucleotide comprises a unique nucleic acid sequence capable of identifying a target analyte in a sample. The first nucleic acid probe comprises a first amplification primer binding site, followed by a nucleic acid sequence comprising a unique molecular identifier, followed by a region complementary to the identifier oligonucleotide, wherein the nucleic acid sequence comprising the unique molecular identifier is located 5' of the first amplification primer binding site. The second nucleic acid probe comprises a second amplification primer binding site, followed by a region complementary to the identifier oligonucleotide. A schematic diagram of the identifier oligonucleotide-short nucleic acid probe complex is shown in Fig.17 Depicted in.

[0172] Fig.16A schematic overview of an exemplary short probe hybridization method of the present disclosure is shown. First, at least one target analyte in a sample is contacted with at least one probe of the present disclosure. The at least one target analyte can be a target protein or a target nucleic acid. In aspects where the at least one target analyte is a target protein, the probe can include a target binding domain, which is a target protein binding region that can specifically bind to a target protein of interest. In aspects where the at least one target analyte is a target nucleic acid, the probe can include a target nucleic acid binding region that can directly or indirectly hybridize to a target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide can include a unique nucleic acid sequence that identifies a target analyte that is bound to the target domain.

[0173] After contacting at least one target analyte with at least one probe, a force sufficient to release the identifier oligonucleotide is then applied to the sample location. After release, the identifier oligonucleotide is collected, such as Fig.16 as shown in the top figure.

[0174] As from Fig.16 As shown in the second figure from the top of the figure, the released identifier oligonucleotide is then hybridized with the first nucleic acid probe and the second nucleic acid probe. In the non-limiting example, the first nucleic acid probe comprises a first amplification primer binding site, a nucleic acid sequence comprising a unique molecular identifier and a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. The nucleic acid sequence comprising the unique molecular identifier is located at 3' of the first amplification primer binding site. The second nucleic acid probe comprises a second amplification primer binding site and a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. In the non-limiting example, the first and second nucleic acid probes hybridize with the identifier oligonucleotide so that the first and second nucleic acid probes are adjacent and non-overlapping. After hybridization with the identifier oligonucleotide, the first and second probes are connected together, for example, by performing a nick repair reaction.

[0175] After ligating the first and second nucleic acid probes, the ligated product is amplified via PCR using amplification primers that hybridize to the first and second amplification primer binding sites. Fig.16 As shown in the second figure from the bottom, the amplification primer that hybridizes to the second amplification primer binding site comprises the first flow cell binding site, the first nucleic acid sequence that identifies the specific position of the sample from which the identifier oligonucleotide is released, and the nucleic acid sequence that is complementary to the second amplification primer binding site. The amplification primer that hybridizes to the first amplification primer binding site comprises the second flow cell binding site, the second nucleic acid sequence that identifies the specific position of the sample from which the identifier oligonucleotide is released, and the nucleic acid sequence that is complementary to the first amplification primer binding site. Then, Fig.16 The PCR products shown in the bottom panel are sequenced to identify the released oligonucleotides, thereby spatially detecting at least one target analyte in the sample.

[0176] Fig.18 A schematic overview of an exemplary short probe hybridization method of the present disclosure is shown. First, at least one target analyte in a sample is contacted with at least one probe of the present disclosure. The at least one target analyte can be a target protein or a target nucleic acid. In aspects where the at least one target analyte is a target protein, the probe can include a target binding domain, which is a target protein binding region that can specifically bind to a target protein of interest. In aspects where the at least one target analyte is a target nucleic acid, the probe can include a target nucleic acid binding region that can directly or indirectly hybridize to a target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide can include a unique nucleic acid sequence that identifies a target analyte that is bound to the target domain.

[0177] After contacting at least one target analyte with at least one probe, a force sufficient to release the identifier oligonucleotide is then applied to the sample location. After release, the identifier oligonucleotide is collected, such as Fig.18 As shown in the top figure.

[0178] As from Fig.18 As shown in the second figure from the top of the figure, the released identifier oligonucleotide is then hybridized with the first nucleic acid probe and the second nucleic acid probe. In the non-limiting example, the first nucleic acid probe comprises a first amplification primer binding site, a nucleic acid sequence comprising a unique molecular identifier and a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. The nucleic acid sequence comprising the unique molecular identifier is located at 5' of the first amplification primer binding site. The second nucleic acid probe comprises a second amplification primer binding site and a nucleic acid sequence complementary to a portion of the identifier oligonucleotide. In the non-limiting example, the first and second nucleic acid probes hybridize with the identifier oligonucleotide, so that the first and second nucleic acid probes are adjacent and non-overlapping. After hybridization with the identifier oligonucleotide, the first and second probes are connected together, for example, by performing a nick repair reaction.

[0179] After ligating the first and second nucleic acid probes, the ligated product is amplified via PCR using amplification primers that hybridize to the first and second amplification primer binding sites. Fig.18 As shown in the second figure from the bottom, the amplification primer that hybridizes to the second amplification primer binding site comprises the first flow cell binding site, the first nucleic acid sequence that identifies the specific position of the sample from which the identifier oligonucleotide is released, and the nucleic acid sequence that is complementary to the second amplification primer binding site. The amplification primer that hybridizes to the first amplification primer binding site comprises the second flow cell binding site, the second nucleic acid sequence that identifies the specific position of the sample from which the identifier oligonucleotide is released, and the nucleic acid sequence that is complementary to the first amplification primer binding site. Then, Fig.18The PCR products shown in the bottom panel are sequenced to identify the released oligonucleotides, thereby spatially detecting at least one target analyte in the sample.

[0180] In another aspect, the present disclosure provides compositions and methods for spatially detecting at least one target analyte in a sample using the probes of the present disclosure in a method referred to herein as a "long probe hybridization method."

[0181] The long probe hybridization method of the present disclosure may include: (1) contacting at least one target analyte in a sample with at least one probe of the present disclosure. The at least one target analyte may be a target protein or a target nucleic acid. In the aspect that the at least one target analyte is a target protein, the probe may include a target binding domain, which is a target protein binding region that can specifically bind to the target protein of interest. In the aspect that the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region, which can directly or indirectly hybridize with the target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain.

[0182] After contacting at least one target analyte with at least one probe, the long probe hybridization method can further include: (2) providing a force sufficient to release the identifier oligonucleotide to the location of the sample. In a non-limiting example, in an aspect where the probe comprises a photocleavable linker between the identifier oligonucleotide and the target binding domain, exciting the region of interest (ROI) with light of sufficient wavelength to cleave the photocleavable linker.

[0183] After releasing the identifier oligonucleotide, the long probe hybridization method may further include: (3) collecting the released identifier oligonucleotide. By directing the force only to a specific position in step (2), the identifier oligonucleotide is released only from the probe within the position, and not from the probe outside the position. Therefore, in step (3), only the identifier oligonucleotide for the probe bound to the target within the position is collected, thereby allowing the detection of the characteristics and amount of the target (protein and / or nucleic acid) located only in the position.

[0184] After collecting the one or more released identifier oligonucleotides, the long probe hybridization method may further include: (4) hybridizing the first nucleic acid probe and the second nucleic acid probe to the released identifier oligonucleotides.

[0185] The first or second nucleic acid probe may comprise a nucleic acid sequence that is complementary to a portion of the identifier oligonucleotide.The first or second nucleic acid probe may also comprise a nucleic acid sequence that identifies a specific location of the sample from which the identifier oligonucleotide is released.

[0186] The first or second nucleic acid probe may further comprise a first unique molecular identifier. The first or second nucleic acid probe may further comprise a second unique molecular identifier. The first or second nucleic acid probe may further comprise a third unique molecular identifier.

[0187] The first nucleic acid probe can include a first amplification primer binding site.

[0188] The first nucleic acid probe may further comprise a first flow cell binding site.The second nucleic acid probe may comprise a second flow cell binding site.

[0189] The first and second nucleic acid probes may comprise any combination of the above features. Figure 8 In the preferred aspect depicted, the first nucleic acid probe comprises a first flow cell binding site, a first unique molecular identifier, a first amplification primer binding site, a nucleic acid sequence that identifies a specific location of a sample from which the identifier oligonucleotide is released, and a nucleic acid sequence that is complementary to the identifier oligonucleotide. In the same preferred aspect, the second nucleic acid probe comprises a second flow cell binding site, a second unique molecular identifier, a third unique molecular identifier, and a nucleic acid sequence that is complementary to the identifier oligonucleotide. In the preferred aspect, the nucleic acid sequence that identifies a specific location of a sample from which the identifier oligonucleotide is released and the first unique molecular identifier are located 5' of the first flow cell binding site and the second and third unique molecular identifiers are located 3' of the second flow cell binding site.

[0190] exist Fig. 9 Another preferred aspect depicted, the first nucleic acid probe comprises a first flow cell binding site, a first unique molecular identifier, a second unique molecular identifier, a first amplification primer binding site, a nucleic acid sequence that identifies a specific location of a sample from which the identifier oligonucleotide is released, and a nucleic acid sequence that is complementary to the identifier oligonucleotide. In the same preferred aspect, the second nucleic acid probe comprises a second flow cell binding site, a third unique molecular identifier, and a nucleic acid sequence that is complementary to the identifier oligonucleotide. In the preferred aspect, the first unique molecular identifier, the second unique molecular identifier, and a nucleic acid sequence that identifies a specific location of a sample from which the identifier oligonucleotide is released are located 5' of the first flow cell binding site and the third unique molecular identifier is located 3' of the second flow cell binding site.

[0191] exist Fig.10In another preferred aspect depicted in , the first nucleic acid probe comprises a first flow cell binding site, a first unique molecular identifier, a first amplification primer binding site, and a nucleic acid sequence complementary to the identifier oligonucleotide. In the same preferred aspect, the second nucleic acid probe comprises a second flow cell binding site, a second unique molecular identifier, a third unique molecular identifier, a nucleic acid sequence that identifies a specific position of the sample from which the identifier oligonucleotide is released, and a nucleic acid sequence that is complementary to the identifier oligonucleotide. In the preferred aspect, the first unique molecular identifier is located 5' of the first flow cell binding site, and the second unique molecular identifier, the third unique molecular identifier, and a nucleic acid sequence that identifies a specific position of the sample from which the identifier oligonucleotide is released are located 3' of the second amplification primer binding site.

[0192] The first nucleic acid probe and the second nucleic acid probe can hybridize with the identifier oligonucleotide so that the first and second nucleic acid probes are adjacent and do not overlap. On the other hand, the first nucleic acid probe and the second nucleic acid probe can hybridize with the identifier oligonucleotide so that the first and second nucleic acid probes are not adjacent and do not overlap.

[0193] After the first and second nucleic acid probes are hybridized to the identifier oligonucleotide, the long probe hybridization method may further include: (5) in the aspect where the first and second nucleic acid probes are hybridized to the identifier oligonucleotide such that the first and second nucleic acid probes are adjacent and non-overlapping, performing a nick repair reaction such that the first and second nucleic acid probes are connected together. In another aspect where the first and second nucleic acid probes are hybridized to the identifier oligonucleotide such that the first and second nucleic acid probes are non-adjacent and non-overlapping, the method includes performing a nick extension and a nick repair reaction such that the first and second nucleic acid probes are connected together.

[0194] The method may further include: (6) amplifying the ligation product produced in step (5) using an amplification primer that hybridizes to the first and second amplification primer binding sites; and (7) identifying the released identifier oligonucleotide by sequencing the amplification product produced in step (6), thereby spatially detecting at least one target analyte in the sample.

[0195] In one aspect, the present disclosure provides a composition of an identifier oligonucleotide-long nucleic acid probe complex for spatial detection of at least one target analyte in a sample. The identifier oligonucleotide-long nucleic acid probe complex comprises an identifier oligonucleotide that hybridizes with a first nucleic acid probe and a second nucleic acid probe. The identifier oligonucleotide comprises a unique nucleic acid sequence capable of identifying a target analyte in a sample. The first nucleic acid probe comprises a first flow cell binding site suitable for sequencing, followed by a first unique molecular identifier, followed by a first amplification primer binding site, followed by a unique nucleic acid sequence capable of identifying a specific position in the sample, followed by a region complementary to the identifier oligonucleotide. The second nucleic acid probe comprises a second flow cell binding site, followed by a second unique molecular identifier, followed by a third unique molecular identifier, followed by a region complementary to the identifier oligonucleotide. A schematic diagram of the identifier oligonucleotide-short nucleic acid probe complex is shown in Figure 8 Depicted in.

[0196] In another aspect, the present disclosure provides compositions and methods for spatially detecting at least one target analyte in a sample using the probes of the present disclosure in a method referred to herein as a "direct PCR method."

[0197] The direct PCR method of the present disclosure may include: (1) contacting at least one target analyte in a sample with at least one probe of the present disclosure. The at least one target analyte may be a target protein or a target nucleic acid. In the aspect that the at least one target analyte is a target protein, the probe may include a target binding domain, which is a target protein binding region that can specifically bind to the target protein of interest. In the aspect that the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region, which can directly or indirectly hybridize with the target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain. The identifier oligonucleotide may also include a first amplification primer binding site, a second amplification primer binding site, or a unique molecular identifier. The identifier oligonucleotide may include any combination of these features. Any of these features may also be flanked by a region of a constant nucleic acid sequence comprising about 1 nucleotide to about 10 nucleotides.

[0198] After contacting the at least one analyte with the at least one probe, the direct PCR method further comprises: (2) providing a force sufficient to release the identifier oligonucleotide to the location of the sample. In a non-limiting example, in an aspect where the probe comprises a photocleavable linker between the identifier oligonucleotide and the target binding domain, exciting the region of interest (ROI) with light of sufficient wavelength to cleave the photocleavable linker.

[0199] The direct PCR method may further include: (3) collecting the released identifier oligonucleotides. By directing the force only to a specific position in step (2), the identifier oligonucleotides are released only from the probes within the position, and not from the probes outside the position. Therefore, in step (3), only the identifier oligonucleotides for the probes bound to the target within the position are collected, thereby allowing the detection of the characteristics and amount of the target (protein and / or nucleic acid) located only within the position.

[0200] After releasing the identifier oligonucleotide, the direct PCR method can further include: (4) using a first amplification primer that can bind to the first amplification primer binding site and a second amplification primer that can bind to the second amplification primer binding site to amplify the released identifier oligonucleotide. In some aspects, at least one of the amplification primers contains a nucleic acid sequence that identifies a specific position of the sample from which the identifier oligonucleotide is released. For example, if the identifier oligonucleotide is released from the position of a sample designated as "ROI #1", at least one of the amplification primers will contain a nucleic acid sequence corresponding to "ROI #1". In other aspects, at least one of the amplification primers contains a unique molecular identifier.

[0201] After amplification, the direct PCR method of the present disclosure may further comprise: (5) identifying the released oligonucleotides by sequencing the amplification products produced in step (5), thereby spatially detecting at least one target analyte in the sample.

[0202] Fig.11 The schematic diagram of the preferred aspects of the direct PCR method of the present disclosure is shown. In this respect, the probe comprises a target binding domain, and the target binding domain comprises a nucleic acid sequence complementary to the target nucleic acid. In the upper figure, the probe hybridizes with the target nucleic acid. In the lower figure, the ultraviolet light-cuttable joint between the target binding domain and the identifier oligonucleotide is cut to release the identifier oligonucleotide. The identifier oligonucleotide comprises a first amplification primer binding site, a second amplification primer binding site, a unique molecular identifier and a unique nucleic acid sequence that identifies the target analyte that is bound to the target binding domain. Between these four features is a constant spacer of 3 nucleotides in length. The identifier oligonucleotide is double-stranded and comprises a chain comprising 3 separated nucleic acid molecules. After release, the identifier oligonucleotide is amplified using a first amplification primer amplification that hybridizes with the first amplification primer binding site and comprises a nucleic acid sequence that identifies a specific position of the sample from which the identifier oligonucleotide is released and a second amplification primer amplification that hybridizes with the second amplification primer binding site. Then the amplified product is sequenced to identify the target nucleic acid bound by the probe.

[0203] Fig.19A schematic diagram of a preferred aspect of the direct PCR method of the present disclosure is shown. In this aspect, the identifier oligonucleotide comprises a first amplification primer binding site, a nucleic acid sequence comprising a unique molecular identifier, a unique nucleic acid sequence that identifies a target analyte bound to a target binding domain, and a second amplification primer binding site, such as Fig.19 The identifier oligonucleotide is amplified using amplification primers that hybridize to the first and second amplification primer binding sites. Fig.19 As shown in the middle figure of , the amplification primer that hybridizes to the second amplification primer binding site comprises the first flow cell binding site, a nucleic acid sequence of a specific position of the first identification sample from which the identifier oligonucleotide is released, and a nucleic acid sequence complementary to the second amplification primer binding site. The amplification primer that hybridizes to the first amplification primer binding site comprises the second flow cell binding site, a nucleic acid sequence of a specific position of the second identification sample from which the identifier oligonucleotide is released, and a nucleic acid sequence complementary to the first amplification primer binding site. Fig.19 The PCR products shown in the bottom panel are sequenced to identify the released oligonucleotides, thereby spatially detecting at least one target analyte in the sample.

[0204] In one aspect, the present disclosure provides a composition of a direct-PCR compatible identifier oligonucleotide for spatial detection of at least one target analyte in a sample. The direct-PCR compatible identifier oligonucleotide comprises a first amplification primer binding site, followed by a unique nucleic acid sequence capable of identifying the target analyte in the sample, followed by a unique molecular identifier, followed by a second amplification primer binding site. A schematic diagram of a direct-PCR compatible identifier oligonucleotide is shown in Fig.11 Depicted in the figure below.

[0205] In one aspect, the present disclosure provides a composition of a direct-PCR compatible identifier oligonucleotide for spatial detection of at least one target analyte in a sample. The direct-PCR compatible identifier oligonucleotide comprises a first amplification primer binding site, followed by a nucleic acid sequence comprising a unique molecular identifier, followed by a unique nucleic acid sequence capable of identifying the target analyte in the sample, followed by a second amplification primer binding site. A schematic diagram of the direct-PCR compatible identifier oligonucleotide is shown in Fig.19 Shown in the top figure.

[0206] In some aspects of the methods of the present disclosure, at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or at least eight, or at least nine, or at least ten, or at least eleven, or at least twelve, or at least thirteen, or at least fourteen, or at least fifteen, or at least sixteen, or at least seventeen, or at least eighteen, or at least nineteen, or at least twenty, or at least thirty, or at least forty, or at least fifty, or at least sixty, or at least seventy, or at least eighty, or at least ninety, or at least one hundred probes can be bound to a single target analyte. As used herein, the term "tiling" is used to describe when more than one probe of the present disclosure is bound to a target analyte. Fig. 27 The top figure shows the probes being tiled onto the target RNA. Tiling multiple probes onto the target analyte means that each target analyte will be detected individually multiple times, thereby increasing the overall accuracy of the measurement. In a non-limiting example, Fig. 27 In the case of tiling 10 probes onto a single target RNA, shown in the bottom graph, one probe may be erroneously detected too many times (outlier high count probe), while another probe may be erroneously detected too few times (outlier low count probe). However, the other 8 probes may be detected at similar levels, indicating that the two outliers should be discarded during analysis and the signals from the 8 probes used to generate a more accurate measure of target RNA abundance.

[0207] The present disclosure provides compositions and methods for spatially detecting at least one target analyte in a sample using probes of the present disclosure in a method referred to herein as a "non-enzymatic method."

[0208] The enzyme-free method of the present disclosure may include: (1) contacting at least one target analyte in a sample with at least one probe of the present disclosure. The at least one target analyte may be a target protein or a target nucleic acid. In the aspect that the at least one target analyte is a target protein, the probe may include a target binding domain, which is a target protein binding region that can specifically bind to the target protein of interest. In the aspect that the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region, which can directly or indirectly hybridize with the target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain. The identifier oligonucleotide may also include a capture probe binding site.

[0209] After contacting the at least one target analyte with the at least one probe, the non-enzymatic method may further comprise: (2) providing a force sufficient to release the identifier oligonucleotide to the location of the sample. In a non-limiting example, in aspects where the probe comprises a photocleavable linker between the identifier oligonucleotide and the target binding domain, exciting the region of interest (ROI) with light of sufficient wavelength to cleave the photocleavable linker.

[0210] After releasing the identifier oligonucleotide, the enzyme-free method may further comprise: (3) collecting the released identifier oligonucleotide. By directing the force only to a specific location in step (2), the identifier oligonucleotide is released only from the probe within the location, and not from the probe outside the location. Thus, in step (3), only the identifier oligonucleotide for the probe bound to the target within the location is collected, thereby allowing the detection of the characteristics and amount of the target (protein and / or nucleic acid) located only within the location.

[0211] After collecting the released identifier oligonucleotide, the enzyme-free method may further include: (4) hybridizing the capture probe to the released identifier oligonucleotide.

[0212] The capture probe may comprise a region complementary to the capture probe binding site.The capture probe may also comprise an affinity molecule.

[0213] After hybridization of the capture probes, the non-enzymatic method may further include: (5) identifying the released identifier oligonucleotide by sequencing the hybridization products produced in step (4), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0214] The hybridization product produced in step (4) can be sequenced using an enzyme-free sequencing method. Enzyme-free sequencing methods have been described in, for example, US2014946386 and US15 / 819,151, each of which is incorporated herein by reference in its entirety.

[0215] Fig.12 A schematic diagram of a preferred aspect of the enzyme-free method of the present disclosure is shown. In this aspect, the probe comprises a target binding domain comprising a nucleic acid sequence complementary to the target nucleic acid. In the top figure, the probe hybridizes with the target nucleic acid. In the middle figure, a UV-light-cleavable joint between the target binding domain and the identifier oligonucleotide is cut to release the identifier oligonucleotide. The identifier oligonucleotide comprises a unique nucleic acid sequence and a capture probe binding site that identifies the target nucleic acid that is bound to the target binding domain. After release, the identifier oligonucleotide hybridizes with the capture probe, as shown in the bottom figure. The capture probe comprises a nucleic acid sequence and an affinity molecule that are complementary to the capture probe binding site. The product of the hybridization is then sequenced using an enzyme-free sequencing method to identify the target nucleic acid bound by the probe.

[0216] In one aspect, the present disclosure provides a composition of a hybridized identifier oligonucleotide-capture probe complex for spatial detection of at least one target analyte in a sample. The hybridized identifier oligonucleotide-capture probe complex comprises an identifier oligonucleotide hybridized to a capture probe. The identifier oligonucleotide comprises a unique nucleic acid sequence capable of identifying a specific target analyte in a sample and a capture probe binding site. The capture probe comprises an affinity molecule and a region complementary to the capture probe binding site. Fig.12 A schematic diagram of the hybridized identifier oligonucleotide-capture probe complex is depicted in the bottom panel.

[0217] The present disclosure provides compositions and methods for spatially detecting at least one target analyte in a sample using probes of the present disclosure in a method referred to herein as a "multiplexed non-enzymatic method."

[0218] The multiplex enzyme-free method of the present disclosure may include: (1) contacting at least one target analyte in a sample with at least one probe of the present disclosure. The at least one target analyte may be a target protein or a target nucleic acid. In the aspect that the at least one target analyte is a target protein, the probe may include a target binding domain, which is a target protein binding region that can specifically bind to the target protein of interest. In the aspect that the at least one target analyte is a target nucleic acid, the probe may include a target nucleic acid binding region, which can directly or indirectly hybridize with the target nucleic acid of interest. The probe further includes an identifier oligonucleotide. The identifier oligonucleotide may include a unique nucleic acid sequence that identifies the target analyte bound to the target binding domain. The identifier oligonucleotide may also include a capture probe binding site. The identifier oligonucleotide may also include a multiplexed probe binding site.

[0219] After contacting the at least one target analyte with the at least one probe, the multiplex non-enzymatic method can further include: (2) providing a force sufficient to release the identifier oligonucleotide to the location of the sample. In a non-limiting example, in aspects where the probe comprises a photocleavable linker between the identifier oligonucleotide and the target binding domain, exciting the region of interest (ROI) with light of sufficient wavelength to cleave the photocleavable linker.

[0220] After releasing the identifier oligonucleotide, the multiplex enzyme-free method may further include: (3) collecting the released identifier oligonucleotide. By directing the force only to a specific location in step (2), the identifier oligonucleotide is released only from the probe within the location, and not from the probe outside the location. Therefore, in step (3), only the identifier oligonucleotide for the probe bound to the target within the location is collected, thereby allowing the detection of the characteristics and amount of the target (protein and / or nucleic acid) located only within the location.

[0221] After collecting the released identifier oligonucleotides, the multiplexed non-enzymatic method may further include: (4) hybridizing the capture probes and the multiplexing probes to the released identifier oligonucleotides.

[0222] The capture probe may comprise a region complementary to the capture probe binding site.The capture probe may also comprise an affinity molecule.

[0223] The multiplexed probe may comprise a region complementary to the multiplexed probe binding site.The multiplexed probe may also comprise a nucleic acid sequence that identifies a specific location of the sample from which the identifier oligonucleotide is released and a region complementary to the multiplexed probe binding site.

[0224] After hybridization of the capture probe and the multiplexed probe, the multiplexed non-enzymatic method may further include: (5) identifying the released identifier oligonucleotide by sequencing the hybridization product produced in step (4), thereby spatially detecting at least one target analyte in at least one cell in the tissue sample.

[0225] The hybridization product produced in step (4) can be sequenced using an enzyme-free sequencing method. Enzyme-free sequencing methods have been described in, for example, US2014946386 and US15 / 819,151, each of which is incorporated herein by reference in its entirety.

[0226] Fig.13 The schematic diagram of the preferred aspects of the multiple enzyme-free method of the present disclosure is shown. In this aspect, the probe comprises a target binding domain, and the target binding domain comprises a nucleic acid sequence complementary to the target nucleic acid. In the top figure, the probe hybridizes with the target nucleic acid. In the middle figure, the ultraviolet light-cleavable joint between the target binding domain and the identifier oligonucleotide is cut to release the identifier oligonucleotide. The identifier oligonucleotide comprises a unique nucleic acid sequence, a capture probe binding site, and a multiplexed probe binding site that identify the target analyte bound to the target binding domain, as shown in the middle figure. After release, the identifier oligonucleotide hybridizes with the capture probe and the multiplexed probe, as shown in the figure below. The capture probe comprises a nucleic acid sequence and an affinity molecule that are complementary to the capture probe binding site. The multiplexed probe comprises a nucleic acid sequence that is complementary to the multiplexed probe binding site and a nucleic acid sequence that identifies the specific position of the sample from which the identifier oligonucleotide is released. The product of the hybridization is then sequenced using an enzyme-free sequencing method to identify the target nucleic acid bound by the probe.

[0227] In one aspect, the present disclosure provides a composition of a hybridized identifier oligonucleotide-capture probe-multiplex probe complex for spatial detection of at least one target analyte in a sample. The hybridized identifier oligonucleotide-capture probe-multiplex probe complex comprises an identifier oligonucleotide hybridized to a capture probe and a multiplexed probe. The identifier oligonucleotide comprises a unique nucleic acid sequence capable of identifying a specific target analyte in a sample, a capture probe binding site, and a multiplexed probe binding site. The capture probe comprises an affinity molecule and a region complementary to the capture probe binding site. The multiplexed probe comprises a nucleic acid sequence that identifies a specific position of a sample from which the identifier oligonucleotide was released and a region complementary to the multiplexed probe binding site. Fig.13 A schematic diagram of the hybridized identifier oligonucleotide-capture probe-multiplex probe complex is depicted in the bottom panel.

[0228] Fig. 20 is an exemplary schematic diagram of an overview of the method of the present disclosure. First, a sample on a microscope slide is contacted with a plurality of probes of the present disclosure ( Fig. 20 The slides were then imaged and specific regions of interest (ROIs) were selected ( Fig. 20 Then, the specific ROI is irradiated with ultraviolet light to release the identifier oligonucleotide from the probe bound in the ROI. The released identifier oligonucleotide is then collected by aspiration with a micropipette. After aspiration, the identifier oligonucleotide is transferred to a specific well in a 96-well plate. Then, steps 4 and 5 are repeated for each ROI determined in step 2. After all ROIs have been irradiated and all released identifier oligonucleotides have been collected, the identifier oligonucleotide is sequenced using a next generation sequencing method to spatially detect at least one target analyte in the sample.

[0229] As previously described, the present disclosure provides probes for compositions and methods for spatially detecting at least one target analyte in a sample. The present disclosure provides probes comprising a target binding domain and an identifier oligonucleotide. The target binding domain is a region of the probe that specifically binds to at least one target analyte in a sample.

[0230] The probe of the present disclosure can be used for spatial detection of target nucleic acid. In this respect, the target binding domain can be a target nucleic acid binding region. The target nucleic acid binding region preferably has a length of at least 15 nucleotides, and more preferably a length of at least 20 nucleotides. In particular aspects, the target nucleic acid binding region has a length of about 10 to 500, 20 to 400, 25, 30 to 300, 35, 40 to 200 or 50 to 100 nucleotides. The probe and method for combining and identifying target nucleic acid are described in, for example, US2003 / 0013091, US2007 / 0166708, US2010 / 0015607, US2010 / 0261026, US2010 / 0262374, US2010 / 0112710, US2010 / 0047924 and US2014 / 0371088, which are each incorporated herein by reference in their entirety.

[0231] The target nucleic acid binding region can hybridize directly to a target nucleic acid present in a sample. On the other hand, the probes of the present disclosure can hybridize indirectly (via an intermediate oligonucleotide) to a target nucleic acid present in a sample. Fig.14 The probe (or composition) of the aspect is illustrated. The probe comprises a target nucleic acid binding domain combined with a synthetic oligonucleotide (intermediate oligonucleotide), which itself is combined with a target nucleic acid in a biological sample. It can be said that the intermediate oligonucleotide is a probe as defined herein, because it comprises a nucleic acid backbone and can bind to a target nucleic acid. In these aspects, the target nucleic acid binding region of the probe hybridizes with the region of the intermediate oligonucleotide (i.e., the synthetic oligonucleotide), and the region is different from the target nucleic acid present in the sample. Therefore, the target binding region of the probe is independent of the final target nucleic acid in the sample. This provides economical and rapid flexibility in assay design, because the target (present in the sample) specific component of the assay is contained in a cheap and widely available synthetic DNA oligonucleotide rather than a more expensive probe. This synthetic oligonucleotide is simply designed by comprising a region hybridized with a target nucleic acid present in the sample and a region hybridized with the probe. Therefore, a single set of indirect binding probes can be used to detect an unlimited variety of target nucleic acids (present in the sample) in different experiments only by replacing the target-specific (synthetic) oligonucleotide portion of the assay.

[0232] The target nucleic acid may be DNA or RNA, and is preferably messenger RNA (mRNA) or miRNA.

[0233] The probe of the present disclosure can be used to detect the target protein. In this regard, the target binding domain can be a target protein binding region. The target protein binding region includes molecules or assemblies designed to bind to at least one target protein, at least one target protein surrogate or both, and can form a molecular complex comprising the probe and the target protein under appropriate conditions. The target protein binding region may include antibodies, peptides, aptamers or peptidomimetics. Antibodies can be obtained from a variety of sources, including but not limited to polyclonal antibodies, monoclonal antibodies, monospecific antibodies, recombinantly expressed antibodies, humanized antibodies, plant-produced antibodies, etc. The terms protein, polypeptide, peptide and amino acid sequence are used interchangeably herein to refer to amino acid polymers of any length. The polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids or synthetic amino acids. The term also includes amino acid polymers that have been modified, for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation or any other operation (e.g., conjugation with a labeling component). As used herein, the term amino acid refers to natural and / or non-natural or synthetic amino acids, including but not limited to glycine and both D or L optical isomers, as well as amino acid analogs and peptidomimetics. For example, probes and methods for binding and identifying target proteins have been described in US2011 / 0086774, the contents of which are incorporated herein by reference in their entirety.

[0234] The identifier oligonucleotide is a nucleic acid molecule that identifies a target analyte that is bound to a target binding domain. The identifier oligonucleotide comprises a unique nucleic acid sequence that identifies a target analyte that is bound to the target binding domain of the probe. In a non-limiting example, a probe having a target binding domain that binds to protein P53 comprises an identifier oligonucleotide having a unique nucleic acid sequence corresponding to P53, while a probe having a target binding domain that binds to protein P97 comprises an identifier oligonucleotide having a unique nucleic acid sequence corresponding to P97.

[0235] The identifier oligonucleotide may be DNA, RNA, or a combination of DNA and RNA.

[0236] In some aspects, the identifier oligonucleotide may include at least one amplification primer binding site. An amplification primer binding site is a nucleic acid sequence that can bind to an amplification primer. An amplification primer can use methods known in the art, including but not limited to polymerase chain reaction (PCR), for amplification of nucleic acid molecules bound thereto.

[0237] In some aspects, an identifier oligonucleotide can comprise at least one unique molecular identifier.

[0238] The identifier oligonucleotide can be a single-stranded, double-stranded or partially double-stranded nucleic acid molecule. In aspects where the identifier oligonucleotide is double-stranded or partially double-stranded, at least one of the two strands can comprise at least two separate nucleic acid molecules, which, without being bound by theory, allows the identifier oligonucleotide to be denatured at a lower temperature.

[0239] The identifier oligonucleotide may further comprise at least one 3' end comprising a single nucleotide overhang.

[0240] The identifier oligonucleotide may also comprise a capture probe binding site. A capture probe binding site is a nucleic acid sequence to which a capture probe can bind.

[0241] The capture probe of the present disclosure may comprise a nucleic acid sequence complementary to the capture probe binding site. The capture probe may also comprise an affinity molecule.

[0242] The identifier oligonucleotide may also comprise a multiplex probe binding site. A multiplex probe binding site is a nucleic acid sequence to which a multiplex probe can bind.

[0243] The multiplexed probes of the present disclosure may comprise a nucleic acid sequence that is complementary to the multiplexed probe binding site.The multiplexed probes may also comprise a nucleic acid sequence that identifies a specific location of a tissue sample from which the identifier oligonucleotide is released.

[0244] The probe of the present disclosure may include a region allowing to release the identifier oligonucleotide after applying suitable force. In a non-limiting example, the region is a cleavable motif (e.g., a restriction enzyme site or a cleavable joint). The cleavable motif allows to release the identifier oligonucleotide from the target nucleic acid or protein of combination, and then the identifier oligonucleotide can be collected and detected. The region allowing to release the identifier oligonucleotide can be located between the target binding domain and the identifier oligonucleotide, thereby allowing to release the identifier oligonucleotide from the target binding domain. When the identifier oligonucleotide can be separated from the remainder of the probe (i.e., cutting and releasing), the identifier oligonucleotide is considered to be releasable. The example of the cleavable motif includes but is not limited to a photo-cleavable joint. The photo-cleavable joint can be cut by the light provided by a suitable coherent light source (e.g., laser and ultraviolet light source) or a suitable incoherent light source (e.g., arc lamp and light emitting diode (LED)).

[0245] In some aspects, the identifier oligonucleotide is collected from a solution adjacent to a point or at least one cell (e.g., at least immediately above or around) that releases the identifier oligonucleotide. Adjacent solution can be collected by, for example, sucking out via a pipette, capillary, microarray pin, a flow cell comprising a hole or another suitable aspiration system known in the art or any combination thereof. The capillary can include an optical device that can transmit light force such as ultraviolet light to at least one cell. A pipette or microarray pin can be attached to an array comprising many pipettes or microarray pins. Adjacent solution can include anionic polymers, for example, dextran sulfate and / or salmon sperm DNA, and / or the signal oligonucleotide collected can be added to a solution comprising anionic polymers such as dextran sulfate and / or salmon sperm DNA. In addition to salmon sperm DNA or instead of salmon sperm DNA, other non-specific blocking agents known in the art can be used.

[0246] In some aspects, the identifier oligonucleotide is collected from tissue, at least one cell, or a point adjacent to the release identifier oligonucleotide via a liquid laminar flow, turbulent flow, or transitional flow. The flow can be via a channel having a depth of 25 to 500 m between a tissue and a fluid device or an impermeable barrier placed on the tissue.

[0247] In the aspect that the target binding domain of the probe is an antibody, a cysteine ​​bioconjugation method can be used to prepare the probe, which is preferably stable and site-specific to the hinge region heavy chain of the antibody. The preparation method provides a relatively controllable identifier oligonucleotide and antibody stoichiometry. The probe can contain many (i.e., more than one, such as 2, 3, 4, 5 or more) identifier oligonucleotides per antibody. Generally, the "heavier" probe containing 3 or 4 identifier oligonucleotides per antibody is significantly less sensitive than the antibody lacking the identifier oligonucleotide or the "lighter" probe containing 1 or 2 identifier oligonucleotides per antibody.

[0248] In various aspects, the probe is provided to the sample at a concentration that is generally lower than that used for immunohistochemistry (IHC) or for in situ hybridization (ISH). On the other hand, the concentration may be significantly lower than that used for IHC or ISH. For example, the probe concentration may be 1 / 2, 1 / 5, 1 / 10, 1 / 20, 1 / 25, 1 / 30, 1 / 50, 1 / 60, 1 / 70, 1 / 80, 1 / 90, 1 / 100, 1 / 200, 1 / 300, 1 / 400, 1 / 500, 1 / 600, 1 / 700, 1 / 800, 1 / 900, 1 / 1000, 1 / 2000 or lower and any number therebetween. In various aspects, the probes are provided at a concentration of 100 nM, 70 nM, 60 nM, 50 nM, 40 nM, 30 nM, 20 nM, 10 nM, 9 nM, 8 nM, 7 nM, 6 nM, 5 nM, 4 nM, 3 nM, 2 nM, 1 nM, 0.9 nM, 0.8 nM, 0.7 nM, 0.6 nM, 0.5 nM, 0.4 nM, 0.3 nM, 0.2 nM, 0.1 nM, 0.09 nM, 0.08 nM, 0.07 nM, 0.06 nM, 0.05 nM, 0.04 nM, 0.03 nM, 0.02 nM, 0.01 nM and lower, and any concentration in between.

[0249] By carrying out negative purification of complete probe molecules, background noise in the protein detection process can be reduced. This can be accomplished by affinity purification of antibodies or photocleavable joints after collecting the eluate from the region of interest. Typically, the released signal oligonucleotide will not be pulled out of the solution. Protein-G or -O mechanisms in pipette tops, tubes or flat plates can be used for the steps. Such equipment and reagents are commercially available.

[0250] By performing negative purification of the complete probe molecule, background noise during nucleic acid detection can be reduced. This can be accomplished by affinity purification of the target binding domain or photocleavable linker after collecting the eluate from the region of interest. Typically, the released signaling oligonucleotide will not be pulled out of the solution. To aid in negative purification, a universal purification sequence can be included in the probe, such as in the target binding domain.

[0251] Protein targeting probes and nucleic acid targeting probes can be used simultaneously as long as conditions allow binding of both protein targets and nucleic acid targets. On the other hand, when conditions that allow binding of both protein targets and nucleic acid targets are not possible, protein targeting probes and nucleic acid targeting probes can be used sequentially.

[0252] A group of probes is synonymous with the composition of probes. A group of probes includes at least one type of probe, i.e., for a target. A group of probes preferably includes at least two, e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 1920, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more types of probes. The probe group can include one or more copies of the probe of each type.

[0253] Only the first set of probes can be applied to the sample. On the other hand, the second set (or higher number) of probes can be applied to the sample later. The first set and the second (or higher number) can target only nucleic acids, only proteins or a combination thereof.

[0254] In the present disclosure, two or more targets (i.e., proteins, nucleic acids, or a combination thereof) are detected; 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 1920, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more targets are detected, and any number in between.

[0255] A set of probes can be predetermined based on the cell type or tissue type to be targeted. For example, if the tissue is breast cancer, the probe set will include probes for proteins associated with breast cancer cells (e.g., Her2, EGFR, and PR) and / or probes for proteins associated with normal breast tissue. In addition, the probe set can be predetermined based on the developmental state of the cell or tissue to be targeted. On the other hand, the probe set can be predetermined based on the subcellular localization of interest (e.g., nucleus, cytoplasm, and membrane). For example, antibodies to Foxp3, histone H3, or P-S6 mark the nucleus, antibodies to CD3, CD4, PD-1, or CD45RO mark the cytoplasm, and antibodies to PD-L1 mark the membrane.

[0256] Probes may be chemically synthesized or may be produced biologically using a vector into which a nucleic acid encoding the probe has been cloned.

[0257] Any probe or probe set described herein can be used in the methods and kits of the present disclosure.

[0258] For the probes described herein, the association of a unique nucleic acid sequence with a specific target nucleic acid or target protein is not fixed.

[0259] As described above, the probes of the present disclosure can be used to detect target nucleic acids or target proteins present in any sample, such as biological samples. As will be appreciated by those skilled in the art, samples can include many things, including, but not limited to: cells (including both primary cells and cultured cell lines) and tissues (including cultured or explanted). In various aspects, tissue samples (fixed or unfixed) are embedded, serially sliced ​​and fixed on microscope slides. As is well known, a pair of serial sections will include at least one cell present in both serial sections. The structure and cell type located on the first serial section will have similar positions on adjacent serial sections. The sample can be a cultured cell or a dissociated cell (fixed or unfixed) fixed on a slide. The sample can be a formalin-fixed paraffin-embedded (FFPE) tissue sample.

[0260] In various aspects, the tissue sample is a biopsied tumor or a portion thereof, i.e., a clinically relevant tissue sample. For example, the tumor may be from a breast cancer. The sample may be a resected lymph node.

[0261] The sample can be obtained from virtually any organism, including multicellular organisms, for example, plants, fungi, and organisms of the animal kingdom; preferably, the sample is obtained from an animal, for example, a mammal. Human samples are particularly preferred.

[0262] In some aspects, the probes, compositions, methods and kits described herein are used for diagnosis of conditions. As used herein, the term diagnosis of a condition or diagnosis of a condition includes predicting or diagnosing a condition, determining susceptibility to a condition, monitoring treatment of a condition, diagnosing a therapeutic response to a disease, and a prognosis of a condition, a condition, a condition progression, and a response to a particular treatment of a condition. For example, a tissue sample may be assayed according to any probe, method or kit described herein to determine the presence and / or amount (relative to a non-disease condition) of a marker of a disease or malignant cell type in the sample to diagnose or stage a disease or cancer.

[0263] Typically, samples attached to a slide can first be imaged using fluorescence (e.g., fluorescent antibodies or fluorescent stains such as DAPI) to identify morphology, regions of interest, cell types of interest, and individual cells, and then protein and / or nucleic acid expression can be digitally counted from the sample on the same slide.

[0264] The compositions and kits of the present disclosure may include probes and other reagents, such as buffers and other reagents known in the art, to facilitate the binding of proteins and / or nucleic acids in a sample, ie, for performing a hybridization reaction.

[0265] The kit will also include instructions for using the kit components, including, but not limited to, information necessary to hybridize the labeled oligonucleotide to the probe, hybridize the probe to the target-specific oligonucleotide, hybridize the target-specific oligonucleotide to the target nucleic acid, and / or hybridize the probe to the target protein.

[0266] The region of interest may be a tissue type, a cell type, a cell, or a subcellular structure within a cell present in the sample.

[0267] The methods of the present disclosure can be used together to compare the properties and abundance of target proteins and / or target nucleic acids present in a first region of interest (e.g., tissue types, cell types (including normal and abnormal cells), and subcellular structures within cells) with the properties and abundance of the target proteins and / or target nucleic acids present in a second region of interest or more regions of interest.

[0268] As previously described, the product produced by the method of the present disclosure can be used for nucleic acid amplification. In a preferred aspect, nucleic acid amplification can be solid phase nucleic acid amplification. Therefore, in a further aspect, the present invention provides a method for solid phase nucleic acid amplification of a template polynucleotide molecule, comprising: using the method of the present disclosure to prepare a library of template polynucleotide molecules having a common sequence at its 5' and 3' ends, and performing a solid phase nucleic acid amplification reaction, wherein the template polynucleotide molecules are amplified. Compositions and methods for nucleic acid amplification and sequencing have been described in, for example, US9376678, which is incorporated herein by reference in its entirety.

[0269] As used herein, the term "solid phase amplification" refers to any nucleic acid amplification reaction performed on or in conjunction with a solid support, such that all or part of the amplified product is immobilized on the solid support as it is formed. In particular, the term includes solid phase polymerase chain reaction (solid phase PCR), which is a reaction similar to standard liquid phase PCR, except that one or both of the forward and reverse amplification primers are immobilized on a solid support.

[0270] Although the present invention includes "solid phase" amplification methods, in which only one amplification primer is immobilized (the other primer is usually present in free solution), it is preferred to provide a solid support to which both the forward and reverse primers are immobilized. In practice, because the PCR process requires an excess of primers to maintain amplification, there will be "many" identical forward primers and / or "many" identical reverse primers immobilized on the solid support. Unless the context indicates otherwise, references to forward and reverse primers herein are therefore to be interpreted as including "many" such primers.

[0271] As the skilled reader will appreciate, any given PCR reaction requires at least one type of forward primer and at least one type of reverse primer specific to the template to be amplified. However, in some aspects, forward and reverse primers can comprise template-specific portions of the same sequence, and can have identical nucleotide sequences and structures (including any non-nucleotide modifications). In other words, solid phase amplification may be performed using only one type of primer, and this single primer method is included within the scope of the present invention. Other aspects may use forward and reverse primers that contain identical template-specific sequences, but are different in some other structural features. For example, a type of primer may contain non-nucleotide modifications that do not exist in another.

[0272] In other aspects of the invention, the forward and reverse primers may contain template-specific portions of different sequences.

[0273] The amplification primers for solid phase PCR are preferably fixed by covalently attaching to a solid support at or near the 5' end of the primer, so that the template-specific portion of the primer is free for annealing with its associated template and the 3' hydroxyl is free for primer extension. For this purpose, any suitable covalent attachment method known in the art can be used. The attachment chemistry selected will depend on the characteristics of the solid support and any derivatization or functionalization applied thereto. The primer itself can contain a part that can be a non-nucleotide chemical modification to promote attachment. In a particularly preferred aspect, the primer can contain a sulfur-containing nucleophilic substance at the 5' end, such as a thiophosphate or a thiophosphoric acid. In the case of a solid-supported polyacrylamide hydrogel (as described below), the nucleophilic substance will be combined with the "C" group present in the hydrogel. The most preferred method for attaching the primer and template to a solid support is to attach to a hydrogel containing polymerized acrylamide and N-(5-bromoacetamidopentyl) acrylamide (BRAPA) via a 5' thiophosphate.

[0274] The terms "cluster" and "colony" are used interchangeably herein to refer to discrete spots on a solid support that contain a plurality of identical immobilized nucleic acid strands and a plurality of identical immobilized complementary nucleic acid strands. The term "clustered array" refers to an array formed by such clusters or colonies. In the context described, the term "array" should not be understood as requiring an ordered arrangement of clusters.

[0275] The present invention also includes methods for sequencing amplified nucleic acids produced by solid phase amplification. Thus, the present invention provides methods for nucleic acid sequencing, comprising amplifying a library of nucleic acid templates by the methods of the present disclosure described above, using solid phase amplification as described above to amplify the library on a solid support, and performing a nucleic acid sequencing reaction to determine the sequence of all or a portion of at least one amplified nucleic acid strand produced in the solid phase amplification reaction.

[0276] As referred to herein, sequencing can be performed using any suitable "sequencing-by-synthesis" technique, in which nucleotides are added successively to the free 3' hydroxyl group, thereby resulting in the synthesis of a polynucleotide chain in a 5' to 3' direction. Preferably, the identity of the added nucleotide is determined after each nucleotide addition.

[0277] The starting point for the sequencing reaction can be provided by annealing a sequencing primer to the product of a whole genome or solid phase amplification reaction. In this regard, one or two adapters added during the formation of the template library can comprise a nucleotide sequence that allows the sequencing primer to anneal to the amplification product obtained by whole genome or solid phase amplification of the template library.

[0278] The product of a solid phase amplification reaction in which both forward and reverse amplification primers are covalently immobilized on a solid surface is a so-called "bridged" structure formed by annealing of an immobilized polynucleotide strand and an immobilized complementary strand pair, with both strands attached to the solid support at their 5' ends. Arrays containing such bridged structures provide inefficient templates for nucleic acid sequencing because hybridization of a conventional sequencing primer to one of the immobilized strands is unfavorable compared to annealing of the strand to its immobilized complementary strand under standard hybridization conditions.

[0279] In order to provide a more suitable template for nucleic acid sequencing, it is preferred to remove substantially all or at least a portion of one of the fixed strands in the "bridging" structure to produce a template that is at least partially single-stranded. Portions of the single-stranded template will therefore be available for hybridization with a sequencing primer. The process of removing all or a portion of one of the fixed strands in the "bridging" double-stranded nucleic acid structure may be referred to herein as "linearization."

[0280] The bridged template structure can be linearized by cleaving one or both strands with a restriction endonuclease or by cleaving one strand with a nicking endonuclease. Other methods of cleavage can be used as an alternative to restriction enzymes or nicking enzymes, including chemical cleavage (e.g., cleavage of diol bonds with periodate), cleavage of abasic sites by cleavage with an endonuclease or by exposure to heat or base, cleavage of ribonucleotides incorporated into an amplification product that otherwise contains deoxyribonucleotides, photochemical cleavage, or cleavage of a peptide linker, among others.

[0281] It will be appreciated that if the solid phase amplification reaction is performed with only one covalently immobilized primer and the other in free solution, a linearization step may not be necessary.

[0282] In order to generate a linearized template suitable for sequencing, the "unequal" amount of complementary strands in the bridge structure formed by amplification must be removed so as to leave a completely or partially single-stranded linearized template for sequencing. Most preferably, one strand of the bridge structure is substantially or completely removed.

[0283] After the cleavage step, regardless of the method used for cleavage, the product of the cleavage reaction can be subjected to denaturing conditions to remove one or more portions of the cleaved strand(s) not attached to the solid support. Suitable denaturing conditions will be apparent to the skilled reader with reference to standard molecular biology protocols.

[0284] Denaturation (and subsequent reannealing of the cleaved strands) results in the generation of a partially or substantially single-stranded sequencing template. A sequencing reaction can then be initiated by hybridizing a sequencing primer to the single-stranded portion of the template.

[0285] Thus, a nucleic acid sequencing reaction can include hybridizing a sequencing primer to a single-stranded region of a linearized amplification product, sequentially incorporating one or more nucleotides into a polynucleotide chain complementary to the amplified template chain region to be sequenced, identifying the bases present in the one or more incorporated nucleotides and thereby determining the sequence of the template chain region.

[0286] A preferred sequencing method that can be used according to the present invention relies on the use of modified nucleotides that can act as chain terminators. Once the modified nucleotides have been incorporated into the growing polynucleotide chain complementary to the template region being sequenced, there is no free 3'-OH group available to guide further sequence extension, and therefore the polymerase cannot add further nucleotides. Once the characteristics of the base incorporated into the growing chain have been determined, the 3' blockage can be removed to allow the addition of the next consecutive nucleotide. By arranging the products derived from these modified nucleotides, it is possible to deduce the DNA sequence of the DNA template. If each modified nucleotide is attached with different tags known to correspond to specific bases to facilitate distinguishing the bases added in each incorporation step, this reaction can be completed in a single experiment. On the other hand, separate reactions containing each modified nucleotide can be performed separately.

[0287] The modified nucleotides may carry a label to facilitate their detection. Preferably, this is a fluorescent label. Each nucleotide type may carry a different fluorescent label. However, the detectable label need not be a fluorescent label. Any label that allows detection of the incorporated nucleotide may be used.

[0288] One method for detecting fluorescently labeled nucleotides includes using a laser of a wavelength specific to the labeled nucleotide, or using other suitable illumination sources. Fluorescence from the label on the nucleotide can be detected by a CCD camera or other suitable detection means.

[0289] The present invention is not intended to be limited to the use of the sequencing methods outlined above, since essentially any sequencing method that relies on the sequential incorporation of nucleotides into a polynucleotide chain may be used. Suitable alternative techniques include, for example, pyrosequencing, FISSEQ (fluorescence in situ sequencing), MPSS (massively parallel signature sequencing) and methods based on sequencing by ligation.

[0290] In the methods of the present disclosure, the unique nucleic acid sequence present in the identifier oligonucleotide of the probe that identifies the target analyte that binds to the target binding domain of the probe can include about 5 nucleotides to about 50 nucleotides. Preferably, the sequence includes about 20 nucleotides to about 40 nucleotides. Even more preferably, the sequence includes about 35 nucleotides. In some preferred aspects, the sequence includes 10 nucleotides.

[0291] In the methods of the present disclosure, the nucleic acid sequence identifying the specific location of the tissue sample from which the identifier oligonucleotide is released comprises about 6 nucleotides to about 15 nucleotides. Preferably, the sequence comprises about 12 nucleotides.

[0292] In the methods of the present disclosure, the amplification primer binding site comprises about 18 nucleotides to about 40 nucleotides. Preferably, the amplification primer binding site comprises about 32 nucleotides.

[0293] In some aspects of the methods of the present disclosure, the amplification primer binding site may comprise an i7 sequence, wherein the i7 sequence comprises the sequence set forth in SEQ ID NO:1.

[0294] In some aspects of the methods of the present disclosure, the amplification primer binding site may comprise an i5 sequence, wherein the i5 sequence comprises the sequence set forth in SEQ ID NO:2.

[0295] In some aspects of the methods of the present disclosure, the amplification primer may comprise a flow cell adapter sequence, wherein the flow cell adapter sequence is suitable for sequencing. Preferably, at least one amplification primer used in the methods of the present disclosure comprises a P5 flow cell adapter sequence, wherein the P5 flow cell adapter sequence comprises the sequence set forth in SEQ ID NO: 3. Still preferably, at least one amplification primer used in the methods of the present disclosure comprises a P7 flow cell adapter sequence, wherein the P7 flow cell adapter sequence comprises the sequence set forth in SEQ ID NO: 4.

[0296] In the methods of the present disclosure, the unique molecular identifier may comprise about 6 nucleotides to about 30 nucleotides. Preferably, the unique molecular identifier may comprise about 15 nucleotides. The terms unique molecular identifier and random molecular tag are used interchangeably herein. Using methods known in the art, the unique molecular identifier is a random sequence that can be used to correct for deviations in amplification prior to sequencing.

[0297] In the methods of the present disclosure, the constant nucleic acid sequence that minimizes ligation bias comprises about 1 nucleotide to about 15 nucleotides. Preferably, the constant sequence comprises about 8 nucleotides.

[0298] In some aspects, the flow cell binding site may comprise about 15 to about 40 nucleotides. The flow cell binding site may comprise about 29 nucleotides. The flow cell binding site may comprise about 24 nucleotides.

[0299] In some aspects, the target binding domain may comprise about 10 to about 70 nucleotides. The target binding domain may comprise about 30 to about 55 nucleotides. The target binding domain may comprise about 35 to about 50 nucleotides.

[0300] In some aspects, the unique nucleic acid sequence identifying the target analyte bound to the target binding domain may comprise about 20 to about 40. The unique nucleic acid sequence identifying the target analyte bound to the target binding domain may comprise about 25 nucleotides, or about 35 nucleotides, or about 12 nucleotides.

[0301] In some aspects, the amplification primer binding site can comprise about 20 to about 50 nucleotides. The amplification primer binding site can comprise about 33 nucleotides or about 34 nucleotides.

[0302] In some aspects, the nucleic acid sequence identifying the specific location of the tissue sample from which the identifier oligonucleotide is released can contain about 1 to about 20 nucleotides. The nucleic acid sequence identifying the specific location of the tissue sample from which the identifier oligonucleotide is released can contain about 8 nucleotides.

[0303] In some aspects, the nucleic acid sequence comprising the unique molecular identifier may comprise about 5 to about 20 nucleotides. The nucleic acid sequence comprising the unique molecular identifier may comprise about 14 nucleotides.

[0304] As used herein, the terms "region of interest" and "ROI" are used in their broadest sense to refer to a specific location in a sample that is analyzed using the methods of the present disclosure.

[0305] As used herein, the term "adjacent" may mean within about 1 nucleotide, or within about 2 nucleotides, or within about 3 nucleotides, or within about 4 nucleotides, or within about 5 nucleotides, or within about 6 nucleotides, or within about 7 nucleotides, or within about 8 nucleotides, or within about 9 nucleotides, or within about 10 nucleotides, or within about 11 nucleotides, or within about 12 nucleotides, or within about 13 nucleotides, or within about 14 nucleotides, or within about 15 nucleotides, or within about 16 nucleotides, or within about 17 nucleotides, or within about 18 nucleotides, or within about 19 nucleotides. nucleotides, or within about 20 nucleotides, or within about 21 nucleotides, or within about 22 nucleotides, or within about 23 nucleotides, or within about 24 nucleotides, or within about 25 nucleotides, or within about 26 nucleotides, or within about 27 nucleotides, or within about 28 nucleotides, or within about 29 nucleotides, or within about 30 nucleotides, or within about 40 nucleotides, or within about 50 nucleotides, or within about 60 nucleotides, or within about 70 nucleotides, or within about 80 nucleotides, or within about 90 nucleotides, or within about 100 nucleotides.

[0306] As used herein, the term "spatial detection" is used in its broadest sense to refer to identifying the presence of a specific target analyte within a specific region of interest in a sample. Spatial detection can include quantifying the amount of a specific target analyte present within a specific region of interest in a sample. Spatial detection can further include quantifying the relative amount of a first target analyte within a region of specific interest in a sample compared to the amount of at least a second target analyte within a region of specific interest in the sample. Spatial detection can also include quantifying the relative amount of a specific target analyte within a first region of interest in a sample compared to the amount of the same target analyte in at least a second region of interest in the same sample or a different sample.

[0307] In some aspects of the methods and compositions of the present disclosure, the target analyte can be any molecule in the sample that will be spatially detected. Target analytes include, but are not limited to, nucleic acid molecules and protein molecules. When the target analyte is a protein, the protein can be referred to as a target protein. When the target analyte is a nucleic acid, the nucleic acid can be referred to as a target nucleic acid. Target nucleic acids can include, but are not limited to, mRNA molecules, microRNA (miRNA) molecules, tRNA molecules, rRNA molecules, gDNA, or any other nucleic acid present in the sample.

[0308] In some aspects of the methods and compositions of the present disclosure, the term target binding domain is used in its broadest sense to refer to a portion of a probe of the present disclosure that binds directly or indirectly to a target analyte located in a sample. The target binding domain may comprise a nucleic acid, a protein, at least one antibody, an aptamer, or any combination thereof. The target binding domain may comprise DNA, RNA, or any combination thereof. The target binding domain may comprise any number of modified nucleotides and / or nucleic acid analogs.

[0309] In aspects where the target analyte to be spatially detected is a target protein, the target binding domain may be a protein-target binding domain. The protein-target binding domain may comprise an antibody or antibody fragment that binds to the target protein.

[0310] In the aspect that the target analyte to be spatially detected is a target nucleic acid, the target binding domain can be a target nucleic acid binding region. The target nucleic acid binding region can include a nucleic acid complementary to the target nucleic acid to be spatially detected. The target nucleic acid binding region can include a nucleic acid that hybridizes with the target nucleic acid to be detected.

[0311] As used herein, the term "hybridization" is used in its broadest sense to refer to the formation of stable nucleic acid duplexes. In one aspect, "stable duplexes" means a duplex structure that is not destroyed by strict washing under conditions such as, for example, about 5 ° C or more than about 5 ° C of temperature and low monovalent salt concentration, such as less than 0.2M or less than 0.1M or salt concentrations known to those skilled in the art, below the Tm of the duplex chain. The duplex can be "completely paired", so that the polynucleotides and / or oligonucleotide chains forming the duplex form a double-stranded structure with each other, so that each nucleotide in each chain is subjected to Watson-Crick base pairing with the nucleotides in the other chain. The term "duplex" includes but is not limited to nucleoside analogs that can be used, such as deoxyinosine, nucleosides with 2-aminopurine, PNAs, etc. The duplex can include at least one mismatch, wherein the term "mismatch" means that a pair of nucleotides in the duplex cannot undergo Watson-Crick bonding.

[0312] As used herein, the term "hybridization conditions" will generally include salt concentrations of less than about 1 M, more typically less than about 500 mM, and even more typically less than about 200 mM. The hybridization temperature can be as low as 5°C, but is typically greater than 22°C, more typically greater than about 30°C, and often greater than about 37°C. Hybridization is typically performed under stringent conditions, e.g., conditions under which the probe will specifically hybridize to its target analyte. Stringent conditions are sequence dependent and are different in different situations. Longer fragments may require higher hybridization temperatures for specific hybridization. Since other factors may affect the stringency of hybridization, including base composition and the length of complementary chains, the presence of organic solvents, and the degree of base mismatching, the combination of parameters is more important than the absolute measure of any one of them alone. Certain hybridization conditions will promote duplex formation between the full length of the target binding domain and the target analyte. Other hybridization conditions will promote the formation of duplexes only along certain portions of the target binding domain.

[0313] In some aspects of the methods and compositions of the present disclosure, the probe may include a target binding domain directly or indirectly connected to an identifier oligonucleotide. In the context of the probe, the identifier oligonucleotide is a polynucleotide comprising a nucleic acid sequence that identifies a target analyte bound to the target binding domain of the probe. That is, the identifier oligonucleotide comprises a specific nucleic acid sequence that is a priori assigned to a specific target analyte bound to the target to which the identifier oligonucleotide is attached. In a non-limiting example, a probe called "probe X" designed to spatially detect "target analyte X" comprises a target binding domain called "target binding domain X" connected to an identifier oligonucleotide called "identifier oligonucleotide X". The target binding domain X binds to the target analyte X, and the identifier oligonucleotide X comprises a nucleic acid sequence called "nucleic acid sequence X", which corresponds to the target analyte X. Therefore, if a technician practicing the method of the present disclosure collects the identifier oligonucleotides released from the region of interest in the sample and obtains the nucleic acid sequence X after sequencing, then those skilled in the art will understand that this indicates that the target analyte X is present in the region of interest. The amount of nucleic acid sequence X or the number of sequencing reads can be used to determine the quantification of the amount of target analyte X within the region of interest, either absolutely or relatively.

[0314] As used herein, the term "amplification primer binding site" is used in its broadest sense to refer to a nucleic acid sequence that is complementary or at least partially complementary to at least one amplification primer, wherein an amplification primer is a short single-stranded or partially single-stranded oligonucleotide that is sufficient to initiate DNA and / or RNA synthesis, for example, by PCR.

[0315] In some aspects of the methods and compositions of the present disclosure, the target binding domain can be connected to the identifier oligonucleotide via a cleavable linker. Suitable cleavable linkers include, but are not limited to, chemically cleavable linkers (e.g., linkers that are cleaved when exposed to a specific chemical substance, a combination of chemical substances, or reaction conditions), photocleavable linkers (e.g., linkers that are cleaved when exposed to light of sufficient wavelength or light containing a sufficient wavelength range), or enzymatically cleavable linkers (e.g., linkers that are cleaved by a specific enzyme or a class of enzymes). Therefore, as used herein, the phrase "providing a force sufficient to release the identifier oligonucleotide to the position of the sample" is used in its broadest sense to describe changes in conditions within a region of interest in the sample, so that for any probe bound to a target analyte within the region of interest, the linker between the target binding domain of the probe and the identifier oligonucleotide of the probe is cleaved, thereby separating the identifier oligonucleotide from the target binding domain so that the identifier oligonucleotide can then be collected from the solution. For example, in the aspect of a chemically cleavable joint between the target binding domain and the identifier oligonucleotide, providing a force sufficient to release the identifier oligonucleotide to the position of the sample may include exposing the position of the sample to a specific chemical substance, a combination of chemicals, or reaction conditions that catalyze the cleavage of the joint. In another non-limiting example, in the aspect of a photocleavable joint between the target binding domain and the identifier oligonucleotide, providing a force sufficient to release the identifier oligonucleotide to the position of the sample may include exposing / exciting the position of the sample with light having sufficient wavelengths capable of cleaving the photocleavable joint. In another non-limiting example, in the aspect of an enzymatically cleavable joint between the target binding domain and the identifier oligonucleotide, providing a force sufficient to release the identifier oligonucleotide to the position of the sample may include exposing the position of the sample to an enzyme sufficient to catalyze the cleavage of the joint.

[0316] Providing a force sufficient to release the identifier oligonucleotide to a location in the sample can result in at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 99% of the probes bound to the target analyte within said location in the sample undergoing cleavage of the linker connecting the target binding domain and the identifier oligonucleotide.

[0317] As will be understood by those skilled in the art, the term "unique molecular identifier" or "UMI" refers to a short nucleic acid sequence that is used to quantify and reduce quantitative bias caused by nucleic acid amplification prior to sequencing reactions.

[0318] In some aspects of the methods and compositions of the present disclosure, the affinity moiety can comprise biotin, avidin, streptavidin, a nucleic acid, or any combination thereof.

[0319] In some aspects of the methods and compositions of the present disclosure, the probe can comprise at least about 5, about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 nucleotides.

[0320] In some aspects of the methods and compositions of the present disclosure, the target binding domain can comprise at least at least about 5, about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 nucleotides.

[0321] In some aspects of the methods and compositions of the present disclosure, the identifier oligonucleotide can comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 nucleotides.

[0322] In some aspects of the methods and compositions of the present disclosure, the amplification primers can comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 nucleotides.

[0323] In some aspects of the methods and compositions of the present disclosure, the nucleic acid probe can comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 nucleotides.

[0324] In some aspects of the methods and compositions of the present disclosure, the nucleic acid that is complementary to a portion of an identifier oligonucleotide can comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, or at least about 100 nucleotides.

[0325] In some aspects of the methods and compositions of the present disclosure, the nucleic acid sequence comprising a molecular identifier may comprise at least about 5, or at least about 10 nucleotides, or at least about 15, or at least about 20, or at least about 25, or at least about 30, or at least about 35, or at least about 40, or at least about 45, or at least about 50 nucleotides.

[0326] In some aspects of the methods and compositions of the present disclosure, the amplification primer binding site can comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, or at least about 70 nucleotides.

[0327] In some aspects of the methods and compositions of the present disclosure, a flow cell adapter sequence suitable for sequencing may comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, or at least about 100 nucleotides.

[0328] In some aspects of the methods and compositions of the present disclosure, the flow cell binding site can comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 90, at least about 95, or at least about 100 nucleotides.

[0329] In some aspects of the methods and compositions of the present disclosure, the nucleic acid sequence that identifies a specific location of a tissue sample from which an identifier oligonucleotide is released can contain at least about 5, or at least about 10 nucleotides, or at least about 15, or at least about 20, or at least about 25, or at least about 30, or at least about 35, or at least about 40, or at least about 45, or at least about 50 nucleotides.

[0330] In some aspects of the methods and compositions of the present disclosure, a unique nucleic acid sequence that identifies a target analyte bound to a target binding domain can comprise at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 90, at least about 95, or at least about 100 nucleotides.

[0331] In some aspects of the methods and compositions of the present disclosure, the probe, target binding domain, identifier oligonucleotide, amplification primer, nucleic acid probe, a nucleic acid complementary to a portion of an identifier oligonucleotide, a nucleic acid sequence comprising a molecular identifier, an amplification primer binding site, a flow cell adapter sequence, a flow cell binding site, a nucleic acid sequence that identifies a specific location of a tissue sample from which the identifier oligonucleotide is released, a unique nucleic acid sequence that identifies a target analyte bound to the target binding domain, or any combination thereof may comprise at least one natural base, may not comprise a natural base, may comprise at least one modified nucleotide or nucleic acid analog, may not comprise a modified nucleotide or nucleic acid analog, may comprise at least one universal base, may not comprise a universal base, may comprise at least one degenerate base, or may not comprise a degenerate base.

[0332] In some aspects of the methods and compositions of the present disclosure, the probe, target binding domain, identifier oligonucleotide, amplification primer, nucleic acid probe, a nucleic acid complementary to a portion of an identifier oligonucleotide, a nucleic acid sequence comprising a molecular identifier, an amplification primer binding site, a flow cell adapter sequence, a flow cell binding site, a nucleic acid sequence that identifies a specific location of a tissue sample from which an identifier oligonucleotide is released, a unique nucleic acid sequence that identifies a target analyte bound to a target binding domain, or any combination thereof can comprise any combination of natural bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more natural bases), modified nucleotides or nucleic acid analogs (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified or analog nucleotides), universal bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more universal bases), or degenerate bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more degenerate bases). When present in combination, natural bases, modified nucleotides or nucleic acid analogs, universal bases and degenerate bases may be arranged in any order.

[0333] The term "modified nucleotide" or "nucleic acid analog" includes, but is not limited to, locked nucleic acids (LNA), bridged nucleic acids (BNA), propyne-modified nucleic acids, zip nucleic acids Preferably, the modified nucleotides or nucleic acid analogs are locked nucleic acids (LNAs).

[0334] The term "locked nucleic acid (LNA)" as used herein includes, but is not limited to, modified RNA nucleotides in which the ribose moiety comprises a methylene bridge connecting the 2' oxygen and the 4' carbon. The methylene bridge locks the ribose in the 3'-endo conformation (also known as the "North" conformation) found in A-type RNA duplexes. The term inaccessible RNA can be used interchangeably with LNA. The term "bridged nucleic acid (BNA)" as used herein includes, but is not limited to, modified RNA molecules comprising a five-membered or six-membered bridging structure with a fixed 3'-endo conformation (also known as the North conformation). The bridging structure connects the 2' oxygen of the ribose to the 4' carbon of the ribose. A variety of different bridge structures containing carbon, nitrogen and hydrogen atoms are possible. The term "propyne-modified nucleic acids" as used herein include, but are not limited to, pyrimidines containing propyne modifications at the C5 position of the nucleic acid base, i.e., cytosine and thymine / uracil. The term "zipper nucleic acid" as used herein " includes, but is not limited to, oligonucleotides conjugated to a cationic spermine moiety.

[0335] As used herein, the term "universal base" includes, but is not limited to, a nucleotide base that does not follow the Watson-Crick base pairing rules but can bind to any of the four canonical bases (A, T / U, C, G) located on the target nucleic acid. As used herein, the term "degenerate base" includes, but is not limited to, a nucleotide base that does not follow the Watson-Crick base pairing rules but can bind to at least two but not all four of the four canonical bases (A, T / U, C, G). Degenerate bases may also be referred to as wobble bases; these terms are used interchangeably herein.

[0336] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0337] Unless otherwise stated or obvious from the context, as used herein, the term "or" is understood to be inclusive and includes both "or" and "and."

[0338] Unless otherwise specified or apparent from the context, as used herein, the term "about" is understood to be within the normal tolerance range of the art, such as within 2 standard deviations of the mean. Approximately can be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05% or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values ​​provided herein are modified by the term "about".

[0339] Unless otherwise defined, all technical and scientific terms used in this article have the same meanings as those of ordinary skill in the art to which the invention belongs. Although other probes, compositions, methods and kits similar or equivalent to those described herein can be used in the practice of the present disclosure, preferred materials and methods are described herein. It is to be understood that the terms used herein are only for the purpose of describing specific aspects and are not intended to be restrictive. Example

[0340] Example 1 - Double-end adapter ligation method for 96 multiplex samples In the embodiment, the double-end adapter ligation method of the present disclosure is used to sequence the identifier oligonucleotides collected from 96 multiplex samples. The nucleic acid adapter used in the experiment is partially double-stranded. The nucleic acid adapter comprises a first strand and a second strand. The first strand comprises a 5' phosphate portion for ligation. The first strand also comprises a constant nucleic acid sequence (GCGTAGTG) that minimizes ligation bias, a nucleic acid sequence comprising a unique molecular identifier, a unique nucleic acid sequence that identifies a specific position of the sample from which the identifier oligonucleotide is released, and a first amplification primer binding site (SEQ ID NO: 2). The second strand comprises a single protruding thymine nucleotide at the 3' end, a sequence complementary to the constant nucleic acid sequence present in the first strand that minimizes ligation bias, a sequence complementary to the unique nucleic acid sequence present in the first strand that identifies a specific position of the sample from which the identifier oligonucleotide is released, and a second amplification primer binding site (SEQ ID NO: 1).

[0341] To form partially double-stranded nucleic acid adaptors, the first strand oligonucleotide and the second strand oligonucleotide were combined in equimolar ratios to a final total oligonucleotide concentration of 28 μM in a buffer containing 50 mM NaCl. The oligonucleotide mixture was heated at 95°C for 2 minutes and cooled at ambient temperature for 30 minutes to anneal the first strand and second strand oligonucleotides together to form partially double-stranded nucleic acid adaptors. The annealed nucleic acid adaptors were diluted to a final concentration of 0.02 μM to 0.002 μM in a solution of 10 mM Tris pH 8 and 0.05% Tween 20.

[0342] The collected identifier oligonucleotides were end-repaired and A-tailed using a modified protocol using the NEBNext Ultra II DNA library preparation kit for Illumina (New England Biolabs). The end-repair / A-tailing master mix was prepared by combining the following: 627.8 μL PCR-grade H2O, 143.9 μL NEBNext Ultra II End Prep reaction buffer, and 61.7 μL NEBNext Ultra II End Prep enzyme mixture. 8.3 μL of the end-repair / A-tailing master mix was added to 4 μL of each identifier oligonucleotide sample. The reaction was incubated at 20°C for 30 minutes with a heated lid of >75°C, followed by a second incubation at 65°C for 30 minutes. The repaired / A-tailed identifier oligonucleotide mixture was then stored at 4°C.

[0343] After end repair and A-tailing, nucleic acid adapters were ligated to the repaired / A-tailed identifier oligonucleotides by adding 6.4 μL NEBNext Ultra II Ligation Master Mix, 0.2 μL NEBNext Ligation Enhancer, and 1 μL Nucleic Acid Adapter Dilution to each repaired / A-tailed identifier oligonucleotide mixture. These reactions were incubated at 20° C. for 15 minutes with the heated lid closed and then quenched with 1 μL 0.5M EDTA. All reactions were then combined into a single 15 mL conical tube to form a combined adapter-ligated sample.

[0344] The pooled adapter-ligated samples were purified using diluted Agencourt AMPure XP magnetic beads (Beckman Coulter Genomics Inc.) prepared by combining 350 μL of AMPure XP beads and 3.15 mL of AMPure XP buffer (2.5 M NaCl, 20% PEG8000). AMPure XP bead purification was performed with 3.5 mL of diluted AMPure XP beads and eluted in 200 μL of buffer containing 10 mM Tris pH 8 and 0.05% Tween 20. The AMPure XP bead purification was then repeated with 400 μL of AMPure XP beads and eluted in 20 μL of buffer containing 10 mM Tris pH 8 and 0.05% Tween 20 to obtain a purified adapter-ligated sample.

[0345] After AMPure XP purification, prepare the PCR reaction of the sample ligated with the purified adapter to amplify the identifier oligonucleotide ligated with the adapter. To 6 μL of the purified adapter-ligated sample, add 10 μL of NEBNext UltraIIQ5 master mix, 0.2 μL of 100 μM forward and reverse primers, and 3.6 μL of PCR-grade H2O. The forward primer contains a flow cell adapter sequence suitable for sequencing, a unique molecular identifier, and a nucleic acid sequence complementary to the first amplification primer binding site located on the first strand of the nucleic acid adapter. Table 1 provides the sequence of the forward primer used.

[0346] Table 1. Forward primers for double-end adapter ligation.

[0347] The reverse primer contains a flow cell adapter sequence suitable for sequencing, a unique molecular identifier, and a nucleic acid sequence complementary to the second amplification primer binding site located on the second strand of the nucleic acid adapter. Table 2 provides the sequence of the reverse primer used.

[0348] Table 2. Reverse primers for double-ended adapter ligation The optimal PCR cycle number is determined experimentally by repeating the PCR reaction three times. On the other hand, the optimal PCR cycle number can be determined using real-time / qPCR. The PCR program used includes the following steps: (1) 30 seconds at 98°C (2) 10 seconds at 98°C (3) 1 minute at 65°C (4) Repeat steps (2) and (3) 9 times (5) 5 minutes at 65°C The amplified product was purified using 18 μL AMPure XP beads and eluted with 20 μL buffer containing 10 mM Tris pH 8 and 0.05% Tween-20.

[0349] Amplified products were evaluated using a high sensitivity DNA chip (Agilent Genomics) on a 2100 bioanalyzer and a KAPA library quantification kit (Kapa Biosystems) for the Illumina platform. The amplified products were also diluted to 15 pM for sequencing on MiSeq (Illumina) using a custom spike-in primer containing the nucleotide sequence ACACTCTTTAAGACGACGTCGCTATGGCCTCTCC (SEQ ID NO: 25) according to the manufacturer's instructions (MiSeq kit v32×75 bp).

[0350] Example 2 - Single-end adapter ligation method for 96 multiplex samples In the embodiment, the single-end adapter ligation method of the present disclosure is used to sequence identifier oligonucleotides collected from 96 multiplex samples. The nucleic acid adapter used in the experiment is partially double-stranded. The nucleic acid adapter comprises a first strand and a second strand. The first strand comprises a 5' phosphate portion for ligation. The first strand also comprises a constant nucleic acid sequence (CACTACGC) that minimizes ligation bias, a nucleic acid sequence comprising a unique molecular identifier, a unique nucleic acid sequence that identifies a specific position of the sample from which the identifier oligonucleotide is released, and a first amplification primer binding site (SEQ ID NO: 1). The second strand comprises a single protruding thymine nucleotide at the 3' end, a sequence complementary to the constant nucleic acid sequence present in the first strand that minimizes ligation bias, and a sequence complementary to the unique nucleic acid sequence present in the first strand that identifies a specific position of the sample from which the identifier oligonucleotide is released.

[0351] To form partially double-stranded nucleic acid adaptors, the first strand oligonucleotide and the second strand oligonucleotide were combined in equimolar ratios to a final total oligonucleotide concentration of 28 μM in 50 mM NaCl. The oligonucleotide mixture was heated to 95°C for 2 minutes and cooled at ambient temperature for 30 minutes, thereby annealing the first strand and second strand oligonucleotides together to form partially double-stranded nucleic acid adaptors. The annealed nucleic acid adaptors were diluted to a final concentration of 0.02 μM to 0.002 μM in a solution of 10 mM Tris pH 8 and 0.05% Tween 20.

[0352] Nucleic acid adapters were ligated to the collected identifier oligonucleotides by adding 10 μL of 2X Quick Ligation Buffer (Enzymatics), 1 μL of T4 DNA Quick Ligase (Enzymatics), and 1 μL of annealed nucleic acid adapter dilution to each collected identifier oligonucleotide sample. The samples were incubated at 20° C. for 15 minutes with the heated lid closed and then quenched with 1 μL of 0.5M EDTA. All reactions were then combined into a single 15 mL conical tube to form a combined adapter-ligated sample.

[0353] The pooled adapter-ligated samples were purified using diluted Agencourt AMPure XP magnetic beads (Beckman Coulter Genomics Inc.) prepared by combining 350 μL of AMPure XP beads and 3.15 mL of AMPure XP buffer (2.5 M NaCl, 20% PEG8000). AMPure XP bead purification was performed with 3.5 mL of diluted AMPure XP beads and eluted in 200 μL of buffer containing 10 mM Tris pH 8 and 0.05% Tween 20. The AMPure XP bead purification was then repeated with 400 μL of AMPure XP beads and eluted in 20 μL of buffer containing 10 mM Tris pH 8 and 0.05% Tween 20 to obtain a purified adapter-ligated sample.

[0354] After AMPure XP purification, prepare the PCR reaction with the purified adapter-ligated sample to amplify the adapter-ligated identifier oligonucleotide. To 6 μL of the purified adapter-ligated sample, add 10 μL of NEBNext UltraIIQ5 Master Mix, 0.2 μL of 100 μM forward and reverse primers, and 3.6 μL of PCR-grade HO. 2 O. The forward primer comprises a flow cell adapter sequence suitable for sequencing, a unique molecular identifier, and a nucleic acid sequence complementary to the first amplification primer binding site located on the first strand of the nucleic acid adapter. Table 3 provides the sequence of the forward primer used.

[0355] Table 3. Forward primers for double-end adapter ligation.

[0356] The reverse primer comprises a flow cell adapter sequence suitable for sequencing, a unique molecular identifier, and a nucleic acid sequence complementary to the second amplification primer binding site located on the second strand of the nucleic acid adapter. Table 4 provides the sequences of the reverse primers used.

[0357] Table 4. Reverse primers for double-end adapter ligation.

[0358] The optimal PCR cycle number is determined experimentally by repeating the PCR reaction three times. On the other hand, the optimal PCR cycle number can be determined using real-time / qPCR. The PCR program used includes the following steps: (1) 30 seconds at 98°C (2) 10 seconds at 98°C (3) 1 minute at 65°C (4) Repeat steps (2) and (3) 9 times (5) 5 minutes at 65°C The amplified product was purified using 18 μL AMPure XP beads and eluted with 20 μL buffer containing 10 mM Tris pH 8 and 0.05% Tween-20.

[0359] Amplified products were evaluated using a high sensitivity DNA chip (Agilent Genomics) on a 2100 bioanalyzer and a KAPA library quantification kit (Kapa Biosystems) for the Illumina platform. The amplified products were also diluted to 15 pM for sequencing on MiSeq (Illumina) using a custom spike-in primer containing the nucleotide sequence ACACTCTTTAAGACGACGTCGCTATGGCCTCTCC (SEQ ID NO: 25) according to the manufacturer's instructions (MiSeq kit v32×75 bp).

[0360] Example 3 - Templated Primer Extension Method for 96 Multiplex Samples In the embodiment, the templated primer extension method of the present disclosure was used to sequence the identifier oligonucleotides collected from 96 multiplex samples. The single-stranded nucleic acid template used in the embodiment comprises a 3' biotin portion, a region complementary to the unique nucleic acid sequence present in the collected identifier oligonucleotides, a nucleic acid sequence comprising a unique molecular identifier, and a second amplification primer binding sequence (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, SEQ ID NO: 26). Table 5 provides the sequence of the single-stranded nucleic acid template used in the embodiment.

[0361] Table 5. Single-stranded nucleic acid templates for templated primer extension methods Single-stranded nucleic acid templates were ordered from Integrated DNA Technologies, Inc. and quantified using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). Each single-stranded nucleic acid template was normalized to a standard concentration and then combined to an equimolar concentration. The single-stranded nucleic acid template pool was diluted to 0.83 nM in a buffer containing 10 mM Tris pH 8 and 0.05% Tween 20.

[0362] The collected identifier oligonucleotides were hybridized to the single-stranded nucleic acid templates and the mixture was prepared by adding 10 μL of NEBNext Ultra IIQ5 master mix (New England Biolabs), 4 μL of diluted single-stranded nucleic acid template pool, and 4 μL of H 2 O was extended. The following PCR program was used to extend the identifier oligonucleotide: (1) 98°C for 30 seconds, 10× (2) 1 minute at 98°C, (3) 1 minute at 68°C (4) 1 minute at 72°C (5) Repeat steps (2)-(4) 10 times (6) 2 minutes at 72°C The extension products were stored at 4°C. Magnetic streptavidin beads (MyOne streptavidin C1 beads, Thermo Fisher Scientific) were washed in 1X binding and washing buffer (5mM Tris-HCl, 0.5mM EDTA, 1M NaCl), and 5 μL of streptavidin beads were added to each extension product sample. The extension product samples were incubated with beads on an orbital mixer for at least 15 minutes. After incubation, the samples were heated to 95°C for 3 minutes and transferred to a magnetic plate. The supernatant was extracted immediately after sufficient bead precipitation to produce a purified extension product sample.

[0363] The purified extension product samples were prepared by adding 12.5 μL of NEBNext Ultra IIQ5 master mix, 0.25 μL of 100 μM forward primer, 1 μL of 25 μM reverse primer, and 3.8 μL of PCR-grade HO to 7.5 μL of each purified extension product sample. 2 O to amplify the purified extension product sample. The forward primer comprises a flow cell adapter sequence suitable for sequencing, a unique molecular identifier, and a nucleic acid sequence complementary to the first amplification primer binding site located on the identifier oligonucleotide. Table 6 provides the sequence of the forward primer used in the described example.

[0364] Table 6. Forward primers for templated primer extension method.

[0365] The reverse primer contains a flow cell adapter sequence suitable for sequencing, a unique molecular identifier, and a nucleic acid sequence complementary to the second amplification primer binding site located on the single-stranded nucleic acid template. Table 7 provides the sequence of the reverse primer used.

[0366] Table 7. Reverse primers for templated primer extension method.

[0367] The PCR procedure used to amplify the purified extension products included the following steps: (1) 30 seconds at 98°C (2) 10 seconds at 98°C (3) 30 seconds at 65°C (4) 72°C for 30 seconds (5) Repeat steps (2)-(4) 18 times (6) 2 minutes at 72°C The amplified extension products were stored at 4° C. 4 μL of each PCR reaction was combined into four pools of 24 samples each.

[0368] The pooled PCR reactions were purified using diluted Agencourt AMPure XP magnetic beads (Beckman Coulter Genomics Inc.) prepared by combining 100 μL AMPure XP beads and 400 μL AMPure XP buffer (2.5 M NaCl, 20% PEG8000). Purification was performed using 76.8 μL of diluted AMPure XP beads and eluted in 20 μL of buffer containing 10 mM Tris pH 8 and 0.05% Tween 20. The beads were retained and the purification process was repeated with 24 μL AMPure XP buffer and eluted in 20 μL of buffer containing 10 mM Tris pH 8 and 0.05% Tween 20.

[0369] Purified PCR products were evaluated using a high sensitivity DNA chip (Agilent Genomics) on a 2100 bioanalyzer and a KAPA library quantification kit (Kapa Biosystems) for the Illumina platform. The purified PCR product was also diluted to 15 pM for sequencing on a MiSeq (Illumina) using a custom spike-in primer containing the nucleotide sequence ACACTCTTTAAGACGACGTCGCTATGGCCTCTCC (SEQ ID NO: 25) according to the manufacturer's instructions (MiSeq kit v32×75 bp).

[0370] Example 4: Long probe hybridization method for 96 multiplex samples In the embodiment, the long probe hybridization method of the present disclosure is used to sequence the identifier oligonucleotides collected from 96 multiplex samples. In the embodiment, the first nucleic acid probe comprises a 5' phosphate portion, a nucleic acid sequence complementary to a portion of the identifier oligonucleotide, a first amplification primer binding site comprising an i7 sequence (SEQ ID NO: 1), a unique nucleic acid sequence identifying a specific position of the sample from which the identifier oligonucleotide was released, and a P7 flow cell adapter sequence (SEQ ID NO: 4). The second nucleic acid probe comprises a nucleic acid sequence complementary to a portion of the identifier oligonucleotide, a nucleic acid sequence comprising a unique molecular identifier, a second amplification primer binding site comprising an i5 sequence (SEQ ID NO: 2), and a P5 flow cell adapter sequence (SEQ ID NO: 3).

[0371] The first and second nucleic acid probes were ordered from Integrated DNA Technologies, Inc. and quantified using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). Each nucleic acid probe was normalized to a standard concentration, combined to be equimolar, and diluted to 0.83 nM in a buffer containing 10 mM Tris pH 8 and 0.05% Tween 20. The nucleic acid probes and identifier oligonucleotides were hybridized by combining 0.5 μL of the diluted nucleic acid probe pool with 2 μL of the identifier oligonucleotide mixture collected from the sample solution in a buffer containing 50 mM NaCl. The mixture was heated at 95° C. for 2 minutes and cooled at ambient temperature for 30 minutes to produce an annealed identifier oligonucleotide-nucleic acid probe mixture.

[0372] A gap extension reaction was performed where the first and second nucleic acid probes were hybridized to the identifier oligonucleotide such that the first and second nucleic acid probes were not adjacent and did not overlap. To 2.5 μL of each annealed identifier oligonucleotide-nucleic acid probe mixture, 3.8 μL of NEBNext Ultra IIQ5 master mix and 1.3 μL of PCR-grade H 2 O. The mixture was then subjected to the following notched extension temperature cycle: (1) 30 seconds at 98°C (2) 1 minute at 98°C (3) 1 minute at 68°C (4) 1 minute at 72°C, (5) Repeat steps (2)-(4) 10 times (6) 2 minutes at 72°C The nick extension products were then stored at 4° C. The nick extension products were then ligated by adding 10 μL of 2X Rapid Ligation Buffer (Enzymatics), 1 μL of T4 DNA Rapid Ligase (Enzymatics), and 8 μL of PCR-grade HO to 1 μL of the nick extension products. 2 O, ligating the first and second nucleic acid probes together. These ligation reactions were incubated at 20°C for 15 minutes, then quenched with 1 μL 0.5 M EDTA and combined into a single 15 mL conical tube.

[0373] In the case where the first and second nucleic acid probes are hybridized to the identifier oligonucleotide so that the first and second nucleic acid probes are adjacent and non-overlapping, a nick repair ligation reaction is performed. To 2.5 μL of each annealed identifier oligonucleotide-nucleic acid probe mixture, 10 μL of 2X Rapid Ligation Buffer (Enzymatics), 1 μL of T4 DNA Rapid Ligase (Enzymatics), and 1 μL of PCR-grade H2 O. The ligation reactions were incubated at 20°C for 15 minutes, then quenched with 1 μL of 0.5 M EDTA and combined into a single 15 mL conical tube.

[0374] The pool of quenched ligation reactions was then purified using diluted Agencourt AMPure XP magnetic beads (Beckman Coulter Genomics Inc.) prepared by combining 350 μL of AMPure XP beads and 3.15 mL of AMPure XP buffer (2.5 M NaCl, 20% PEG8000). The purification was performed with 3.5 mL of diluted AMPure XP beads and eluted in 200 μL of buffer containing 10 mM Tris pH 8 and 0.05% Tween 20. The AMPure XP bead purification was then repeated with 400 μL of AMPure XP beads and eluted in 20 μL of buffer containing 10 mM Tris pH 8 and 0.05% Tween 20.

[0375] To amplify the purified ligation product, a PCR reaction with the purified ligation product and primers was prepared. To 6 μL of the purified ligation product, 10 μL of NEBNext Ultra IIQ5 master mix, 0.2 μL of 100 μM forward primer (CAAGCAGAAGACGGCATACGA, SEQ ID NO: 153) and reverse primer (AATGATACGGCGACCACCGA, SEQ ID NO: 154) and 3.6 μL of PCR-grade H 2 O. The PCR procedure used to amplify the purified extension product includes the following steps: (1) 30 seconds at 98°C (2) 10 seconds at 98°C (3) 30 seconds at 65°C (4) 72°C for 30 seconds (5) Repeat steps (2)-(4) 18 times (6) 2 minutes at 72°C Amplified products were stored at 4°C. 4 μL of each PCR reaction was combined into six pools of 16 samples each. Amplified products were further purified using AMPure XP beads with 64 μL AMPure XP beads and eluted with 20 μL buffer containing 10 mM Tris pH 8 and 0.05% Tween 20.

[0376] The purified amplified products were evaluated using a high sensitivity DNA chip (Agilent Genomics) on a 2100 bioanalyzer and a KAPA library quantification kit (Kapa Biosystems) for the Illumina platform. The purified amplified products were also diluted to 15 pM for sequencing on a MiSeq (Illumina) using standard sequencing primers or custom spiked Read1 primers (SEQ ID NO: 25) according to the manufacturer's instructions (MiSeq kit v32×75 bp).

[0377] Example 5 - Short Probe Hybridization Method for 96 Multiplex Samples In the embodiment, the short probe hybridization method of the present disclosure is used to sequence the identifier oligonucleotides collected from 96 multiplex samples. In the embodiment, the first nucleic acid probe comprises a 5' phosphate portion, a nucleic acid sequence complementary to a portion of the identifier oligonucleotide, a first amplification primer binding site comprising an i7 sequence (SEQ ID NO: 1), and a unique nucleic acid sequence that identifies a specific position of the sample from which the identifier oligonucleotide is released. The second nucleic acid probe comprises a nucleic acid sequence complementary to a portion of the identifier oligonucleotide, a nucleic acid sequence comprising a unique molecular identifier, and a second amplification primer binding site comprising an i5 sequence (SEQ ID NO: 2).

[0378] The first and second nucleic acid probes were ordered from Integrated DNA Technologies, Inc. and quantified using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). Each nucleic acid probe was normalized to a standard concentration, combined to be equimolar, and diluted to 0.83 nM in a buffer containing 10 mM Tris pH 8 and 0.05% Tween 20. The nucleic acid probes and identifier oligonucleotides were hybridized by combining 0.5 μL of the diluted nucleic acid probe pool with 2 μL of the identifier oligonucleotide mixture collected from the sample solution in a buffer containing 50 mM NaCl. The mixture was heated at 95° C. for 2 minutes and cooled at ambient temperature for 30 minutes to produce an annealed identifier oligonucleotide-nucleic acid probe mixture.

[0379] A gap extension reaction was performed where the first and second nucleic acid probes were hybridized to the identifier oligonucleotide such that the first and second nucleic acid probes were not adjacent and did not overlap. To 2.5 μL of each annealed identifier oligonucleotide-nucleic acid probe mixture, 3.8 μL of NEBNext Ultra IIQ5 master mix and 1.3 μL of PCR-grade H 2 O. The mixture was then subjected to the following notched extension temperature cycle: (1) 30 seconds at 98°C (2) 1 minute at 98°C (3) 1 minute at 68°C (4) 1 minute at 72°C, (5) Repeat steps (2)-(4) 10 times (6) 2 minutes at 72°C The nick extension products were then stored at 4° C. The nick extension products were then ligated by adding 10 μL of 2X Rapid Ligation Buffer (Enzymatics), 1 μL of T4 DNA Rapid Ligase (Enzymatics), and 8 μL of PCR-grade HO to 1 μL of the nick extension products. 2 O, ligating the first and second nucleic acid probes together. These ligation reactions were incubated at 20°C for 15 minutes, quenched with 1 μL 0.5M EDTA, and combined into a single 15 mL conical tube.

[0380] In the case where the first and second nucleic acid probes are hybridized to the identifier oligonucleotide so that the first and second nucleic acid probes are adjacent and non-overlapping, a nick repair ligation reaction is performed. To 2.5 μL of each annealed identifier oligonucleotide-nucleic acid probe mixture, 10 μL of 2X Rapid Ligation Buffer (Enzymatics), 1 μL of T4 DNA Rapid Ligase (Enzymatics), and 1 μL of PCR-grade H 2 O. The ligation reactions were incubated at 20°C for 15 minutes, then quenched with 1 μL of 0.5 M EDTA and combined into a single 15 mL conical tube.

[0381] The pool of quenched ligation reactions was then purified using diluted Agencourt AMPure XP magnetic beads (Beckman Coulter Genomics Inc.) prepared by combining 350 μL of AMPure XP beads and 3.15 mL of AMPure XP buffer (2.5 M NaCl, 20% PEG8000). The purification was performed with 3.5 mL of diluted AMPure XP beads and eluted in 200 μL of buffer containing 10 mM Tris pH 8 and 0.05% Tween 20. The AMPure XP bead purification was then repeated with 400 μL of AMPure XP beads and eluted in 20 μL of buffer containing 10 mM Tris pH 8 and 0.05% Tween 20.

[0382] To amplify the purified ligation product, prepare a PCR reaction with the purified ligation product and primers. To 6 μL of the purified ligation product, add 10 μL of NEBNext Ultra IIQ5 master mix, 0.2 μL of 100 μM forward and reverse primers, and 3.6 μL of PCR-grade HO. 2 O. The forward primer comprises a flow cell adapter sequence suitable for sequencing, a unique molecular identifier, and a nucleic acid sequence complementary to the first amplification primer binding site located on the first strand of the nucleic acid adapter. Table 8 provides the sequence of the forward primer used.

[0383] Table 8. Forward primers for short probe hybridization method.

[0384] The reverse primer comprises a flow cell adapter sequence suitable for sequencing, a unique molecular identifier, and a nucleic acid sequence complementary to the second amplification primer binding site located on the second strand of the nucleic acid adapter. Table 9 provides the sequences of the reverse primers used.

[0385] Table 9. Reverse primers for short probe hybridization method.

[0386] The PCR procedure used to amplify the purified extension product included the following steps: (1) 30 seconds at 98°C (2) 10 seconds at 98°C (3) 30 seconds at 65°C (4) 72°C for 30 seconds (5) Repeat steps (2)-(4) 18 times (6) 2 minutes at 72°C Amplified products were stored at 4°C. 4 μL of each PCR reaction was combined into six pools of 16 samples each. Amplified products were further purified using AMPure XP beads with 64 μL AMPure XP beads and eluted with 20 μL buffer containing 10 mM Tris pH 8 and 0.05% Tween 20.

[0387] The purified amplified products were evaluated using a high sensitivity DNA chip (Agilent Genomics) on a 2100 bioanalyzer and a KAPA library quantification kit (Kapa Biosystems) for the Illumina platform. The purified amplified products were also diluted to 15 pM for sequencing on a MiSeq (Illumina) using standard sequencing primers or custom spiked Read1 primers (SEQ ID NO: 25) according to the manufacturer's instructions (MiSeq kit v32×75 bp).

[0388] Example 6 - Direct PCR Method for 96 Multiplex Samples In the described embodiment, the direct PCR method of the present disclosure was used to sequence the identifier oligonucleotides collected from 96 multiplex samples. In the described embodiment, 8 types of forward amplification primers and 12 types of reverse amplification primers were used. The forward primers contained a P5 flow cell adapter (SEQ ID NO: 3), a nucleic acid sequence containing a unique molecular identifier, and a region complementary to the first amplification primer binding site present on the identifier oligonucleotide. Table 10 provides the sequences of the forward amplification primers used.

[0389] Table 10. Forward amplification primers used for direct PCR method.

[0390] The reverse primer comprises the P7 flow cell adaptor (SEQ ID NO: 4), a nucleic acid sequence comprising a unique molecular identifier, and a region complementary to the second amplification primer binding site present on the identifier oligonucleotide. Table 11 provides the sequences of the reverse amplification primers used.

[0391] Table 11. Reverse amplification primers used for direct PCR method.

[0392] With 8 forward amplification primers and 12 reverse amplification primers, a total of 96 unique combinations are available when combining the unique molecular identifiers from a pair of forward and reverse primers, allowing multiplexing of 96 samples.

[0393] To amplify the pooled identifier oligonucleotides for sequencing, PCR reactions with the pooled identifier oligonucleotides and forward and reverse amplification primers were prepared in a 96-well plate with 2 μL of each identifier oligonucleotide sample, 10 μL of NEBNext Ultra IIQ5 master mix, 2 μL of 10 μM forward amplification primer, 2 μL of reverse amplification primer, and 4 μL of PCR-grade HO. 2 O. Each well in the 96-well plate contains a unique combination of an identifier oligonucleotide sample and forward and reverse amplification primers. The PCR program used includes the following steps: (1) 30 seconds at 98°C (2) 10 seconds at 98°C (3) 30 seconds at 65°C (4) 72°C for 30 seconds (5) Repeat steps (2) to (4) 6 to 10 times (6) 2 minutes at 72°C Amplified products were stored at 4° C. 10 μL of each PCR reaction was combined into a single 15 mL conical tube.

[0394] The pooled PCR reactions were purified using diluted Agencourt AMPure XP magnetic beads (Beckman Coulter Genomics Inc.) prepared by combining 115.2 μL AMPure XP beads and 1036.8 μL AMPure XP buffer (2.5 M NaCl, 20% PEG8000). Purification was performed using 1152 μL of diluted AMPure XP beads and eluted in 60 μL of buffer containing 10 mM Tris pH 8. The purification process was repeated using 60 μL AMPure XP beads and eluted in 70 μL of buffer containing 10 mM Tris pH 8.

[0395] After AMPure XP purification, prepare a PCR reaction with universal primers using 9 μL of pooled direct PCR products, 15 μL of NEBNext Ultra IIQ5 master mix, 3 μL of 10 μM universal P7 primer (SEQ ID NO: 153), and 2 μL of 10 μM universal P5 primer (SEQ ID NO: 154). The PCR program used was: (1) 98°C for 30 seconds, (2) 10 seconds at 98°C (3) 30 seconds at 65°C (4) 72°C for 30 seconds (5) Repeat steps (2) to (4) 15 to 24 times (6) 2 minutes at 72°C Two rounds of AMPure XP bead purification were performed. The first round was performed with 30 μL beads and eluted with 20 μL buffer containing 10 mM Tris pH 8, and the second round was performed with 20 μL beads and eluted with 11 μL buffer containing 10 mM Tris pH 8.

[0396] These purified PCR products were evaluated using a high sensitivity DNA chip (Agilent Genomics) on a 2100 Bioanalyzer. The purified PCR products were also diluted for sequencing on a MiSeq (Illumina) using a custom spike-in primer (SEQ ID NO: 25) according to the manufacturer's instructions (MiSeq kit v32×75 bp).

[0397] Example 7 - Spatial Detection of Target Analytes in FFPE Samples The methods of the present invention are used to spatially detect a number of different target analytes, including target proteins and target RNAs, in samples of inflamed human tonsil tissue FFPE sections.

[0398] In one experiment, 30 different target proteins were spatially detected in two consecutive sections cut from inflamed human tonsil tissue FFPE sections using the methods of the present disclosure. The 30 target proteins are set forth in Table 12. The 30 target proteins included IgG rabbit isotypes and IgG mouse isotypes as negative controls because these target proteins should not be present in inflamed human tonsil samples and therefore should not have been detected.

[0399] Table 12. Target proteins Target protein Target protein AKT FOXP3 B7-H3 GZM Bcl-2 Histone H3 Beta-2-microglobulin Ki67 β-catenin CD20 CD14 P-AKT CD19 PanCK CD3 PD1 CD4 PD-L1 CD44 S6 CD45 STAT3 CD45RO P-STAT3 CD56 VISTA CD68 IgG rabbit isotype (negative control) CD8A IgG mouse isotype (control) In order to spatially detect 30 target proteins, 30 different probes of the present disclosure were used. Each probe comprises a target binding domain comprising an antibody that specifically binds to one of the 30 target proteins in Table 12. Two consecutive sections were contacted with many of the 30 different probes. Ninety-six regions of interest (ROIs) were then identified. For each ROI, the ROI was irradiated with ultraviolet light to release the identifier oligonucleotide from the probe bound within the ROI. The released identifier oligonucleotides were then collected and identified using the short probe hybridization method of the present disclosure, thereby spatially detecting the 30 target proteins in two consecutive sections. Fig.21 As shown in , the number of reads for each target protein in each ROI of two consecutive sections correlated well, confirming that the method produced reproducible results.

[0400] In a second experiment, 20 different target RNAs were spatially detected in two different serial sections cut from inflamed human tonsil tissue FFPE sections using the methods of the present disclosure. The 20 different target RNAs are presented in Table 13. The 20 target RNAs included 6 negative controls (Negative Probes) that should not have been detected in the sample.

[0401] Table 13. Target RNAs Target RNA Target RNA Target RNA CD3E CD40 CTLA4 CD3G CD45 GAPDH CD4 CD74 KRT13 CD20 CD79A PD1 PSA RP56 Negative probe #1 Negative probe #2 Negative probe #3 Negative probe #4 Negative probe #5 Negative probe #6 In order to spatially detect 20 target RNAs, 20 different probes of the present disclosure were used. Each probe comprises a target binding domain comprising a nucleic acid sequence complementary to at least a portion of one of the 20 target RNAs. Two consecutive sections were contacted with a plurality of 20 different probes. Ninety-six regions of interest (ROIs) were then identified. For each ROI, the ROI was irradiated with ultraviolet light to release the identifier oligonucleotide from the probe bound within the ROI. The released identifier oligonucleotides were then collected and identified using the direct PCR method of the present disclosure, thereby spatially detecting the 20 target RNAs in two consecutive sections. Fig. 22 As shown in , the number of reads for each target RNA in each ROI of two consecutive sections correlated well, confirming that the method produces reproducible results.

[0402] Example 8 - Spatial Detection of Target Proteins in Fluorescently Stained FFPE Samples In another experiment, 5 μm FFPE sections of inflamed human tonsil tissue were stained with four fluorescent markers: (1) CD3E, a T-cell marker; (2) PanCK, an epithelial cell marker; (3) Ki-67, a proliferation marker; and (4) SYTO 83, a DNA dye, such as Fig.23 The stained FFPE sections were then exposed to probes for 30 target proteins as described in Example 7. Fig.23 As shown in the left figure, 96 regions of interest (ROIs) were selected. Each ROI is a circle with a diameter of 500 μm. For each ROI, the ROI was irradiated with ultraviolet light to release the identifier oligonucleotide from the probe bound within the ROI. The released identifier oligonucleotides were then collected and identified using the short probe hybridization method of the present disclosure, thereby spatially detecting 30 target proteins in FFPE sections. Fig.23 Shown in the right panel, PanCK, CD3E and Ki67 were spatially detected in ROIs associated with their fluorescently displayed markers. Thus, the results generated by the methods of the present disclosure correlate with those generated using established immunohistochemical methods.

[0403] Example 9 - Spatial Detection of Target RNAs in FFPE Samples In another experiment, 5 μm sections from inflamed human tonsil tissue FFPE blocks were contacted with probes for 20 target RNAs as described in Example 7. 96 regions of interest (ROIs) were then selected. Each ROI was a circle with a diameter of 500 μm. For each ROI, the ROI was irradiated with ultraviolet light to release the identifier oligonucleotide from the probe bound within the ROI. The released identifier oligonucleotides were then collected and identified using the direct PCR method of the present disclosure, thereby spatially detecting the 20 target RNAs in two consecutive sections. Total RNA from 20 μm sections of the same inflamed human tonsil tissue FFPE block was then isolated. Using NanoString Systematic analysis of total RNA. Fig.24 It is shown that the average number of counts recorded for 11 different RNA targets using the method of the present disclosure is comparable to that recorded using The average number of counts recorded by the system for the same 11 different RNA targets correlated well. Thus, the results generated using the methods of the present disclosure correlate with those generated using established direct detection methods.

[0404] Example 10 - Spatial detection of target RNAs in specific subregions of a ROI In another experiment, 5 μm sections from inflamed human tonsil tissue FFPE blocks were exposed to probes against 30 target proteins as described in Example 7. The same 5 μm sections were also stained with 4 fluorescent markers: (1) CD3E, a T-cell marker; (2) PanCK, an epithelial cell marker; (3) Ki-67, a proliferation marker; and (4) SYTO83, a DNA dye. Fig.25 As shown in , 48 regions of interest (ROIs) were identified. For each ROI, two subregions were then identified based on fluorescence staining. The ROI region that was positive for PanCK fluorescence staining (PanCK+) was called the "tumor" subregion, and the ROI region that lacked PanCK fluorescence staining was called the "microenvironment" subregion, as shown in Fig.25 As shown in . For each ROI, a customized mask was generated based on the intensity of PanCK fluorescent staining, and the tumor subregion and the microenvironment subregion were irradiated with ultraviolet light to release the identifier oligonucleotides from the probes bound to each subregion. The released identifier oligonucleotides were also collected separately. Then, the short probe hybridization method of the present disclosure and NanoString The system is used to analyze the collected identifier oligonucleotides. Fig.25 The bottom image shows the NanoString The results of the short probe hybridization method of the system and the present disclosure correlated well. In addition, PanCK was detected at significantly higher levels in tumor subregions compared to microenvironment subregions. Therefore, the spatial detection results provided by the method of the present disclosure are consistent with established fluorescent immunohistochemistry methods and allow spatial detection within highly specific regions of the sample.

[0405] Example 11 - 96-Human Immuno-Oncology Experimental Panel A 96-plex human immuno-oncology panel was designed for use with the direct-PCR method of the present invention. The panel contains a number of probes that can be used to spatially detect 96 different human target RNAs using the direct-PCR method of the present disclosure. The 96 target RNAs are shown in Table 14.

[0406] Table 14. Target RNAs target target target target target target target target AKT1 CD3E CEACAM8 FOXP3 IFNG KRT1 NCAM1 SOD2 ARG1 CD4 CMKLR1 GZM IFNGR1 KRT10 NKG7 SOX10 B2M CD40 CSF1R H3F3A IL10 KRT14 NT5E STAT1 BATF3 CD40LG CTLA4 HAVCR2 IL12B KRT17 PDCD1 STAT2 BCL2 CD44 CTNNB1 HIF1A 1L15 KRT18 PDCD1LG2 STAT3 BCL2L1 CD47 CXCL10 HLA_DQA1 IL1B KRT19 PECAM1 TBX21 CCL5 CD68 CXCL9 HLA_DRB IL6 KRT6A PMEL TIGIT CCND1 CD74 CSCR6 HLA_E ITGAM KRT7 PSMB10 TNF CD14 CD86 DKK2 ICAM1 ITGAV LAG3 PTEN TNFRSF9 CD27 CD8A EPCAM ICOSLG ITGAX LY6E PRTPRC TNFSF4 CD274 CEACAM1 FAS IDO1 ITGB2 MKI67 RPS6 VEGFA CD276 CEACAM6 FASLG IFNAR1 ITGB8 MS4A1 S100B VSIR The experimental panel includes a total of 928 different probes. Each probe comprises an identifier oligonucleotide comprising a first amplification primer binding site, a nucleic acid sequence comprising a unique molecular identifier, a unique nucleic acid sequence that identifies a target RNA bound to a target binding domain, and a second amplification primer binding site. Fig.26 A schematic diagram of the probes used in the experimental panel is shown. For each of the 96 target RNAs, at least one probe in the 928 probe sets contains a target binding domain that hybridizes directly or indirectly to the target RNA. For most of the 96 target RNAs, there are 10 different probes that hybridize directly or indirectly to a particular target RNA. These 10 different probes hybridize directly or indirectly to different locations of the target RNA to produce a "tiling" effect, such as Fig. 27 As shown in the top figure of . Tiling multiple probes onto the target RNA means that each target RNA can be detected multiple times individually, thereby increasing the overall accuracy of the measurement. Fig. 27 In the case of tiling 10 probes onto a single target RNA, shown in the bottom graph, one probe may be erroneously detected too many times (outlier high count probe), while another probe may be erroneously detected too few times (outlier low count probe). However, the other 8 probes may be detected at similar levels, indicating that the two outliers should be discarded during analysis and the signals from the 8 probes used to generate a more accurate measure of target RNA abundance.

[0407] The set of 928 probes also includes 80 negative control probes. Each of the 80 negative control probes includes a target binding domain comprising a chaotic non-specific nucleic acid sequence, which is designed using guidelines from the External RNA Controls Consortium so that the target binding domain should not be complementary to RNA molecules present in human samples. Therefore, these 80 negative control probes should not be detected during the analysis.

[0408] A 96-plex human immuno-oncology panel was used to analyze tissue microarrays. The tissue microarrays contained FFPE samples of 22 common human cell lines, including normal and cancerous cell types. Some of the cell lines are shown in Table 15.

[0409] Table 15. Cell lines Cell lines Cell lines Cell lines Cell lines CCRF-CEM DAUDI H596 H2228 HT29 HUT78 HUH7 JURKAT M14 MDA-MB-468 MOLT4 RAJI SKBR3 SUDHL1 SUDHL4 The tissue microarray also contained a mouse cell line (3T3) as a negative control. Each FFPE sample on the microarray was exposed to 928 different probes from a variety of immuno-oncology panels. Fig.28 As shown in , for each FFPE sample, at least three circular regions of interest (ROIs) with a diameter of 300 μm were selected. As a negative control, ROIs can also be selected on a microarray area that does not contain FFPE samples (glass negative control). For each ROI, the ROI is irradiated with ultraviolet light to release the identifier oligonucleotide from the probe bound to the ROI. The released identifier oligonucleotides are then collected and identified using the direct PCR method of the present disclosure, thereby spatially detecting 96 target RNAs in each FFPE sample on the tissue microarray.

[0410] Fig.29 Shows adequate read depth achieved using the MiSeq v3 flow cell. Fig.30 The top graph shows that for the glass negative control ROIs, target RNAs were not spatially detected. Fig.30 The bottom panel shows that almost no target RNAs were detected in the negative control mouse 3T3 FFPE sample. Fig.31 , 33 As shown in Figures 3 and 34, specific target RNAs were successfully detected in HEK293 (human embryonic kidney) FFPE samples and Jurkat (human T-cell lymphocytes) FFPE samples. Fig.31 , 33and 34 showed that for specific target RNAs, including AKT1, B2M, CD3E, HIF1A, PTEN, RPS6, STAT1, STAT2, STAT3, VEGF, PTPRC (CD45) and KRT1 / 10 / 18 / 19, "tiled" probe clusters were detected. These results indicate that there are certain target RNAs that are differentially transcribed in two different cell lines. The results of the described experiments were also validated using the NanoString nCounter system to identify the collected identifier oligonucleotides. As Fig. 27 As shown in , the results using the direct-PCR method of the present disclosure are consistent with the results obtained using the NanoString nCounter system.

Claims

1. A method, comprising: (1) contacting at least one target analyte in a tissue sample with at least three probes, thereby tiling the probes onto the at least one target analyte, Each probe contains: a target binding domain that binds to the at least one target analyte; and a single-stranded identifier oligonucleotide comprising a unique nucleic acid sequence that identifies a target analyte bound to the target binding domain, wherein each probe comprises a photocleavable linker between said single-stranded identifier oligonucleotide and said target binding domain; (2) contacting the tissue sample with one or more fluorescently labeled antibodies and / or fluorescent stains; (3) detecting the one or more fluorescently labeled antibodies and / or fluorescent stains; (4) exciting at least one region on the tissue sample with light to cleave the photocleavable linker, thereby releasing the single-stranded identifier oligonucleotide; (5) collecting the released single-stranded identifier oligonucleotide; and (6) Sequencing the released single-stranded identifier oligonucleotide.

2. The method of claim 1, further comprising identifying the sequenced single-stranded identifier oligonucleotide to spatially detect at least one target analyte in the tissue sample.

3. The method of claim 1, wherein the method further comprises, after step (3), identifying at least one region of interest on the tissue sample based on the detected fluorescently labeled antibody and / or fluorescent stain.

4. The method of claim 3, wherein the at least one region excited in step (4) is the at least one region of interest.

5. The method of claim 1, wherein sequencing the released single-stranded identifier oligonucleotides comprises amplifying the collected single-stranded identifier oligonucleotides.

6. The method of claim 5, wherein the single-stranded identifier oligonucleotide further comprises a nucleic acid sequence comprising a unique molecular identifier.

7. The method of claim 5, wherein the single-stranded identifier oligonucleotide further comprises a first amplification primer binding site and a second amplification primer binding site.

8. The method of claim 7, wherein amplifying the collected single-stranded identifier oligonucleotides comprises performing a polymerase chain reaction (PCR).

9. The method of claim 8, wherein performing PCR comprises the use of a first amplification primer and a second amplification primer, Wherein the first amplification primer comprises: first identifying a nucleic acid sequence at a specific location of a tissue sample from which the identifier oligonucleotide was released; and a nucleic acid sequence complementary to the second amplification primer binding site; and Wherein the second amplification primer comprises: a second nucleic acid sequence identifying a specific location of the tissue sample from which the identifier oligonucleotide was released; and A nucleic acid sequence complementary to the binding site of the first amplification primer.

10. The method of claim 9, wherein the first amplification primer further comprises a first flow cell binding site and the second amplification primer further comprises a second flow cell binding site.

Images