PAM-free single base mutation detection method of CRISPR-Cas12a system

Abstract

The invention discloses a PAM-free single base mutation detection method of a CRISPR-Cas12a (clustered regularly interspaced short palindromic repeats-associated 12a) system, which comprises the following steps: S1, amplifying DNA (deoxyribonucleic acid) in a sample to be detected to obtain an amplified double-chain target; s2, unwinding the amplified double-stranded target by utilizing a high-temperature or alkaline environment to obtain single-stranded DNA (Deoxyribonucleic Acid); s3, Cas12a protein, crRNA, a nucleic acid report probe and a buffer solution are added into a system containing the single-stranded DNA to be detected, the unwound single-stranded DNA can be recognized by a compound formed by the Cas12a protein and the crRNA without a PAM motif, the trans-cleavage activity of the Cas12a protein is activated, and the nucleic acid report probe is rapidly cleaved without difference to generate a fluorescence signal. Besides, mismatch is introduced to crRNA, the recognition capacity of gene single base mutation is remarkably improved, the application range of a CRISPR-Cas12a system is expanded, and the detection method has the advantages of being high in sensitivity and specificity and has wide application prospects in the fields of molecular diagnosis and the like.

Description

Technical Field

[0001] The present invention belongs to the field of gene detection, and specifically relates to a PAM-free single-base mutation detection method of a CRISPR-Cas12a system. Background Art

[0002] Gene mutation, especially single-base mutation detection technology, is of great significance for early diagnosis of diseases and drug strategies. In the context of precision medicine, gene mutation detection has become an important clinical test indicator.

[0003] In recent years, the rapidly developing CRISPR system (Clustered Regularly Interspaced Short Palindromic Repeats) has the advantages of being simple, fast, efficient, highly sensitive and specific, and easy to combine with point-of-care instant detection equipment. At present, the Cas proteins that have been studied more include Cas9, Cas12, and Cas13, among which Cas9 and Cas12 cut DNA chains, and Cas13 cuts RNA chains. Unlike Cas9, Cas12a has trans-cutting activity (indiscriminate cutting of nearby single-stranded DNA fragments) after cutting the target. However, under the guidance of guide RNA (crRNA), Cas12a needs to recognize a special protospacer adjacent motif (PAM) before it can cut when recognizing double-stranded DNA. If there is no PAM motif near the gene mutation site, the CRISPR-Cas12a system cannot recognize it, so it is difficult to detect, which also leads to the limitation of CRISPR-Cas12a system in clinical diagnostic applications.

[0004] In the reported technology, the Cas12a protein is modified to change the protein domain that recognizes the PAM motif to expand its recognition range. However, this method is time-consuming and labor-intensive. Despite this, it still relies on the recognition of suboptimal PAM motifs. In addition, the PAM motif is introduced on the amplification primer, thereby realizing the construction of a PAM-free method. However, the introduction of the PAM motif on the primer will reduce the amplification efficiency and thus reduce the detection sensitivity.

[0005] Based on this, it is necessary to develop a detection method that does not require a PAM motif but has high sensitivity and single-base mismatch recognition capabilities. Summary of the invention

[0006] In view of the shortcomings of the prior art, the purpose of the present invention is to provide a single-base mutation gene detection method with strong specificity, high sensitivity and non-disease diagnosis purpose. The CRISPR-Cas12a system is used to target single-stranded DNA, does not require the characteristics of the PAM motif, and releases its trans-cleavage activity to quickly and indiscriminately cut the nucleic acid reporter probe to produce a fluorescent signal.

[0007] The present invention provides a PAM-free single-base mutation detection method of a CRISPR-Cas12a system, comprising the following steps:

[0008] S1, performing an isothermal or variable temperature nucleic acid amplification reaction on the DNA in the sample to be tested to obtain an amplified double-stranded target;

[0009] S2, using high temperature or alkaline environment to unwind the amplified double-stranded target to obtain single-stranded DNA;

[0010] S3. Cas12a protein, crRNA, nucleic acid reporter probe, and buffer are added to the system containing the target to be tested. The unwound single-stranded DNA can be recognized by the complex formed by Cas12a protein and crRNA without the need for a PAM motif, and the trans-cleavage activity of Cas12a protein is activated, and the nucleic acid reporter probe is quickly and indiscriminately cut to produce a fluorescent signal.

[0011] Preferably, in step S1, the DNA in the sample to be tested is amplified by PCR to improve the sensitivity of detection.

[0012] Preferably, in step S2, the amplification reaction product is placed at 90-100° C. for 1-10 min;

[0013] Alternatively, NaOH is added to the amplification reaction product to maintain the pH at 8-14.

[0014] Preferably, in step S3, the entire solution system is formed into a suitable reaction environment for Cas12a protein by low temperature or addition of hydrochloric acid.

[0015] Preferably, in step S3, crRNA is used to guide the Cas12a protein to specifically bind to the target DNA; including a Repeat sequence and a Spacer sequence, the Repeat sequence can autonomously form a hairpin structure and can specifically bind to the Cas12a protein; the Spacer sequence specifically recognizes the single-stranded DNA sequence obtained after the treatment.

[0016] The design principle of crRNA is: introducing mismatches in crRNA improves the ability of the CRISPR-Cas12a system to distinguish between wild-type and mutant genes.

[0017] Preferably, in step S3, the sequence of the crRNA is one or more of SEQ ID NO.5-12.

[0018] More preferably, the sequence of the crRNA is SEQ ID NO.5.

[0019] Preferably, in step S3, the nucleic acid reporter probe is a single-stranded DNA, and its two ends are respectively modified with a fluorescent group and a quenching group, and the fluorescent group is selected from one or more of FAM, VIC, HEX, TET, JOE, Cy5, Cy3, and TAMRA; the nucleic acid reporter probe is 5'-FAM-(N) n -BHQ1-3' (N=A,G,C,T; n=0~30).

[0020] More preferably, the nucleic acid reporter probe is 5'-FAM-CCCCCC-BHQ1-3'.

[0021] Preferably, in step S3, the Cas12a protein is a protein having endonuclease activity and trans-cleavage activity, selected from any one of LbCas12a, FnCas12a, AsCas12a, and ErCas12a.

[0022] Preferably, in step S3, the buffer solution contains 1-100 μM PVP, 10-50 mM Tris-HCl, 5-50 mM NaCl, 10-50 mM MgCl2 and 1.0-5.0 mM DTT.

[0023] The detection method provided by the present invention first treats the amplified product at high temperature or by adding NaOH, then cools the amplified product at 0°C or neutralizes it by adding HCl to restore it to an environment suitable for Cas12a reaction, and then adds crRNA, Cas12a, nucleic acid reporter probe and buffer to the system containing the target to be tested for detection.

[0024] The main mechanism of the present invention is as follows: the double-stranded DNA is unwound by creating a high temperature or alkaline environment, and then the whole system is made to form a suitable reaction environment for the Cas12a protein by low temperature or adding hydrochloric acid. The unwound single-stranded DNA can be recognized by the complex formed by the Cas12a protein and crRNA without the need for a PAM motif, and the trans-cutting activity of the Cas12a protein is activated, and the nucleic acid reporter probe is quickly and indiscriminately cut to produce a fluorescent signal.

[0025] Beneficial technical effects of the present invention:

[0026] 1) The present invention provides a PAM-free single-base mutation detection method for a CRISPR-Cas12a system, wherein the double-stranded DNA is unwound by creating a high temperature or alkaline environment, and then a suitable reaction environment for the Cas12a protein is formed by low temperature or the addition of hydrochloric acid, and then Cas12a is directly used for the detection of single-stranded DNA: the unwound single-stranded DNA can be recognized by the complex formed by the Cas12a protein and crRNA without the need for a PAM motif, and the trans-cleavage activity of the Cas12a protein is activated, and the nucleic acid reporter probe is quickly and indiscriminately cut to generate a fluorescent signal.

[0027] 2) The present invention significantly improves the ability to distinguish single-base mutations in genes by introducing mismatches on crRNA, expands the detection range of the CRISPR-Cas12a system, and has the characteristics of high sensitivity and specificity, and has broad application prospects in the fields of molecular diagnosis and so on. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Schematic diagram of the principle of the detection method of the present invention.

[0029] Figure 2 To investigate the feasibility of constructing a single-stranded PAM-free CRISPR-Cas12a system for detection by heating and chemical methods.

[0030] Figure 3 Optimization of the ratio of Cas12a to crRNA when constructing a single-stranded CRISPR assay using the heating method.

[0031] Figure 4 Optimization of cooling temperature and cooling time when constructing single-stranded DNA for CRISPR detection using the heating method.

[0032] Figure 5 Optimization of the ratio of Cas12a to crRNA when chemically constructing single-stranded CRISPR detection.

[0033] Figure 6 Optimization of the concentration and time of adding NaOH solution when chemically constructing single-stranded CRISPR detection.

[0034] Figure 7 This is to explore the sensitivity of the detection method of the present invention.

[0035] Figure 8 This is an exploration of the specificity of the detection method of the present invention in detecting single-base mismatches in genes. DETAILED DESCRIPTION

[0036] The present invention is described in detail below by means of specific examples. The experimental methods in the following examples are conventional methods unless otherwise specified. The medicinal materials, reagent materials, etc. used in the following examples are commercially available products unless otherwise specified.

[0037] Table 1 shows the sequences of primers, crRNA and nucleic acid reporter probes. The primers in Table 1 were designed based on the fact that codon 537 is crucial for distinguishing mutant and wild-type ESR1 genes.

[0038] Table 1

[0039]

[0040] The present invention is further described below by way of examples and drawings.

[0041] Example 1

[0042] A PAM-free single-base mutation detection method for a CRISPR-Cas12a system comprises the following steps:

[0043] (1) Taking PCR amplification as an example: the amplification system is 50 μL, including 10 pg / μL wild-type gene (SEQ ID NO.1) or mutant gene (SEQ ID NO.2), 0.4 uM upstream primer F or 0.4 μM downstream primer R, Taq mixture (2×), 1 ng / μL plasmid to be detected; the PCR amplification program is: 95°C, 5 min; 95°C, 10 s, 58°C, 30 s, 72°C, 30 s, 35 cycles; 72°C, 10 min, 4°C storage. The experimental group with water as template was used as the negative control group;

[0044] Specifically, Taq Mix (2×) was purchased from TaKaRa, and 2×Accurate Taq MasterMix was used;

[0045] (2) Treating the amplified product: 2 μL of the amplified product obtained in step (1) was added with 2 μL of DEPC water and placed at 95°C for 1 to 10 min, and then placed at 0°C to restore a suitable reaction environment for CRISPR-Cas12a;

[0046] Alternatively, add 1 μL 100 mM NaOH and 1 μL 100 mM HCl to restore the appropriate reaction environment for CRISPR-Cas12a;

[0047] (3) CRISPR-Cas12a detection: The system is 20 μL, 4 μL of the product to be tested obtained in step (2), 100 nM Cas12a, 200 nM crRNA, 800 nM nucleic acid reporter probe, 1× NEB 2.1 buffer, add DEPC water to make up to 20 μL, and incubate at 37°C for 90 min.

[0048] (4) Signal reading and analysis: Signal monitoring is performed using a device capable of reading fluorescence signals, such as an ELISA reader or a real-time fluorescence quantitative PCR instrument, and the test results are analyzed by signal differentiation;

[0049] The Cas12a protein used was LbCas12a;

[0050] The buffer solution contained 50 μM PVP, 40 mM Tris-HCl, 30 mM NaCl, 30 mM MgCl2 and 3.0 mM DTT.

[0051] At the same time, ultraviolet light or blue light can also be used to irradiate the system after the reaction. The positive test group presents a bright color visible to the naked eye, and the negative control group solution has no bright color. Therefore, the test results of the experimental group and the control group are analyzed by observing the color changes of the solution.

[0052] Figure 1 It shows that PCR amplifies the viral DNA in the sample to be tested to obtain an amplification reaction product; the high temperature and alkaline environment can unwind the double-stranded DNA, and then Cas12a binds to the single-stranded target under the guidance of crRNA, thereby activating the trans-cutting activity of Cas12a, cutting the nucleic acid reporter probe in the detection system, and after the probe molecule is cut, a large amount of detectable fluorescent signal is generated, which can be monitored in real time in the real-time fluorescence quantitative PCR instrument.

[0053] Figure 2 It shows that the PCR amplification primers (SEQ ID NO.3-4), crRNA and the established PAM-free CRISPR-Cas12a detection system designed based on the SEQ ID NO.1-2 region have good detection effects on the analytes.

[0054] Example 2

[0055] In order to obtain the best detection signal, some conditions were optimized.

[0056] First, the combination of Cas12a and crRNA is not optimal at a 1:1 ratio, and the more Cas12a protein, the better. Figure 3As shown in (a), when the ratio of Cas12a:crRNA is 1:2, the fluorescence difference ΔF (fluorescence difference refers to the difference between the experimental group and the control group) reaches the maximum value; the ratio of Cas12a:crRNA is fixed, and the concentrations of Cas12a and crRNA are proportionally increased or decreased to find the maximum ΔF, as shown in Figure 3 As shown in (b), when the concentration of Cas12a:crRNA is 100nM:200nM, ΔF has reached the maximum value, and even if the concentration continues to increase, ΔF does not change much; then the processing of the amplified product is optimized. The closer the cooling temperature is to the Tm value of the target double strand, the longer the cooling time, the more likely the amplified product is to form a double strand, resulting in a decrease in the ΔF signal, as shown in Figure 4 As shown in (a, b), when the cooling temperature is 0℃ and the cooling time is 1min, ΔF reaches the maximum value.

[0057] In summary, the optimal reaction conditions of the PAM-free CRISPR-Cas12a system are: Cas12a: crRNA is 100nM: 200nM, cooling temperature is 0℃, and cooling time is 1min.

[0058] Example 3

[0059] In order to obtain the best detection signal, some conditions were optimized.

[0060] First, the Cas12a: crRNA concentration ratio, the buffer solution was tested and the results showed that it was consistent with that in Example 2, such as Figure 5 As shown in (a, b), when Cas12a:crRNA is 100nM:200nM, ΔF reaches the maximum value. Secondly, the treatment conditions of the amplified product are optimized. The changes in the concentrations of NaOH and HCl solutions and the length of the treatment time have a certain impact on the change of ΔF, such as Figure 6 As shown in (a, b), when the concentration of NaOH solution and HCl solution reaches 100 mM, ΔF reaches saturation, and when the NaOH solution treatment time is 1 min, ΔF reaches the maximum value.

[0061] In summary, the optimal reaction conditions of the PAM-free CRISPR-Cas12a system are: Cas12a: crRNA is 100nM:200nM, the concentration of NaOH and HCl solution used is 100mM, and the NaOH solution treatment time is 1min.

[0062] Example 4

[0063] In order to determine the sensitivity of the CRISPR-Cas12a detection gene based on PAM-free of the present invention, the plasmid containing SEQ IS NO.1-2 of known concentration was diluted respectively, and the sample was diluted to different concentrations such as 0.01ag / μl, 0.1ag / μL, 1ag / μL, 10ag / μL, 100ag / μL, 1fg / μL, 10fg / μL as amplification templates. At the same time, no template was added as a negative control, and the amplification procedure and detection method in Example 1 were carried out, and the primers in SEQ ID NO.3-4 and crRNA (SEQ ID NO.5) were used for amplification and detection.

[0064] Under optimal conditions, the results are Figure 7 As shown in (a, b), the fluorescence intensity increases as the concentration increases from 0.01ag / μL to 10fg / μL. This indicates that as the concentration increases, the concentration of double-stranded DNA in the PCR amplification product increases, and the concentration of single-stranded DNA after treatment also increases accordingly, thereby generating Cas12a trans-cleavage activity of different intensities, that is, generating different detection signals.

[0065] Example 5

[0066] In order to determine the specificity of the single-base mutation of the gene detected by CRISPR-Cas12a based on PAM-free of the present invention, a plasmid containing wild-type and mutant ESR1 of known concentration was used as a template, and no template was used as a negative control, and the amplification procedure and detection method in Example 1 were performed, and the primers in SEQ ID NO.3-4 and crRNA (SEQ ID NO.5-12) were used for amplification and detection, preferably, SEQ ID NO.7 was used for amplification and detection.

[0067] Under optimal conditions, the test results are as follows Figure 8 As shown in (a, b), the PAM-free-based CRISPR-Cas12a detection system has good recognition ability for single-base mutations in genes and exhibits good single-base recognition specificity.

[0068] The nucleotide sequence used in the examples is as follows:

[0069] SEQ ID NO.1:

[0070] GGGGCTCGGGTTGGCTCTAAAGTAGTCCTTTCTGTGTCTTCCCACCTACAGTAACAAAGGCATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTGCTGCTGGAGATGCTGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGGCATCCGTGGAGGAGACGGACCAAAGCC

[0071] SEQ ID NO.2:

[0072] GGGGCTCGGGTTGGCTCTAAAGTAGTCCTTTCTGTGTCTTCCCACCTACAGTAACAAAGGCATGGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTCTGACCTGCTGCTGGAGATGCTGGACGCCCACCGCCTACATGCGCCCACTAGCCGTGGAGGGGCATCCGTGGAGGAGACGGACCAAAGCC

[0073] SEQ ID NO.3:GGGGCTCGGGTTGGCTCTAA

[0074] SEQ ID NO.4:GGCTTTGGTCCGTCTCCTCC

[0075] SEQ ID NO.5:

[0076] UAAUUUCUACUAAGUGUAGAUGGUCAGAGAGGGGCACCACG

[0077] SEQ ID NO.6:

[0078] UAAUUUCUACUAAGUGUAGAUGGUCAGUGAGGGGCACCACG

[0079] SEQ ID NO.7:

[0080] UAAUUUCUACUAAGUGUAGAUGGUCUGUGAGGGGCACCACG

[0081] SEQ ID NO.8:

[0082] UAAUUUCUACUAAGUGUAGAUGGUCAGUCAGGGGCACCACG

[0083] SEQ ID NO.9:

[0084] UAAUUUCUACUAAGUGUAGAUGGUCUGUCAGGGGCACCACG

[0085] SEQ ID NO.10:

[0086] UAAUUUCUACUAAGUGUAGAUGGUCAGUGUGGGGCACCACG

[0087] SEQ ID NO.11:

[0088] UAAUUUCUACUAAGUGUAGAUGGUCAGUGAGGCGCACCACG

[0089] SEQ ID NO.12:

[0090] UAAUUUCUACUAAGUGUAGAUGGUCAGUGUGGCGCACCACG

[0091] The above description is only a preferred embodiment of the present invention and is not intended to limit the scope of implementation of the present invention. If the present invention is modified or replaced by equivalents without departing from the spirit and scope of the present invention, it should be included in the protection scope of the claims of the present invention.

Claims

1. A PAM-free single-base mutation detection method for a CRISPR-Cas12a system, characterized in that: The following steps are involved: S1, performing an isothermal or variable temperature nucleic acid amplification reaction on the DNA in the sample to be tested to obtain an amplified double-stranded target; S2, using high temperature or alkaline environment to unwind the amplified double-stranded target to obtain single-stranded DNA; S3. Cas12a protein, crRNA, nucleic acid reporter probe, and buffer are added to the system containing the target to be tested. The unwound single-stranded DNA can be recognized by the complex formed by Cas12a protein and crRNA without the need for a PAM motif, and the trans-cleavage activity of Cas12a protein is activated, and the nucleic acid reporter probe is quickly and indiscriminately cleaved to produce a fluorescent signal.

2. The PAM-free single-base mutation detection method of the CRISPR-Cas12a system according to claim 1, characterized in that In step S1, the DNA in the sample to be tested is amplified by PCR.

3. The PAM-free single-base mutation detection method of the CRISPR-Cas12a system according to claim 1, characterized in that In step S2, the amplification reaction product is placed at 90-100° C. for 1-10 min; Alternatively, NaOH is added to the amplification reaction product to maintain the pH at 8-14.

4. The PAM-free single-base mutation detection method of the CRISPR-Cas12a system according to claim 1, characterized in that In step S3, the entire solution system is formed into a suitable reaction environment for Cas12a protein by low temperature or addition of hydrochloric acid.

5. The PAM-free single-base mutation detection method of the CRISPR-Cas12a system according to claim 1, characterized in that In step S3, the sequence of the crRNA is one or more of SEQ ID NO.5-12.

6. The PAM-free single-base mutation detection method of the CRISPR-Cas12a system according to claim 1 or 5, characterized in that The sequence of the crRNA is SEQ ID NO.

5.

7. The PAM-free single-base mutation detection method of the CRISPR system according to claim 1, characterized in that: In step S3, the nucleic acid reporter probe is a single-stranded DNA, and its two ends are respectively modified with a fluorescent group and a quenching group, and the fluorescent group is selected from one or more of FAM, VIC, HEX, TET, JOE, Cy5, Cy3, and TAMRA.

8. The PAM-free single-base mutation detection method of the CRISPR-Cas12a system according to claim 1 or 7, characterized in that The nucleic acid reporter probe is 5'-FAM-(N) n -BHQ1-3' (N=A,G,C,T; n=0~30).

9. The PAM-free single-base mutation detection method of the CRISPR-Cas12a system according to claim 1, characterized in that In step S3, the Cas12a protein is selected from any one of LbCas12a, FnCas12a, AsCas12a, and ErCas12a.

10. The PAM-free single-base mutation detection method of the CRISPR-Cas12a system according to claim 1, characterized in that In step S3, the buffer solution contains 1-100 μM PVP, 10-50 mM Tris-HCl, 5-50 mM NaCl, 10-50 mM MgCl2 and 1.0-5.0 mM DTT.

Images