Nucleic acid probe composition for detecting gene expression as well as preparation method and application of nucleic acid probe composition

Abstract

The invention relates to the technical field of biological detection, in particular to a nucleic acid probe composition for detecting gene expression and a preparation method and application thereof. The probe composition comprises an identification and replacement probe, a primer T1, a primer T2 and a readout probe, and the readout probe comprises a Cas12a protein. According to the invention, a tetrahedron double-target recognition technology is combined with a CRISPR / Cas12a system, the sensitivity of gene detection is improved through a short-chain effect probe, and the accuracy of gene locus recognition is enhanced.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a nucleic acid probe composition for detecting gene expression and a preparation method and application thereof. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] The interaction between genes and the environment has a profound impact on the regulation of gene expression and plays a key role in individual aging and disease progression. Environmental exposure not only affects the disease process by providing potential pathogenic factors, but also plays a role by regulating the mechanism of the effect of genetic polymorphism on gene expression. For example, in the process of normal aging and tumorigenesis, exogenous stimulation, abnormal activity of DNA modification enzymes, or defects in DNA damage repair may lead to incorrect repair of cellular DNA damage, thereby affecting gene expression and cell function. Studies have shown that exposure to common toxic heavy metals in the environment, such as arsenic, can lead to the generation and accumulation of intracellular reactive oxygen species (ROS), triggering a variety of cell stress responses and cell death mechanisms, including oxidative stress, autophagy, apoptosis, and programmed necrosis. In addition, arsenic can interact with nuclear proteins and DNA, causing DNA damage, lipid peroxidation, and depletion of protein thiol groups, further increasing the risk of mutations and inhibiting DNA repair. Genes susceptible to environmental disturbances, such as liver kinase B1 (LKB1), also known as serine / threonine kinase 11 (STK11), are involved in regulating basic cellular activities such as cellular metabolism, energy homeostasis, and DNA damage response; LKB1 can respond to mitochondrial stress and appropriately regulate mitochondrial biochemical reactions to maintain cellular homeostasis. Arsenic exposure can lead to mitochondrial matrix condensation and disruption of mitochondrial membrane potential, which in turn may affect the activity or stability of LKB1 through oxidative stress and DNA damage, thereby affecting its cellular function. The relationship between environmental exposure and gene regulation is complex and multifaceted, and their interactions jointly affect the physiological and pathological processes of organisms. By exploring the dynamic changes in gene expression, we can gain a deeper understanding of the defense and adaptation mechanisms of organisms to external risks, reveal how environmental factors affect gene expression patterns, and provide important clues for understanding the adaptive responses of organisms to environmental challenges.

[0004] By analyzing the expression changes of specific genes under different environmental conditions, researchers can reveal the relationship between epigenetic regulation and environmental exposure, and provide a scientific basis for the prevention, diagnosis and treatment of environment-related diseases. Real-time quantitative PCR (RT-qPCR) remains the gold standard for gene expression analysis; however, this technology has high requirements for sample quality, complex operation, and limited ability to detect mutant genes. In recent years, precise detection technology based on nucleic acid sequence recognition has been widely used in molecular diagnosis, especially in the field of mRNA detection. However, due to the low mRNA content and complex background, traditional single-probe detection methods are prone to high false positive rates and lack of accuracy. Summary of the invention

[0005] In order to overcome the above problems, the present invention provides a nucleic acid probe composition for detecting gene expression and a preparation method and application thereof.

[0006] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0007] In a first aspect of the present invention, there is provided a recognition and displacement probe, wherein the recognition and displacement probe comprises a DNA tetrahedron and an X-shaped structure;

[0008] The DNA tetrahedron is composed of DNA single strands P1 to P4, wherein any one DNA single strand is connected to the other three strands through complementary base pairing;

[0009] The 5′ end of DNA single strand P1 is complementary to the DNA single strand Right-up, DNA single strand Left-down and DNA single strand Left-up to form an X-shaped structure;

[0010] The 5′ end of the single-stranded DNA P3 is connected to the hairpin H1;

[0011] The 5′ end of the DNA single strand P2 is connected to the hairpin H2;

[0012] The 3′ end of the single-stranded DNA P4 is connected to the hairpin H3;

[0013] The 3' end of hairpin H1 and the 5' end of hairpin H3 can be linked by click chemistry.

[0014] The second aspect of the present invention provides a method for preparing the recognition and displacement probe according to the first aspect, comprising:

[0015] The oligonucleotides P1, P2, P3, P4, Right-up, Left-down and Left-up constituting the probe are mixed in equal molar amounts, annealed and combined, and then hairpins H1, H2 and H3 are added, and the recognition and displacement probes are obtained after incubation.

[0016] The third aspect of the present invention provides a probe composition for detecting gene expression, the probe composition comprising:

[0017] The recognition and replacement probe, primer T1, primer T2 and readout probe of the first aspect;

[0018] The read-out probe includes a Cas12a protein.

[0019] The fourth aspect of the present invention provides a product for detecting gene expression, comprising the probe composition described in the third aspect.

[0020] The fifth aspect of the present invention provides use of the probe composition described in the third aspect in detecting gene expression.

[0021] A sixth aspect of the present invention provides a method for detecting gene expression, comprising:

[0022] (1) Pre-reacting the recognition and replacement probes, primer T1 and primer T2 described in the first aspect, adding the readout probe, and then adding the standard. After incubation, the fluorescence signal is detected and a standard curve of activity concentration and fluorescence intensity is obtained based on the activity concentration and fluorescence intensity in the standard.

[0023] (2) Extracting RNA from target cells to obtain a sample to be tested; replacing the sample to be tested with the standard substance for detection to obtain a fluorescence signal, and calculating the gene expression level in the sample to be tested based on the fluorescence signal value of the sample to be tested and the standard curve.

[0024] Detection mechanism: After adding primer T1, the single-stranded DNA Right-up and single-stranded DNA Left-up in the X-shaped structure of the recognition and displacement probe are displaced, and the displaced Right-up and Left-up are paired with hairpin H1, thereby releasing hairpin H1; similarly, after adding primer T2, T2 is paired with hairpin H2, thereby releasing hairpin H2, and the end of hairpin H2 is paired with hairpin H3, thereby releasing hairpin H3; at this time, the 3′ end of hairpin H1 and the 5′ end of hairpin H3 are restored to a free state, and the 3′ end of hairpin H1 is modified with azide; the 5′ end of hairpin H3 is modified with cyclooctyne, and the two realize local click reaction within the spatial confinement of the tetrahedral vertex, quickly promoting the connection of DNA fragments. The connected single-stranded DNA then binds to CRISPR RNA (crRNA), which then activates the cross-cutting activity of the Cas12a enzyme, resulting in a fluorescent signal readout.

[0025] The beneficial effects of the present invention are:

[0026] (1) In the present invention, the tetrahedron dual-target recognition technology is combined with the CRISPR / Cas12a system to improve the sensitivity of gene detection and enhance the accuracy of gene site identification through short-chain effector probes.

[0027] The present invention detects the gene expression detection mechanism: after adding primer T1, the DNA single-strand Right-up and DNA single-strand Left-up in the X-shaped structure of the recognition and displacement probe are displaced, and the displaced Right-up and Left-up are paired with hairpin H1, thereby releasing hairpin H1; similarly, after adding primer T2, T2 is paired with hairpin H2, thereby releasing hairpin H2, and the end of hairpin H2 is paired with hairpin H3, thereby releasing hairpin H3; at this time, the 3′ end of hairpin H1 and the 5′ end of hairpin H3 are restored to a free state, so that a local click reaction is achieved within the spatial confinement of the tetrahedron vertex, and DNA fragment connection is quickly promoted. The connected single-stranded DNA then binds to CRISPR RNA (crRNA), which then activates the cross-cutting activity of the Cas12a enzyme, resulting in a fluorescent signal readout.

[0028] (2) The present invention introduces an X-type probe at one end point of the DNA tetrahedron to improve the accuracy of site identification, and the other end point performs double confirmation to achieve high-precision AND-type logical judgment. The recognition and displacement probe provided by the present invention uses two vertices of the tetrahedron structure for gene site identification. On one vertex, an X-type DNA probe with a hairpin site is integrated, which significantly enhances the accuracy of base recognition. When a stable X-type structure is formed, the remaining vertices are closed and can only be disassembled through a hairpin-mediated chain displacement reaction, which is initiated only when a sequence that fully matches the hairpin region exists. When there is a mismatch in the target sequence, the reaction efficiency is significantly reduced. In order to further enhance the detection specificity and reliability, a hairpin H2 probe is designed at the second vertex of the tetrahedron to identify another fragment of the target gene sequence, effectively reducing false positive results through double confirmation and improving detection accuracy.

[0029] (3) In the present invention, the double recognition results are converted through click reaction, and the confinement effect of tetrahedron construction is used to accelerate the click reaction and achieve rapid recognition conversion.

[0030] (4) The present invention introduces the cas12a readout system to improve the sensitivity of detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0032] Figure 1 Schematic diagram of the detection principle of an embodiment of the present invention.

[0033] Figure 2The preparation and characteristics of TDN probes; A is a gel electrophoresis image of TDN preparation with integrated X-shaped structure, B is an atomic force microscope image of TDN with integrated X-shaped structure, C is a gel electrophoresis image of X-shaped DNA probe detecting target, and D is a gel electrophoresis image of hairpin probe detecting target;

[0034] Figure 3 To verify the cross-cleavage activity of Cas12a by click ligation, A is the gel electrophoresis image of the click ligation process, B is the time-dependent fluorescence intensity of click ligation with or without DNA tetrahedron, C is the fluorescence intensity of Cas12a cleavage reporter activated by click ligation of ssDNA fragments of different lengths, D is the fluorescence spectrum of Cas12a cleavage reporter to ssDNA targets of different concentrations, and E is the fluorescence intensity response of Cas12a cleavage reporter to ssDNA targets of different concentrations;

[0035] Figure 4 The figure is the performance verification of TDN probe; A is the fluorescence spectrum of TDN probe at different T1 concentrations under the same T2 concentration; B is the fluorescence intensity response of TDN probe to different T1 concentrations; C is the fluorescence spectrum of TDN probe under various input modes; D is the fluorescence intensity response of TDN probe to various input modes; E is the specificity evaluation of TDN probe for target; F is the repeatability evaluation of TDN probe;

[0036] Figure 5 It is the stability test of TDN probe, where A is the anti-degradation test and B is the decay time;

[0037] Figure 6 The figures are tests of animal tissue samples; A is RT-PCR analysis of genes related to oxidative stress in mouse liver; B is validation of an established method for detecting LKB1 gene in mouse liver. DETAILED DESCRIPTION

[0038] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0039] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0040] A first typical embodiment of the present invention provides a recognition and displacement probe, wherein the recognition and displacement probe comprises a DNA tetrahedron and an X-shaped structure;

[0041] The DNA tetrahedron is composed of DNA single strands P1 to P4, wherein any one DNA single strand is connected to the other three strands through complementary base pairing;

[0042] The 5′ end of DNA single strand P1 is complementary to the DNA single strand Right-up, DNA single strand Left-down and DNA single strand Left-up to form an X-shaped structure;

[0043] The 5′ end of the single-stranded DNA P3 is connected to the hairpin H1;

[0044] The 5′ end of the DNA single strand P2 is connected to the hairpin H2;

[0045] The 3′ end of the DNA single strand P4 is connected to the hairpin H3;

[0046] The 3' end of hairpin H1 and the 5' end of hairpin H3 can be linked by click chemistry.

[0047] In one or more embodiments, the nucleic acid sequences of DNA single strands P1 to P4, and DNA single strand Right-up, DNA single strand Left-down and DNA single strand Left-up are shown as SEQ ID NOs. 1 to 7; the nucleic acid sequences of hairpins H1 to H3 are shown as SEQ ID NOs. 8 to 10.

[0048] In one or more embodiments, the 3′ end of the hairpin H1 is modified with an azide; the 5′ end of the hairpin H3 is modified with a cyclooctyne, and click connection between DNA chains is achieved through stress-promoted alkyne-azide cycloaddition reaction (SPAAC).

[0049] A second typical embodiment of the present invention provides a method for preparing the recognition and replacement probe according to the first aspect, comprising:

[0050] The oligonucleotides P1, P2, P3, P4, Right-up, Left-down and Left-up constituting the probe are mixed in equal molar amounts, annealed and combined, and then hairpins H1, H2 and H3 are added, and the recognition and displacement probes are obtained after incubation.

[0051] In one or more embodiments, the annealing condition is heating at 95° C. for 5 minutes and naturally cooling to room temperature.

[0052] In one or more embodiments, the incubation conditions are: incubation at 35-40° C. for 25-40 min; preferably incubation at 37° C. for 30 min.

[0053] A third typical embodiment of the present invention provides a probe composition for detecting gene expression, the probe composition comprising:

[0054] The recognition and replacement probe, primer T1, primer T2 and readout probe of the first aspect;

[0055] The read-out probe includes a Cas12a protein.

[0056] In one or more embodiments, the nucleic acid sequences of primer T1 and primer T2 are shown in SEQ ID NOs. 11-12.

[0057] A fourth typical embodiment of the present invention provides a product for detecting gene expression, comprising the probe composition described in the third aspect.

[0058] A fifth typical embodiment of the present invention provides use of the probe composition described in the third aspect in detecting gene expression.

[0059] In one or more embodiments, the gene includes the LKB1 gene.

[0060] A sixth typical embodiment of the present invention provides a method for detecting gene expression, comprising:

[0061] (1) Pre-reacting the recognition and replacement probes, primer T1 and primer T2 described in the first aspect, adding the readout probe, and then adding the standard. After incubation, the fluorescence signal is detected and a standard curve of activity concentration and fluorescence intensity is obtained based on the activity concentration and fluorescence intensity in the standard.

[0062] (2) Extracting RNA from target cells to obtain a sample to be tested; replacing the sample to be tested with the standard substance for detection to obtain a fluorescence signal, and calculating the gene expression level in the sample to be tested based on the fluorescence signal value of the sample to be tested and the standard curve.

[0063] In one or more embodiments, the final concentration of the standard is 0, 10, 50, 100, 500, 1000, 5000 and 10000 pM.

[0064] In one or more embodiments, the pre-reaction conditions are: temperature of 35-40° C., reaction time of 1-2 h; preferably, reaction time of 1.5 h at 37° C.

[0065] In one or more embodiments, the incubation conditions are: incubation at 35-40° C. for 1.5-3 h; preferably incubation at 37° C. for 2 h.

[0066] Detection mechanism: After adding primer T1, the single-stranded DNA Right-up and single-stranded DNA Left-up in the X-shaped structure of the recognition and displacement probe are displaced, and the displaced Right-up and Left-up are paired with hairpin H1, thereby releasing hairpin H1; similarly, after adding primer T2, T2 is paired with hairpin H2, thereby releasing hairpin H2, and the end of hairpin H2 is paired with hairpin H3, thereby releasing hairpin H3; at this time, the 3′ end of hairpin H1 and the 5′ end of hairpin H3 are restored to a free state, and the 3′ end of hairpin H1 is modified with azide; the 5′ end of hairpin H3 is modified with cyclooctyne, and the two realize local click reaction within the spatial confinement of the tetrahedral vertex, quickly promoting the connection of DNA fragments. The connected single-stranded DNA then binds to CRISPR RNA (crRNA), which then activates the cross-cutting activity of the Cas12a enzyme, resulting in a fluorescent signal readout.

[0067] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0068] The nucleic acid sequences used in the following examples are as follows:

[0069] P1 (SEQ ID NO.1):

[0070] ATCGTGGATAGTAGACTTGACGTTTTTTTTTTTTACATTCTAAGTCTG AAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTA;

[0071] P2 (SEQ ID NO.2):

[0072] TGAGCGATAGCGTTTTTTTTTTTTTTTTTTATCACCAGGCAGTTGACAG TGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC;

[0073] P3 (SEQ ID NO.3):

[0074] CAGTAAGCTAGACTTTTTTTTTTTTTTTCAACTGCCTGGTGATAAAACG ACACTACGTGGGAATCTACTATGGCGGCTCTTC;

[0075] P4 (SEQ ID NO.4):

[0076] TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCC TCGCATTTTTTTTTTTTTTTATGGATCGACACA;

[0077] S1(Left-up SEQ ID NO.5):

[0078] GAGCAAATGTACCTGGAAGGAGATCCAGCTGTACGTAT;

[0079] S2(Right-up SEQ ID NO.6):

[0080] ACGTCAACAGGTACATTTGCTC;

[0081] S3(Left-down SEQ ID NO.7):

[0082] GCCGCAGCAGCTGGATCTCCTTCGTCTACTATCCACGAT;

[0083] H1(SEQ ID NO.8):

[0084] GTCTAGCTTACTGATACGTACAGCTGGATCTCCTTCTTGACGTCTGACTTCCAGCTGTACGCC-azide;

[0085] H2(SEQ ID NO.9):

[0086] ACGCTATCGCTCACCATGCAGGTCCTCCAGGTAGGGTTTTCGTATGGCTCGATGACTGGAGGACCTGC;

[0087] H3(SEQ ID NO.10):

[0088] cyclooctyne-TGAGGCTCGATGACTAGATGGATAGCCTCCAGTCATCGAGCCATACGTGTGTCGATCCAT;

[0089] Target 1(T1,SEQ ID NO.11):

[0090] ACGTCAAGAAGGAGATCCAGCTGCTGCGGC;

[0091] Target 2(T2,SEQ ID NO.12):

[0092] CCCTACCTGGAGGACCTGCATGG;

[0093] crRNA:

[0094] UAAUUUCUACUAAGUGUAGAUAGCCUCAGGCGUACAGCU;

[0095] Reporter:

[0096] BHQ1-TTAATT-FAM.

[0097] Figure 1 The detection mechanism of gene expression in the present invention is as follows: after adding primer T1, the single-stranded DNA Right-up and the single-stranded DNA Left-up in the X-shaped structure of the recognition and displacement probe are displaced, and the displaced Right-up and Left-up are paired with hairpin H1, thereby releasing hairpin H1; similarly, after adding primer T2, T2 is paired with hairpin H2, thereby releasing hairpin H2, and the end of hairpin H2 is paired with hairpin H3, thereby releasing hairpin H3; at this point, the 3′ end of hairpin H1 and the 5′ end of hairpin H3 are restored to a free state, so that a local click reaction is achieved within the spatial confinement of the tetrahedron vertex, and DNA fragment connection is rapidly promoted. The connected single-stranded DNA then binds to CRISPR RNA (crRNA), thereby activating the cross-cutting activity of the Cas12a enzyme, resulting in a fluorescent signal readout.

[0098] Example 1

[0099] 1.1 P1, P2, P3, P4, S1, S2 and S3 were heated at 95°C for 5 minutes at a concentration of 1 μM in TBE buffer (1×TBE, 100 mM NaCl, 10% DMSO) and cooled naturally to form a DNA tetrahedron with an integrated X-shaped structure (abbreviated as X-shaped structure TDN). H1, H2 and H3 were then added and incubated at 37°C for 30 minutes to construct a recognition and displacement probe, hereinafter referred to as a TDN probe.

[0100] The assembly and detection process of the TDN probe was characterized by gel electrophoresis. First, a TDN with multiple sticky ends was synthesized through complementary base pairing of four single-stranded DNA (ssDNA) chains. One of the sticky ends was connected to the other three ssDNA chains to form an X-shaped DNA structure. Specifically, Figure 2As shown in A, lanes 1, 2, 3, and 4 show the process of gradual addition of four ssDNA chains (P1 to P4), respectively. The gradual upward movement of the bands in the lanes indicates the success of the step-by-step assembly. When all four ssDNA chains were present, the lowest mobility was observed, proving the successful assembly of the DNA tetrahedron (abbreviated as TDN). There were almost no nonspecific bands, indicating that the assembly efficiency was very high. In lane 8, after all four chains of the X-type structure were added, a clear band with a reduced migration speed appeared, confirming the formation of the X-type DNA structure. The top band in lane 9 further indicates that the X-type structure was successfully integrated into the TDN.

[0101] In addition, the average size of the TDNs with integrated X-shaped structures was evaluated using atomic force microscopy (AFM). Figure 2 As shown in B, its height and length are approximately 1.60 nm and 60 nm, respectively.

[0102] 1.2 Continue to add primers T1 and T2 to the TDN probe prepared in 1.1 and continue the reaction at 37°C for 1.5 hours.

[0103] exist Figure 2 In C, after adding primer T1, the X-shaped DNA structure releases the upper part of the structure through the hairpin-mediated strand displacement reaction, which hybridizes with H1 and opens its hairpin structure. The appearance of new bands in lanes 2 and 5 confirms the occurrence of strand displacement reaction. Figure 2 In D, the new bands in lanes 2 and 5 indicate that the H2 probe successfully recognized T2, unlocked the flexible region of its hairpin structure, and subsequently opened the hairpin structure of H1.

[0104] When the hairpin structures of H1 and H3 are opened, the terminal azide (N3) and cyclooctyne (DBCO) groups are exposed, allowing a cycloaddition reaction to occur between the two DNA chains. Figure 3 The upper band in lane 3 of A clearly confirms the success of click ligation. Compared with solution-based click reactions, the interfacial reaction promoted by the highly stable DNA nanostructure reduces the distance between the click reaction groups and increases the collision frequency, thereby improving the reaction efficiency. Figure 3 As shown in B, compared with free click ligation, TDN-based click ligation significantly improves the collision efficiency between click groups, leading to faster fluorescence signal recovery and greatly reducing the reaction time.

[0105] Example 2

[0106] 2.1 Performance evaluation of TDN probe:

[0107] In order to ensure the accuracy and reliability of the experimental results, a standard curve for traditional Cas12a / crRNA detection was first established. 10 μM crRNA was annealed from 95 ° C to room temperature in the Cas12a reaction buffer at a rate of 5 ° C every 7 minutes. Subsequently, it was mixed with Cas12a in a 1: 1 ratio in Cas12a reaction buffer (10mM Tris-HCl, 50mM NaCl, 10mM MgCl2, and 100μg / ml BSA), and incubated at 37 ° C for 1 hour to obtain a functional Cas12a / crRNA complex. Different concentrations of ssDNA targets (final concentrations of 0, 1, 5, 10, 50, 100, 500 and 1000pM) were added to the Cas12a reaction buffer, the concentration of Cas12a / crRNA was set to 1nM, and the concentration of the reporter probe was 500nM. After reacting for 2 hours at 37 ° C, the fluorescence intensity was measured. The results are shown in Figure 2. Figure 3 As shown in Figure 5, the fluorescence intensity showed a significant dose-dependency with the increase in ssDNA target concentration, and it was confirmed that ssDNA targets at the 1 pM level could be detected.

[0108] In order to avoid interference of ssDNA fragmentation target to the detection system before click connection occurs, it is necessary to determine a relatively appropriate target length range. We took 14nt as the starting length of the ssDNA target and divided it into two equal parts. Then, the number of bases in the part away from the recognition area was increased step by step by 2nt. First, the ssDNA fragmentation target was configured in TBE buffer, the final concentration was set to 1nM, and a pre-reaction was performed at 37°C for 1.5 hours. After the pre-reaction, the concentration of Cas12a / crRNA was adjusted to 1nM in the Cas12a reaction buffer, and the concentration of the reporter probe was maintained at 500nM. The entire reaction system continued to react at 37°C for 2 hours, and then the fluorescence intensity was measured. The results are as follows Figure 3 As shown in Figure C, by comparing the increase in fluorescence intensity of ssDNA target-activated Cas12a cutting reporter before and after click ligation, we found that 7nt+11nt is the optimal length pairing, which can significantly activate the trans-cutting efficiency of Cas12a without causing significant signal interference.

[0109] 2.2TDN probe sensitivity:

[0110] First, the TDN probe was configured in TBE buffer and the final concentration was set to 10nM. At the same time, the concentration of T2 was maintained at 10nM, and different concentrations of T1 (final concentrations of 0, 10, 50, 100, 500, 1000, 5000 and 10000pM) were added for a 1.5-hour pre-reaction at 37°C. In addition, different combinations of T1 and T2 (final concentration of 1nM) were incubated with 10nM TDN probe. After the pre-reaction, the concentration of Cas12a / crRNA was adjusted to 1nM in the Cas12a reaction buffer, while ensuring that the concentration of the reporter probe was maintained at 500nM. The entire reaction system continued to react for 2 hours at 37°C, and then the fluorescence intensity was measured.

[0111] The AND logic gate mechanism of dual-target identification was verified by quantitative analysis. The detection analysis was performed by keeping the concentration of T2 constant (10nM) and varying the concentration of T1 (ranging from 10pM to 10nM). Figure 4 As shown in AB, with the increase of T2 concentration, the fluorescence intensity at 520nm gradually increased. Similarly, through logistic curve fitting, a correlation coefficient (R2) of 0.9902 was obtained, which further verified the stability and accuracy of the method.

[0112] 2.3 Specificity of TDN probe:

[0113] Mismatch targets were planned by designing single base mismatches at the hairpin position of T1. In addition, random DNA strands were used as negative targets. Specifically, 500 nM of different T1 and T2 were mixed with 10 nM of TDN-based probes in TBE buffer for reaction, followed by CRISPR reaction and determination of fluorescence intensity.

[0114] Using the LKB1 gene affected by arsenic as a model, the probe combination was tested for detecting changes in gene expression under the influence of environmental factors. The key to the activation of Cas12a cross-cutting activity lies in the deconstruction of the H1 and H3 hairpin structures and their subsequent click reaction. The conformational changes of the H1 and H3 hairpins are guided by the X-type DNA and the H2 hairpin, respectively. When the LKB1 gene is recognized, the displacement of the X-type DNA and the opening of the H2 hairpin occur, resulting in conformational changes in the H1 and H3 hairpins, which ultimately activate the cross-cutting activity of Cas12a. Figure 4 As shown in CD, only when both sites are present will a significant fluorescence signal response be generated. In contrast, when either site is missing, the fluorescence signal is significantly reduced and does not reach a detectable level, thereby minimizing false positive results and greatly improving the accuracy of the method. Figure 4The results shown in E indicate that the TDN click ligation system has a good selective response to LKB1. Due to the high specificity of the X-shaped DNA probe, even if there is only one nucleotide variation or mismatch in the target sequence, it is impossible to accurately match the sticky end, thereby preventing the chain displacement reaction. This feature significantly improves gene selectivity and enables accurate distinction of single base mismatches. In addition, multiple parallel samples were prepared and measured under the same experimental conditions, and a relative standard deviation (RSD) of only 1.24% was obtained, showing the high repeatability and reliability of the experiment. In addition, after forming a DNA tetrahedral structure, it can effectively resist nuclease degradation in biological media. When incubated with untreated calf serum, the structure exhibited high stability and a long decay time ( Figure 5 A and B), highlighting the potential application of this method in real sample testing.

[0115] Experimental Example 1

[0116] Detection of LKB1 gene expression level

[0117] A mouse liver injury model was established by freely drinking 10 mg / L NaAsO2 solution, and used for subsequent sample analysis. Arsenic disrupts the balance between oxidation and antioxidant mechanisms in the body, leading to the accumulation of free radicals in cells and triggering oxidative stress. Analysis of gene expression related to oxidative stress and immune inflammation in mice revealed that arsenic exposure increased the expression of Cat, Sod1, and IL-18 in the liver ( Figure 6 A), indicating that arsenic disturbs the balance of the antioxidant system and leads to liver damage. Consistent with previous studies, we observed elevated expression of genes related to cellular metabolism and energy homeostasis, such as LKB1, AMPK, and its downstream target ACC ( Figure 6 A). This may be due to the activation of the LKB1 / AMPK pathway by oxidative stress caused by NaAsO2. Inspired by these results, we applied a probe combination for detecting gene expression to detect the expression of the LKB1 gene. The results are shown in Figure 6 As shown in Figure B, the experimental results are intuitively displayed and are consistent with the results of RT-qPCR, indicating that our method can reliably detect the expression level of the LKB1 gene. In addition, compared with RT-qPCR, our method has significant advantages in distinguishing differences in gene expression, which is mainly due to the high sensitivity of the Cas12a signal readout system. The system is able to detect small changes in gene expression, making it possible to identify potential biomarkers in complex samples. These experimental results verify the applicability and effectiveness of the established method. This method can not only more accurately identify and confirm the target gene sequence and ensure the accuracy of the test results, but also significantly improve the sensitivity of gene detection and provide more accurate data. This method is expected to provide support for future gene function research and disease diagnosis.

[0118] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A recognition and displacement probe, characterized in that The recognition and displacement probe comprises a DNA tetrahedron and an X-shaped structure; The DNA tetrahedron is composed of DNA single strands P1 to P4, wherein any one DNA single strand is connected to the other three strands through complementary base pairing; The 5′ end of DNA single strand P1 is complementary to the DNA single strand Right-up, DNA single strand Left-down and DNA single strand Left-up in pairs to form an X-shaped structure; The 5′ end of the DNA single strand P3 is connected to the hairpin H1; The 5′ end of the DNA single strand P2 is connected to the hairpin H2; The 3′ end of the single-stranded DNA P4 is connected to the hairpin H3; The 3' end of hairpin H1 and the 5' end of hairpin H3 can be linked by click chemistry.

2. The recognition and displacement probe according to claim 1, characterized in that The nucleic acid sequences of DNA single strands P1 to P4, and DNA single strand Right-up, DNA single strand Left-down, and DNA single strand Left-up are shown in SEQ ID NOs. 1 to 7; the nucleic acid sequences of hairpins H1 to H3 are shown in SEQ ID NOs. 8 to 10; Alternatively, the 3′ end of the hairpin H1 is modified with an azide; and the 5′ end of the hairpin H3 is modified with a cyclooctyne.

3. The method for preparing the recognition and displacement probe according to claim 1 or 2, characterized in that: include: The oligonucleotides P1, P2, P3, P4, Right-up, Left-down and Left-up constituting the probe are mixed in equal molar amounts, annealed and combined, and then hairpins H1, H2 and H3 are added, and the recognition and displacement probes are obtained after incubation.

4. The preparation method according to claim 3, characterized in that: The annealing conditions were heating at 95 °C for 5 min and cooling naturally to room temperature; Alternatively, the incubation conditions are: incubation at 35-40°C for 25-40 min; preferably incubation at 37°C for 30 min.

5. A probe composition for detecting gene expression, characterized in that: The probe composition comprises: The recognition and replacement probe, primer T1, primer T2 and readout probe according to claim 1 or 2; The read-out probe includes a Cas12a protein.

6. The probe composition according to claim 5, characterized in that The nucleic acid sequences of primer T1 and primer T2 are shown in SEQ ID NOs. 11-12.

7. A product for detecting gene expression, characterized in that: Comprising the probe composition according to claim 5 or 6.

8. Use of the probe composition according to claim 5 or 6 in detecting gene expression.

9. A method for detecting gene expression, characterized in that: include: (1) Pre-reacting the recognition and replacement probes, primer T1 and primer T2 described in claim 1 or 2, adding the readout probe, and then adding the standard. After incubation, the fluorescence signal is detected and a standard curve of activity concentration and fluorescence intensity is obtained based on the activity concentration and fluorescence intensity in the standard. (2) Extracting RNA from target cells to obtain a sample to be tested; replacing the sample to be tested with the standard substance for detection to obtain a fluorescence signal, and calculating the gene expression level in the sample to be tested based on the fluorescence signal value of the sample to be tested and the standard curve.

10. The method according to claim 9, characterized in that The final concentrations of the standards were 0, 10, 50, 100, 500, 1000, 5000 and 10000 pM. Alternatively, the pre-reaction conditions are: a temperature of 35 to 40° C. for 1 to 2 h; preferably, a temperature of 37° C. for 1.5 h; Alternatively, the incubation conditions are: incubation at 35-40° C. for 1.5-3 h; preferably incubation at 37° C. for 2 h.

Images