Probe for nucleic acid detection and application thereof

Abstract

The invention relates to the technical field of nucleic acid detection, in particular to a probe for nucleic acid detection and application thereof. The nucleotide sequence of the probe for nucleic acid detection sequentially comprises an induced ring opening sequence, an upstream ring formation sequence, a ring sequence, a downstream ring formation sequence and an anchoring extension sequence from the 5'end to the 3 'end; wherein the upstream cyclization sequence and the downstream cyclization sequence are in reverse complementary pairing, the 5'end of the nucleotide sequence of the probe is connected with a first quenching group, the 3 'end of the nucleotide sequence of the probe is connected with a second quenching group, and the upstream of the anchoring extension sequence is connected with a fluorophore. According to the probe provided by the invention, the background fluorescence value can be remarkably reduced, and the signal-to-noise ratio is improved, so that the detection sensitivity of a fluorescence signal is remarkably improved. Therefore, the probe provided by the invention can be well applied to nucleic acid detection and can be used for preparing nucleic acid detection related products such as nucleic acid detection kits.

Description

Technical Field

[0001] The present application belongs to the technical field of nucleic acid detection, and in particular, relates to a probe for nucleic acid detection and its application. Background Art

[0002] Real-time fluorescent polymerase chain reaction (Real-time PCR) is a commonly used detection method in the field of nucleic acid detection. It is easy to operate and widely used. Taqman probe is a fluorescent probe widely used in real-time quantitative PCR. Its principle is to use the 5'-3' exonuclease activity of Taq DNA polymerase to hydrolyze the double-labeled probe during PCR amplification, releasing the reporter group to generate a fluorescent signal. However, it has the following problems: the fluorescent group of the Taqman probe is at a certain distance from the quenching group (generally the total length from the 5' end to the 3' end of the probe), which easily leads to a high background fluorescence value of the probe, resulting in a low signal-to-background ratio, thereby reducing the sensitivity of multiple real-time PCR detection.

[0003] In order to improve the detection level of fluorescent real-time PCR signals, Sanjay Tyagi and Fred Russell Kramer pioneered the concept of molecular beacon in 1996. The basic principle is to design two complementary paired regions at the 5' and 3' ends of the Taqman probe to form a hairpin structure. Through this special secondary structure, the probe presents a hairpin structure when it is not bound to the target, and the fluorescence is quenched, thereby reducing the background fluorescence value. However, the existence of the secondary structure makes it more difficult for the molecular beacon probe to bind to the template, especially when the melting temperature (Tm) of the secondary structure is greater than the PCR annealing temperature; at the same time, the design requirements of molecular beacons are relatively high, and the hairpin structure, probe sequence, fluorescent group and quencher selection need to be carefully designed, which increases the difficulty of use.

[0004] Multiplex detection is the development direction of nucleic acid detection, and PCR amplification product probe melting curve analysis is an important technical means to achieve multiplex detection, which requires probes that can realize the amplification curve analysis of fluorescent real-time PCR and the melting curve analysis of probes. In 2022, Li Qingge's research group at Xiamen University proposed a design scheme of mediator probes combined with molecular beacon structure reporter probes, which can successively perform fluorescent real-time PCR amplification curve analysis and post-amplification product probe melting curve analysis - melting array technology. Although this method can improve the detection throughput, stability and specificity of a single PCR reaction, it cannot significantly reduce the amplification background signal of the fluorescent real-time PCR reaction, and the signal-to-noise ratio needs to be further improved. Summary of the invention

[0005] The purpose of the present application is to provide a probe for nucleic acid detection and its application, aiming to solve the technical problem of how to provide a fluorescent reporter probe with low background fluorescence value, high signal-to-noise ratio and high sensitivity.

[0006] In order to achieve the above application purpose, the technical solution adopted in this application is as follows: In the first aspect, the present application provides a probe for nucleic acid detection, wherein the nucleotide sequence of the probe includes, from the 5' end to the 3' end, an induced ring-opening sequence, an upstream ring-forming sequence, a ring sequence, a downstream ring-forming sequence and an anchor extension sequence; wherein the upstream ring-forming sequence and the downstream ring-forming sequence are reverse complementary pairs, the 5' end of the nucleotide sequence of the probe is connected to a first quenching group, the 3' end of the nucleotide sequence of the probe is connected to a second quenching group, and the upstream of the anchor extension sequence is connected to a fluorescent group.

[0007] In a second aspect, the present application provides an application, namely, the application of the above-mentioned probe provided by the present application in nucleic acid detection.

[0008] In a third aspect, the present application provides a nucleic acid detection kit, comprising the above-mentioned probe provided in the present application, and an intermediate probe.

[0009] The nucleotide sequence of the probe provided in the present application includes an induced ring-opening sequence, an upstream ring-forming sequence, a ring sequence, a downstream ring-forming sequence and an anchor extension sequence from the 5' end to the 3' end; based on the hairpin structure formed by the upstream ring-forming sequence, the ring sequence and the downstream ring-forming sequence of the probe of the present application, and combined with the fluorescent group and the quenching group modified at a specific position, such a probe can be used as a fluorescent reporter probe, and when used in combination with an intermediate probe (i.e., an oligonucleotide sequence that can bind to the target sequence and has no fluorescent modification) for real-time fluorescent PCR, the background fluorescence value can be significantly reduced compared to the commonly used Taqman probe and molecular beacon probe, and the signal-to-noise ratio is improved, thereby significantly improving the detection sensitivity of the fluorescent signal. Therefore, the probe provided in the present application can be well used in nucleic acid detection, and nucleic acid detection-related products such as nucleic acid detection kits can be prepared. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0011] Figure 1 is a schematic diagram of the structure of the probe provided in the embodiment of the present application; Figure 21 is a feasibility analysis result diagram of the probe provided in the embodiment of the present application for reducing background fluorescence value and improving signal-to-noise ratio; A is a comparison of fluorescence PCR amplification curves of the experimental group using KEY probe and control group 1 and control group 2 using commonly used Taqman probes and control group 3, control group 4 and control group 5 using molecular beacon probes with weak, medium and strong hairpin structures; B is a significant difference analysis of background fluorescence value between the experimental group and the control group; C is a significant difference analysis of signal-to-noise ratio between the experimental group and the control group; and D is a comparison of Ct values ​​between the experimental group and the control group at different template concentration levels; Figure 3 It is a feasibility analysis result diagram of the probe provided in the embodiment of the present application for probe melting curve analysis; Figure 4 This is a graph showing the strength test results of different hairpin structures of the probes provided in the examples of the present application; Figure 5 This is a graph showing the results of investigating different induced open-loop sequence lengths of the probes provided in the examples of the present application; Figure 6 This is a diagram showing the signal inspection results of the probe provided in the examples of the present application in different fluorescence channels. DETAILED DESCRIPTION

[0012] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0013] In this application, the term "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0014] In this application, "at least one" means one or more, "more than one" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single or plural items.

[0015] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution, some or all of the steps can be executed in parallel or sequentially, and the execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0016] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments, and are not intended to limit the present application. The singular forms "a", "said" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms, unless the context clearly indicates other meanings.

[0017] The weight of the relevant components mentioned in the embodiment description of the present application can not only refer to the specific content of each component, but also indicate the proportional relationship between the weights of the components. Therefore, as long as the content of the relevant components is proportionally enlarged or reduced according to the embodiment description of the present application, it is within the scope disclosed in the embodiment description of the present application. Specifically, the mass described in the embodiment description of the present application can be a mass unit known in the chemical industry such as µg, mg, g, kg, etc.

[0018] The terms "first" and "second" are used only for descriptive purposes to distinguish objects such as substances from each other, and should not be understood as indicating or implying relative importance or implicitly indicating the number of technical features indicated. For example, without departing from the scope of the embodiments of the present application, the first XX may also be referred to as the second XX, and similarly, the second XX may also be referred to as the first XX. Thus, features defined as "first" and "second" may explicitly or implicitly include one or more of the features.

[0019] In order to meet the high-sensitivity detection requirements of low-abundance and low-concentration nucleic acid samples, and to be compatible with amplification curve analysis and probe melting curve analysis, real-time fluorescence PCR urgently needs to introduce fluorescent probes with lower background fluorescence values, high signal-to-noise ratios, and high sensitivity. In view of the shortcomings of the prior art, the present application embodiment designs a probe with ultra-low fluorescence background values ​​and the ability to improve the sensitivity of the detection system. The specific technical solution is as follows.

[0020] In the first aspect, the present invention provides a probe for nucleic acid detection, Figure 1 As shown. The probe provided in the embodiment of the present application includes a long nucleotide sequence. Specifically, the nucleotide sequence of the probe includes, from the 5' end to the 3' end: ① an induced ring-opening sequence, which functions to promote the opening of the probe's own hairpin structure when the enzyme cleavage sequence extends to this position; ② an upstream ring-forming sequence, which functions to complementarily pair with the downstream ring-forming sequence; ③ a ring sequence, which forms a hairpin structure with the complementary paired upstream and downstream ring-forming sequences; ④ a downstream ring-forming sequence, which functions to complementarily pair with the upstream ring-forming sequence; ⑤ an anchor extension sequence, which is used to mediate the anchoring and extension of the enzyme cleavage sequence.

[0021] In the probe structure provided above, the upstream looping sequence and the downstream looping sequence are reversely complementary paired, so that a hairpin structure can be formed with the loop sequence located between the two. At the same time, the 5' end of the nucleotide sequence of the probe, i.e., the 5' end of the induced loop-opening sequence, is connected with a quenching group, and the 5' end quenching group is the first quenching group. The 3' end of the nucleotide sequence of the probe, i.e., the 3' end of the anchor extension sequence, is connected with a quenching group, and the 3' end quenching group is the second quenching group, and the upstream of the anchor extension sequence is connected with a fluorescent group. The upstream of the anchor extension sequence means that the anchor extension sequence is divided into two sections according to the number of bases, the one close to the 5' end is the upstream, and the one close to the 3' end is the downstream, and the fluorescent group is upstream of the anchor extension sequence close to the 5' end.

[0022] In the probe provided in the embodiment of the present application, the double-end modified quenching groups (i.e., the first quenching group at the 5' end and the second quenching group at the 3' end), the middle modified fluorescent group, combined with the hairpin structure can shorten the distance between the first quenching group and the middle fluorescent group, and can form an ultra-low background fluorescence value probe when used; the induced opening sequence designed at the 5' end of the probe helps the intermediate enzyme cleavage sequence to extend on the probe, open the hairpin structure, and improve the fluorescence signal level. In this way, when performing real-time fluorescence PCR, the background fluorescence value can be significantly reduced, and the signal-to-noise ratio is improved, thereby significantly improving the detection sensitivity of the fluorescence signal.

[0023] In some embodiments, the loop sequence of the probe is provided with a spacer modification. By introducing a spacer modification (Spacer) into the loop sequence of the probe, the extension of the intermediate enzyme cleavage sequence on the probe can be further terminated at a specific point, so that the extension product forms a hairpin structure and does not bind to the reporter probe, thereby increasing the intensity of the fluorescent signal and achieving a stable probe melting curve analysis.

[0024] For example, the spacer modification includes one or more Spacer 18, Spacer 9, Spacer C3 or Spacer C6 modification. iSp18 modification is used, iSp18 is the abbreviation of intermediate modification Spacer 18, and its full name is hexaethylene glycol phosphoramide (spacer phosphoramide 18). Through one or more of the above spacer modifications, the extension of the intermediate enzyme cleavage sequence on the reporter probe can be terminated so as to obtain a stable melting temperature (Tm value) during the probe melting curve analysis. The spacer modification can be at any specific position on the loop sequence to achieve the above effect.

[0025] In some embodiments, the anchor extension sequence of the probe may also be provided with iXNA modification, which is an intermediate modification of the probe, wherein an artificially synthesized nucleic acid analog, Xeno nucleic acid (XNA), is modified on the base to enhance the binding force of the probe.

[0026] In some embodiments, the induced ring-opening sequence has a length of 1-20 bases, for example, 1 base, 4 bases, 6 bases, 8 bases, 9 bases, 10 bases, 12 bases, 15 bases, 18 bases, etc.; the upstream ring-forming sequence and the downstream ring-forming sequence both have a length of 4-20 bases, for example, 4 bases, 6 bases, 8 bases, 10 bases, 12 bases, 14 bases, 16 bases, 18 bases, etc.; the ring sequence has a length of 3-10 bases, for example, 3 bases, 5 bases, 6 bases, 8 bases, 10 bases, etc.; the anchor extension sequence has a length of 30-45 bases, and the distance between the fluorescent group and the second quenching group is at least 25 bases. Specifically, the above base numbers are some optional embodiments, and the lengths of the induced loop sequence, upstream loop sequence, loop sequence, downstream loop sequence, and anchor extension sequence can be selected according to actual needs. The lengths of the nucleotide sequences mentioned in the embodiments of this application are counted in base numbers.

[0027] In some embodiments, the nucleotide sequence of the probe has a length of 50-70 bases, that is, the total length of the induced loop-opening sequence, the upstream loop-forming sequence, the loop sequence, the downstream loop-forming sequence, and the anchor extension sequence can be 50-70 bases.

[0028] In some embodiments, the embodiments of the present application analyze the effect of the length of the loop sequence (upstream loop sequence / downstream loop sequence) on the amplification curve and the melting curve signal. The loop sequence length range examined is 4 base pairs to 8 base pairs. As the loop sequence length increases, the fluorescence signal values ​​of the amplification curve and the melting curve are increased. Based on this, the probe loop sequence length is greater than or equal to 4 base pairs, for example, 6-10 base pairs. By adjusting and optimizing the loop sequence length, a better detection effect can be obtained.

[0029] In some embodiments, the present application analyzes the effect of the length of the induced open-loop sequence on the amplification curve and the melting curve signal. The length of the induced open-loop sequence examined ranges from 0 bases to 10 bases. It is found that as the length of the induced open-loop sequence increases, the fluorescence signal values ​​of the amplification curve and the melting curve both increase, but as the length increases to 10 bases, non-specific signals appear in the negative control. Based on this, the length of the probe induced open-loop sequence can be selected from 2 to 9 bases.

[0030] In some embodiments, in the probe of the present application, the induced ring-opening sequence has a length of 2-9 bases, the upstream ring-forming sequence and the downstream ring-forming sequence both have a length of 6-10 bases, the ring sequence has a length of 3-10 bases, the anchor extension sequence has a length of 40-45 bases, and the distance between the fluorescent group and the second quenching group is at least 38 bases.

[0031] In some embodiments, the melting curve Tm value of the probe is 50° C.-90° C. The probes of the embodiments of the present application can be used not only for fluorescence real-time PCR amplification curve analysis, but also for probe melting curve analysis, and can realize multi-target nucleic acid detection through Tm value.

[0032] Specifically, the examples of the present application analyze the amplification curves and melting curves of the probes of the present application in different fluorescence channels, demonstrating the high fluorescence signal detection capability in multiple fluorescence channels and the excellent application potential in the field of multiple detection. In some embodiments, the melting peak Tm value ranges from 58.5°C to 83.5°C, and the temperature span ranges from 25°C. The Tm value can be further reduced or enhanced by further adjusting the position of the meson, so the Tm value of the probe melting curve is reasonably designed to be 50°C to 90°C, and the temperature span range is 40°C.

[0033] In some embodiments, the fluorescent groups in the probe include but are not limited to at least one of Atto425 (450 nm), FAM (510 nm), HEX (565 nm), Cy5 (665 nm), ROX (620 nm) and Quasar705 (705 nm). The probes of the embodiments of the present application can have high fluorescence signal detection capabilities in multiple fluorescence channels and excellent application capabilities in the field of multiple detection by selecting and matching different fluorescent groups.

[0034] In some embodiments, there are multiple choices for the types of the first quencher group and the second quencher group; for example, the first quencher group includes at least one of TAMRA, Dabcyl, BHQ1 and BHQ2; the second quencher group includes at least one of TAMRA, Dabcyl, BHQ1 and BHQ2. The first quencher group and the second quencher group may be the same or different, and the same quencher group is selected in the embodiment of the present application. In the embodiment of the present application, the double quencher group can enhance the fluorescence quenching efficiency. The ring structure of the probe makes the first quencher group and the fluorescent group in close contact, greatly reducing the fluorescence background.

[0035] In some embodiments, the nucleotide sequence of the probe includes at least one of the sequences shown in SEQ ID No. 1-12.

[0036] SEQ ID No.1 (60 bases in length): TATTGCCGGTTTTCCGGCATATAAACAGGTCAGAGTGAGGAGACAGCACCGTCCAGCGTC. SEQ ID No.2 (60 bases in length): TATTGCCGGTTTTCCGGCATATAAGAAGTGTGAGAGGTGTGATGAGTCAGGAGCTGGAGC.

[0037] SEQ ID No.3 (62 bases in length): TATTGCCCGGTTTTCCGGGCATATAAACAGGTCAGAGTGAGGAGACAGCACCGTCCAGCGTC.

[0038] SEQ ID No.4 (64 bases in length): TATTGCCGCGGTTTTCCGCGGCATATAAACAGGTCAGAGTGAGGAGACAGCACCGTCCAGCGTC.

[0039] SEQ ID No.5 (58 bases in length): TATTCCGGTTTTCCGGATATAAACAGGTCAGAGTGAGGAGACAGCACCGTCCAGCGTC.

[0040] SEQ ID No.6 (54 bases in length): AGCCGGTTTTCCGGCTAAGAAGTGTGAGAGGTGTGATGAGTCAGGAGCTGGAGC.

[0041] SEQ ID No.7 (56 bases in length): TTGCCGGTTTTCCGGCATAAGAAGTGTGAGAGGTGTGATGAGTCAGGAGCTGGAGC.

[0042] SEQ ID No.8 (58 bases in length): TATGCCGGTTTTCCGGCAATAAGAAGTGTGAGAGGTGTGATGAGTCAGGAGCTGGAGC.

[0043] SEQ ID No.9 (68 bases in length): TTTTTTTTATTGCCGGTTTCCGGCATATTAAGAAGTGTGAGAGGTGTGATGAGTCAGGAGCTGGAGC.

[0044] SEQ ID No.10 (62 bases in length): TATTGCCGCGGTTTTCCGCGGCATATACTGGGCAGGGACTCGGCTCGTCTCGGAGGGCAGCA.

[0045] SEQ ID No.11 (64 bases in length): TATTGCCGCGGTTTTCCGCGGCATATACGCACGACCTCAGGAGACGACGGCAGGGTGGACGGCA.

[0046] SEQ ID No.12 (64 bases in length): TATTGCCGCGGTTTTCCGCGGCATATGGAGGGACGGTCGTGGCAGGAGGAGCAGCTCAGTCGCA.

[0047] In the present embodiment, the 5' end of the nucleotide sequence of any one of SEQ ID No. 1-12 is modified with the first quenching group, the 3' end is modified with the second quenching group, the upstream fluorescent group near the 5' end of the anchor extension sequence is modified, and the spacer modification is introduced into the loop sequence. The probe formed in this way can significantly reduce the background fluorescence value, improve the detection signal-to-noise ratio and sensitivity, and can also be used for the probe melting curve analysis after the PCR amplification reaction.

[0048] In some embodiments, through feasibility analysis of the probe to reduce background fluorescence values ​​and improve the signal-to-noise ratio, the results showed that the background fluorescence value can be reduced to 2.2%-3.5% of the commonly used Taqman probe and molecular beacon solutions, the signal-to-noise ratio is increased to 3.6-4.8 times, and the cycle threshold (Ct value) is reduced by 3.2 to 4.7 Ct values, significantly improving the detection sensitivity of the fluorescence signal.

[0049] In the second aspect, the present application provides an application, specifically, the application of the probe provided in the first aspect of the present application in nucleic acid detection.

[0050] The probes based on the embodiments of the present application can significantly reduce the background fluorescence value, and the signal-to-noise ratio is improved, thereby significantly improving the detection sensitivity of the fluorescent signal. Therefore, the probes provided in the embodiments of the present application can be well used in nucleic acid detection, and nucleic acid detection related products such as nucleic acid detection kits can be prepared.

[0051] In a third aspect, the present application also provides a nucleic acid detection kit. Specifically, the nucleic acid detection kit provided by the present application includes the probe provided in the first aspect of the present application and an intermediate probe.

[0052] The nucleic acid detection kit of the embodiment of the present application contains the probe provided in the first aspect of the embodiment of the present application, and the nucleotide sequence of the probe includes an induced ring-opening sequence, an upstream ring-forming sequence, a ring sequence, a downstream ring-forming sequence and an anchor extension sequence from the 5' end to the 3' end; based on the combination of the probe and the intermediate probe, the nucleic acid detection kit of the embodiment of the present application can significantly reduce the background fluorescence value when performing nucleic acid detection, and the signal-to-noise ratio is improved, thereby significantly improving the detection sensitivity of the fluorescence signal.

[0053] In some embodiments, the nucleic acid detection kit contains the probe provided in the first aspect of the embodiment of the present application, and may also contain an intermediate probe. The intermediate probe is an oligonucleotide sequence that can bind to the target sequence and is not fluorescently modified (for example, one or more of SEQ ID No.13, SEQ ID No.19-39, etc.). In addition, it may also contain various reagents and polymerases required for PCR. The nucleic acid detection kit of the embodiment of the present application can be used for multiplex fluorescent real-time PCR. In the embodiment of the present application, when conducting relevant experimental verification, the KEY probe mentioned is the probe specifically designed in the embodiment of the present application.

[0054] The following describes the invention in conjunction with specific embodiments.

[0055] Example 1 Feasibility verification of KEY probe to reduce background fluorescence value and improve signal-to-noise ratio Taqman probes and molecular beacon probes commonly used in nucleic acid detection were selected as controls to investigate whether KEY probes can be used to reduce the background fluorescence value of the fluorescent real-time PCR detection system and improve the signal-to-noise ratio.

[0056] The characteristic gene stp sequence of Escherichia coli enterotoxigenic Escherichia coli was selected as the detection object. Each 25μL PCR reaction system includes: 1×PCR buffer (10 mM Tris-HCl (pH 8.0) and 50 mM KCl), 3.0 mM MgCl 2, 0.2 mM dNTPs, 2U TaqHS enzyme (TaKaRa, Japan), target gene upstream primer (SEQ ID No.40: 5'-GTTTTATCCTTTTCTTGTTCGT-3', 400nM) and downstream primer (SEQ ID No.41: 5'-CATCTGCCACTGAAATACA-3', 400nM), 5μL template is a gradient dilution of nucleic acid extracted from enterotoxigenic Escherichia coli strains carrying stp virulence gene, the template copy number added is 50000, 10000, 2000, 400, 80, 16 copies / reaction, two duplicate wells were made for each experiment, and two no-template controls (template is 5 μL of nucleic acid dilution solution) were made at the same time. The PCR reaction program was: 50℃ for 2min, 95℃ for 30s, then 95℃ for 10s and 60℃ for 1min for 40 cycles, and fluorescence was collected at 60℃. The experimental instrument was SLAN 96S real-time PCR instrument (Hongshi Medical Technology Co., Ltd., Shanghai), and the primers and probes were synthesized by Shanghai Bioengineering Co., Ltd.

[0057] The PCR buffer, magnesium ion concentration, dNTPs concentration, primer dosage and Taq enzyme dosage used in the nucleic acid detection system of the experimental group and the control group were the same. The difference was that the probe design scheme was different. The experimental group used a combination of an intermediate probe (nucleotide sequence as shown in SEQ ID: NO.13) and a KEY probe (nucleotide sequence as shown in SEQ ID: NO.1). The specific settings of the control group were as follows: the probe of the control group 1 used a Taqman probe with a predicted Tm value of 68°C (conventional Taqman probe design scheme, nucleotide sequence as shown in SEQ ID: NO.14); the probe of the control group 2 used a Taqman probe with a predicted Tm value of 62°C that was shortened by 4 bases at the 3' end based on the control group 1 (nucleotide sequence as shown in SEQ ID: NO.15). Control group 3 used a molecular beacon probe with a weak hairpin structure (nucleotide sequence as shown in SEQ ID: NO.16), and the secondary structure predicted melting Tm value was 55°C (nucleotide sequence as shown in SEQ ID: NO.17); control group 4 used a molecular beacon probe with a normal strength hairpin structure (nucleotide sequence as shown in SEQ ID: NO.18), and the secondary structure predicted melting Tm value was 60°C; control group 5 used a molecular beacon probe with a strong hairpin structure, and the secondary structure predicted melting Tm value was 65°C. The above parameters are based on the prediction of the probe Tm value by online software (OligoAnalyzer™, https: / / sg.idtdna.com / pages / tools / oligoanalyzer), and the molecular beacon probe secondary structure strength (melting Tm value) was predicted by online software (DNA Folding form, http: / / www. unafold.org / DNA_form.php). The amount of probe bound to the template chain in the control experimental group and the control group was the same, and the differences in background fluorescence value and signal-to-noise ratio of different technical schemes were compared. The probes used in the experimental group and the control group and the corresponding concentrations are shown in Table 1.

[0058] Table 1 Sequences of probes in the present example and control group

[0059] Note: The bases in bold are the same probe binding region that matches the template.

[0060] The experimental results are as follows Figure 2 As shown, the results show that the amplification curve signal of the experimental group using the KEY probe of the embodiment of the present application is better than that of the control group using the Taqman probe and the molecular beacon probe (see Figure 2The fluorescence background value of the experimental group was only 2.16%-2.88% of the control group using Taqman probe, and only 2.21%-3.52% of the control group using molecular beacon, which was significantly better than Taqman probe and molecular beacon probe (see Figure 2 The signal-to-noise ratio of the experimental group was 4.27-4.28 times that of the control group using Taqman probes and 3.63-4.75 times that of the control group using molecular beacons, which was significantly better than that of Taqman probes and molecular beacon probes (see Figure 2 The cycle threshold values ​​(Ct values) of different template concentrations in the experimental group were 3.55-4.07 Ct values ​​lower than those in the control group using the Taqman probe, and 3.19-4.70 Ct values ​​lower than those in the control group using the molecular beacon, which was significantly better than the Taqman probe and the molecular beacon probe ( Figure 2 In summary, the nucleic acid detection system using the KEY probe in the embodiment of the present application has a low background fluorescence value and a high signal-to-noise ratio, and can more sensitively detect changes in the fluorescence signal.

[0061] Example 2 Minimum detection limit and specificity verification of KEY probe 1) Taqman probes and molecular beacon probes commonly used in nucleic acid detection were selected as controls to investigate whether KEY probes can be used to reduce the minimum detection limit (LOD) of the nucleic acid detection system.

[0062] The characteristic gene stp sequence of Escherichia coli enterotoxigenic Escherichia coli was selected as the detection object. Each 25 μL PCR reaction system included 1× PCR buffer (10 mM Tris-HCl (pH 8.0) and 50 mM KCl), 3.0 mM MgCl 2, 0.2 mM dNTPs, 2U TaqHS enzyme (TaKaRa, Japan), upstream primer of target gene (sequence 5'-GTTTTATCCTTTTCTTGTTCGT-3', 400nM) and downstream primer (sequence 5'-CATCTGCCACTGAAATACA-3', 400nM), the probes and corresponding concentrations of the experimental and control groups are shown in Table 1. 5μL template is a gradient dilution of nucleic acid extracted from enterotoxigenic Escherichia coli strains carrying stp virulence gene, and the number of template copies added is 10, 5, 3, 2, and 1 copies / reaction, respectively, and 20 parallel wells are made for each. The PCR reaction program is: 50℃ for 2min, 95℃ for 30s, then 95℃ for 10s and 60℃ for 1min for a total of 40 cycles, and fluorescence is collected at 60℃. The experimental instrument is SLAN 96S real-time PCR instrument (Hongshi Medical Technology Co., Ltd., Shanghai). The lowest concentration gradient with a positive detection rate ≥95% is defined as the LOD of the nucleic acid detection system (at least 19 of 20 parallel wells have positive signals).

[0063] The detection results are shown in Table 2. The minimum detection limits of the Taqman probe scheme and the molecular beacon scheme are both 5 copies / reaction, while the minimum detection limit of the design scheme based on the KEY probe in the embodiment of the present application can reach 2 copies / reaction, which significantly reduces the minimum detection limit and is conducive to the detection of low-abundance and low-concentration nucleic acid samples.

[0064] Table 2 Investigation of the minimum detection limits of nucleic acid detection systems using different probes

[0065] 2) The characteristic gene stp sequence of Escherichia coli enterotoxigenic Escherichia coli was selected as the detection object to examine the specificity of the probe. Each 25 μL PCR reaction system includes 1× PCR buffer (10 mM Tris-HCl (pH 8.0) and 50 mM KCl), 3.0 mM MgCl 2 , 0.2 mM dNTPs, 2U TaqHS enzyme (TaKaRa, Japan), upstream primer of target gene (sequence 5'-GTTTTATCCTTTTCTTGTTCGT-3', 400nM) and downstream primer (sequence 5'-CATCTGCCACTGAAATACA-3', 400nM) and 5 μL template. The PCR reaction program was: 50℃ for 2min, 95℃ for 30s, then 95℃ for 10s and 60℃ for 1min for 40 cycles, and fluorescence was collected at 60℃. The experimental instrument was SLAN 96S real-time PCR instrument (Hongshi Medical Technology Co., Ltd., Shanghai).

[0066] For specificity investigation, 10 strains of enterotoxigenic Escherichia coli (ETEC) containing stp virulence gene and 30 strains of Escherichia coli without stp virulence gene were selected as nucleic acid templates, including 5 strains of enteropathogenic Escherichia coli (EPEC), 5 strains of enteroaggregative Escherichia coli (EAEC), 5 strains of enteroinvasive Escherichia coli (EIEC), 5 strains of Shiga toxin-producing Escherichia coli (STEC), 10 strains of non-diarrhea Escherichia coli (Non-DEC), and 5 strains of Salmonella and 5 strains of Vibrio parahaemolyticus that are not Escherichia coli. The experimental results are shown in Table 3, which show that the nucleic acid detection results of the 10 ETEC strains containing stp virulence gene are all positive for stp virulence gene, while the nucleic acid detection results of the other 40 strains without stp virulence gene are all negative for stp virulence gene, and no non-specific signal is generated, which proves that the KEY probe nucleic acid detection system has strong specificity.

[0067] Table 3 Investigation of the specificity of the probe nucleic acid detection system in this application

[0068] Example 3 Feasibility verification of KEY probe application in probe melting curve analysis The characteristic sequence of stp gene of enterotoxigenic Escherichia coli was selected as the detection object to investigate whether the KEY probe can be used for probe melting curve analysis (MCA).

[0069] In this example, six intermediate probes with different Tm values ​​were designed based on the KEY probe with the nucleotide sequence shown in SEQ ID: NO.2 (nucleotide sequences shown in SEQ ID: NO.19-24). Each 25 μL PCR reaction system includes 1×PCR buffer (10 mM Tris-HCl (pH 8.0) and 50 mM KCl), 3.0 mM MgCl 2, 0.2 mM dNTPs, 2UTaqHS enzyme (TaKaRa, Japan), upstream primer of target gene (sequence 5'-GTTTTATCCTTTTCTTGTTCGT-3', 400 nM) and downstream primer (sequence 5'-CATCTGCCACTGAAATACA-3', 400 nM), the designed intermediate probes and KEY probes with different melting temperatures and their corresponding concentrations are shown in Table 4. The number of template copies added was 2000 copies / reaction, and two no-template controls were made at the same time (the template was 5 μL of nucleic acid diluent). The PCR reaction program was: 50℃ for 2 min, 95℃ denaturation for 30 s, then 95℃ for 10 s and 60℃ for 1 min for a total of 40 cycles, and fluorescence was collected at 60℃. The post-PCR probe melting curve analysis program was as follows: 35℃ for 20 min, 45℃ for 5 min, and gradually increased from 45℃ to 95℃ (0.04°C / s), and fluorescence was collected at each step. The experimental instrument was SLAN 96S real-time PCR instrument (Hongshi Medical Technology Co., Ltd., Shanghai).

[0070] Table 4 Probes and intermediate probe sequences of this application

[0071] Note: The bold bases are the probe binding regions that match the template.

[0072] The experimental results are as follows Figure 3 As shown, the results show that the probe melting curve analysis shows that each intermediate probe corresponds to a different melting peak, and the corresponding Tm values ​​are 55.0°C, 61.0°C, 63.8°C, 69.5°C, 72.6°C and 74.4°C, respectively, and the melting peak signal is good, and the Tm values ​​between the melting peaks can be clearly distinguished. The above results show that the KEY probe of the embodiment of the present application can not only be used for probe melting curve analysis, but also can realize multi-target nucleic acid detection through Tm value in a single fluorescence channel. Example 4 KEY probe hairpin structure strength inspection and verification To investigate the secondary structure strength of the hairpin structure of the KEY probe, the nucleic acid sequences of the induced open loop sequence, loop sequence and extended anchor sequence of the probe KEY-FL1 were kept unchanged, and the length of the upstream and downstream loop sequences (4-8 bp) were adjusted to obtain four KEY probes with different hairpin structure strengths. The hairpin structures were KEY-FL3 (hairpin structure Tm = 92.4 °C), KEY-FL2 (hairpin structure Tm = 88.5 °C), KEY-FL1 (hairpin structure Tm = 84 °C) and KEY-FL4 (hairpin structure Tm = 79.6 °C) from strong to weak. The nucleotide sequences corresponding to the KEY probes were SEQ ID: NO.4, SEQ ID: NO.3, SEQ ID: NO.1, and SEQ ID: NO.5. The nucleotide sequences of the intermediate probes were shown in SEQ ID: NO.25-27.

[0073] Each 25 μL PCR reaction system includes 1× PCR buffer (10 mM Tris-HCl (pH 8.0) and 50 mM KCl), 3.0 mM MgCl 2 , 0.2 mM dNTPs, 2U TaqHS enzyme (TaKaRa, Japan), upstream primer of target gene (sequence 5'-GTTTTATCCTTTTCTTGTTCGT-3', 400nM) and downstream primer (sequence 5'-CATCTGCCACTGAAATACA-3', 400nM), the designed intermediate probes and KEY probes with different melting temperatures and their corresponding concentrations are shown in Table 5. The number of template copies added was 2000 copies / reaction, and two no-template controls were made at the same time (the template was 5 μL of nucleic acid diluent). The PCR reaction program was: 50℃ for 2min, 95℃ denaturation for 30 s, then 95℃ for 10 s and 60℃ for 1min for a total of 40 cycles, and fluorescence was collected at 60℃. The post-PCR probe melting curve analysis program was as follows: 35℃ for 20min, 45℃ for 5min, and gradually increased from 45℃ to 95℃ (0.04°C / s), and fluorescence was collected at each step. The experimental instrument was SLAN 96S real-time PCR instrument (Hongshi Medical Technology Co., Ltd., Shanghai).

[0074] Table 5 Probe sequences used in the investigation of the strength of the probe hairpin structure in this application

[0075] Note: The bold bases are the probe binding regions that match the template.

[0076] The experimental results are as follows Figure 4As shown, the results show that when the loop sequence length (upstream loop sequence / downstream loop sequence) is greater than or equal to 6 base pairs, the amplification curve signal and the melting curve signal are both good. However, when the loop sequence length is shortened to 4 base pairs, the amplification curve signal and the melting peak signal are significantly reduced. Therefore, in the application embodiment, the KEY probe loop sequence length can be designed to be greater than or equal to 4 base pairs, and 6 base pairs or more can be selected.

[0077] Example 5 Investigation and verification of the length of the KEY probe-induced open-loop sequence To investigate the appropriate length of the induced open loop sequence of the KEY probe, the nucleic acid sequences of the upstream loop sequence, downstream loop sequence, loop sequence and extended anchor sequence of the KEY probe were kept unchanged, and 5 KEY probes were obtained by adjusting the length of the induced open loop sequence (0-10bp). The lengths of the induced open loop sequences were ROX-RL2 (0bp), ROX-RL3 (1bp), ROX-RL4 (2bp), ROX-RL1 (3bp) and ROX-RL5 (10bp) from small to large. The nucleotide sequences corresponding to the KEY probes were SEQ ID: NO.6, SEQ ID: NO.7, SEQ ID: NO.8, SEQ ID: NO.2 and SEQ ID: NO.9. The nucleotide sequences of the intermediate probes were shown in SEQ ID: NO.28-29.

[0078] Each 25 μL PCR reaction system includes 1× PCR buffer (10 mM Tris-HCl (pH 8.0) and 50 mM KCl), 3.0 mM MgCl 2 , 0.2 mM dNTPs, 2U TaqHS enzyme (TaKaRa, Japan), upstream primer of target gene (sequence 5'-GTTTTATCCTTTTCTTGTTCGT-3', 400nM) and downstream primer (sequence 5'-CATCTGCCACTGAAATACA-3', 400nM), the designed intermediate probes and KEY probes with different melting temperatures and their corresponding concentrations are shown in Table 6. The number of template copies added was 2000 copies / reaction, and two no-template controls were made at the same time (the template was 5 μL of nucleic acid diluent). The PCR reaction program was: 50℃ for 2min, 95℃ denaturation for 30 s, then 95℃ for 10 s and 60℃ for 1min for a total of 40 cycles, and fluorescence was collected at 60℃. The post-PCR probe melting curve analysis program was as follows: 35℃ for 20min, 45℃ for 5min, and gradually increased from 45℃ to 95℃ (0.04°C / s), and fluorescence was collected at each step. The experimental instrument was SLAN 96S real-time PCR instrument (Hongshi Medical Technology Co., Ltd., Shanghai).

[0079] Table 6 Probe sequences used in the investigation of probe-induced open-loop sequence length in this application

[0080] Note: The bold bases are the probe binding regions that match the template.

[0081] The experimental results are as follows Figure 5 As shown in the figure, the results show that the length of the induced open-loop sequence ranges from 0 bases to 10 bases. As the length of the induced open-loop sequence increases, the fluorescence signal values ​​of the amplification curve and the melting curve increase. However, as the length increases to 10 bases, non-specific signals appear in the negative control. Based on this, the KEY probe induced open-loop sequence can be 2-9 bases.

[0082] Example 6 Comprehensive verification of KEY probe nucleic acid sequence and its modification method In order to investigate the detection signals of KEY probes in different fluorescence channels, based on the optimal induced ring-opening sequence length and the optimal upstream / downstream ring-forming sequence explored in the above embodiments, a KEY probe was designed in each of the fluorescence channels FAM (510 nm), HEX (565 nm), ROX (620 nm) and Cy5 (665 nm) of fluorescence real-time PCR, namely KEY-FH1 (nucleotide sequence as shown in SEQ ID: NO.1), KEY-HH1 (nucleotide sequence as shown in SEQ ID: NO.10), KEY-RH1 (nucleotide sequence as shown in SEQ ID: NO.11), KEY-CH1 (nucleotide sequence as shown in SEQ ID: NO.12), and 3 intermediate probes corresponding to each KEY probe.

[0083] Each 25 μL PCR reaction system includes 1× PCR buffer (10 mM Tris-HCl (pH 8.0) and 50 mM KCl), 3.0 mM MgCl 2, 0.2 mM dNTPs, 2U TaqHS enzyme (TaKaRa, Japan), upstream primer of target gene (sequence 5'-GTTTTATCCTTTTCTTGTTCGT-3', 400nM) and downstream primer (sequence 5'-CATCTGCCACTGAAATACA-3', 400nM), the designed intermediate probes and KEY probes with different melting temperatures and their corresponding concentrations are shown in Table 7. The number of template copies added was 2000 copies / reaction, and two no-template controls were made at the same time (the template was 5 μL of nucleic acid diluent). The PCR reaction program was: 50℃ for 2min, 95℃ denaturation for 30 s, then 95℃ for 10 s and 60℃ for 1min for a total of 40 cycles, and fluorescence was collected at 60℃. The post-PCR probe melting curve analysis program was as follows: 35℃ for 20min, 45℃ for 5min, and gradually increased from 45℃ to 95℃ (0.04°C / s), and fluorescence was collected at each step. The experimental instrument was SLAN 96S real-time PCR instrument (Hongshi Medical Technology Co., Ltd., Shanghai).

[0084] Table 7 Nucleic acid sequences of probe combinations and their modifications in this application

[0085] Note: The bold bases are the probe binding regions that match the template.

[0086] The experimental results are as follows Figure 6 As shown, the results show that the amplification curve and melting curve signals of the KEY probe designed in 4 commonly used fluorescence channels are good. The melting peak Tm value range is 58.5℃-83.5℃, the temperature span range is 25℃, a melting peak is set every 2℃ (corresponding to 1 target gene of the detection object), and 13 target genes can be detected in a single fluorescence channel. Using a commonly used four-fluorescence channel real-time fluorescence PCR instrument, it is expected to detect 52 target genes in a single PCR reaction; using a six-fluorescence channel real-time fluorescence PCR instrument, it is expected to detect 78 target genes in a single PCR reaction; and so on. This embodiment demonstrates the high fluorescence signal detection capability of the KEY probe in multiple fluorescence channels and its excellent application potential in the field of multiple detection.

[0087] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. A probe for nucleic acid detection, characterized in that: The nucleotide sequence of the probe includes, from the 5' end to the 3' end, an induced ring-opening sequence, an upstream ring-forming sequence, a ring sequence, a downstream ring-forming sequence and an anchor extension sequence in sequence; wherein the upstream ring-forming sequence and the downstream ring-forming sequence are reverse complementary pairs, the 5' end of the nucleotide sequence of the probe is connected to a first quenching group, the 3' end of the nucleotide sequence of the probe is connected to a second quenching group, and the upstream of the anchor extension sequence is connected to a fluorescent group.

2. The probe according to claim 1, characterized in that The loop sequences are provided with spacer modifications.

3. The probe according to claim 2, characterized in that The spacer modification includes one or more Spacer18, Spacer 9, Spacer C3 or Spacer C6 modification.

4. The probe according to claim 1, characterized in that The induced loop-opening sequence has a length of 1-20 bases; And / or, the upstream loop-forming sequence and the downstream loop-forming sequence both have a length of 4-20 bases; and / or, the loop sequence has a length of 3-10 bases; And / or, the anchor extension sequence has a length of 30-45 bases, and the distance between the fluorescent group and the second quenching group is at least 25 bases.

5. The probe according to claim 4, characterized in that: The induced ring-opening sequence has a length of 2-9 bases, the upstream ring-forming sequence and the downstream ring-forming sequence both have a length of 6-10 bases, the anchor extension sequence has a length of 40-45 bases, and the distance between the fluorescent group and the second quenching group is at least 38 bases.

6. The probe according to claim 1, characterized in that The nucleotide sequence of the probe has a length of 50-70 bases; And / or, the melting curve Tm value of the probe is 50°C-90°C.

7. The probe according to any one of claims 1 to 6, characterized in that: The fluorescent group includes at least one of Atto425, FAM, HEX, ROX, Cy5, and Quasar705; and / or, the first quenching group comprises at least one of TAMRA, Dabcyl, BHQ1 and BHQ2; And / or, the second quenching group includes at least one of TAMRA, Dabcyl, BHQ1 and BHQ2.

8. The probe according to any one of claims 1 to 6, characterized in that The nucleotide sequence of the probe includes at least one of the sequences shown in SEQ ID No. 1-12.

9. Use of the probe according to any one of claims 1 to 8 in nucleic acid detection.

10. A nucleic acid detection kit, characterized in that: The method comprises the probe according to any one of claims 1 to 8, and an intermediate probe.

Images