EccDNA and application thereof in radiation dose detection

Abstract

The invention provides EccDNA for detecting a radiation dose, and also provides a method for detecting the radiation dose. The EccDNA and the method thereof provided by the invention can accurately, simply and quickly detect the radiation dose, and have a good application prospect.

Description

Technical Field

[0001] The present invention relates to the field of radiation detection and medical diagnosis technology, and in particular to EccDNA for radiation dose detection and a detection method thereof. Background Art

[0002] Most current studies focus on radiation dose damage in radiotherapy patients, and few have focused on predicting large-scale casualties in nuclear accidents or nuclear strikes, which are often accompanied by trauma, burns, or infections. However, existing studies have not focused on changes in genomic expression under conditions of combined injuries. Therefore, we need to design a method that can perform large-scale personnel screening under conditions of combined injuries.

[0003] In the case of various nuclear and radiation accidents, how to quickly classify and diagnose the casualties and timely and accurately predict the possible long-term effects is a basic principle and important scientific issue guiding emergency response and clinical treatment. Radiation biodosimeters are used to quantitatively estimate the radiation dose absorbed by irradiated individuals to guide the clinical diagnosis of radiation sickness, treatment plan decisions, prognosis determination, and long-term effect assessment, and play an irreplaceable role in the treatment of radiation sickness. In addition, in places of radiation exposure, rapid assessment of radiation dose is an important guarantee for the health monitoring of occupational personnel.

[0004] At present, the gold standard for judging radiation absorption dose at home and abroad is to judge by dicentric chromosome detection and lymphocyte micronucleus rate, but these experiments have some problems, such as: 1) the dose of ionizing radiation in the body is often uneven; 2) the repair of chromosomal aberrations will affect the estimation of dose; 3) lymphocytes carrying unstable aberrations disappear relatively quickly. It limits retrospective dose determination. Therefore, blood collected several hours before the leukopenia event is required for determination. In addition, chromosome dicentric detection requires culturing lymphocytes in the patient's blood for at least 48 hours after radiation exposure before testing, which is not conducive to large-scale population screening. Although the current biological indicators with radiation dose correlation (radiation-related proteins, RNA) can improve the above shortcomings to a certain extent, the expression of these indicators is easily affected by disease and stress, and the stability and specificity are not high, which limits the application of radiation biodosimeters. These are the main bottlenecks in the research of radiation biodosimeters. Summary of the invention

[0005] The purpose of the present invention is to provide a method for estimating ionizing radiation dose in a radiation-complex injury model based on transcriptomics radiation biomarkers in view of the shortcomings of existing radiation assessment technologies.

[0006] The present invention first provides an EccDNA for detecting radiation dose, which is selected from one or more of the nucleotide sequences of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.

[0007] The present invention also provides a primer pair for amplifying EccDNA, which is selected from one or more of the first primer pair, the second primer pair or the third primer pair;

[0008] The nucleotide sequences of the first primer pair are SEQ ID NO: 4 and SEQ ID NO: 5;

[0009] The nucleotide sequences of the second primer pair are SEQ ID NO: 6 and SEQ ID NO: 7;

[0010] The nucleotide sequences of the third primer pair are SEQ ID NO:8 and SEQ ID NO:9.

[0011] Another aspect of the present invention provides a method for detecting radiation dose, comprising:

[0012] 1) Extract the whole genome of peripheral blood samples;

[0013] 2) purifying the peripheral blood whole genome by EccDNA;

[0014] 3) Use primer pairs to amplify and detect specific EccDNA content;

[0015] The nucleotide sequence of the specific EccDNA is SEQ ID NO:1, SEQ ID NO:2 and / or SEQ ID NO:3.

[0016] In one embodiment according to the present invention, the primer pair is selected from one or more of a first primer pair, a second primer pair or a third primer pair;

[0017] The nucleotide sequences of the first primer pair are SEQ ID NO: 4 and SEQ ID NO: 5;

[0018] The nucleotide sequences of the second primer pair are SEQ ID NO: 6 and SEQ ID NO: 7;

[0019] The nucleotide sequences of the third primer pair are SEQ ID NO:8 and SEQ ID NO:9.

[0020] The present invention further provides a reagent or kit for detecting radiation amount, which comprises the above-mentioned EccDNA and / or primer pairs.

[0021] According to one embodiment of the present invention, the use of the above-mentioned EccDNA or primer pair in the preparation of a reagent or kit for detecting radiation amount is provided.

[0022] The beneficial effects of the above technical solution of the present invention are as follows:

[0023] The EccDNA provided by the present invention can be used for the detection of radiation dose, and the detection method is simple, rapid and accurate, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 is a sequencing flow chart of the present invention;

[0025] Figure 2 Schematic diagram of the EccDNA screened in the present invention;

[0026] Figure 3 This is the VENN analysis diagram of EccDNA sequencing data;

[0027] Figure 4 The graphs show the detection results of three EccDNAs in mice after irradiation with 0.2, 1, 2, 4, 6, 8, and 10 Gy at 24 hours and 72 hours after radiation. DETAILED DESCRIPTION

[0028] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0029] Radiation conditions: control group (n=5), whole body 0.2Gy X-ray irradiation, 24-hour blood draw (n=5), whole body 1Gy X-ray irradiation, 24-hour blood draw (n=5), whole body 2Gy X-ray irradiation, 24-hour blood draw (n=5), whole body 4Gy X-ray irradiation, 24-hour blood draw (n=5), whole body 6Gy X-ray irradiation, 24-hour blood draw (n=5), whole body 8Gy X-ray irradiation, 24-hour blood draw (n=5), whole body 10Gy X-ray irradiation, 24-hour blood draw (n=5), whole body 0.2Gy X-ray irradiation, 72-hour blood draw (n=5), whole body 1Gy X-ray irradiation, 72-hour blood draw (n=5), whole body 2Gy X-ray irradiation, 72-hour blood draw (n=5), whole body 4Gy X-ray irradiation, 72-hour blood draw (n=5), whole body 6Gy X-ray irradiation, blood draw within 72 hours (n=5), whole body 8Gy X-ray irradiation, blood draw within 72 hours (n=5), whole body 10Gy X-ray irradiation, blood draw within 72 hours (n=5).

[0030] Mouse peripheral blood whole genome purification: (Purification kit BG0046, Bio-biotech)

[0031] 1). Take 200-300μl of blood or serum, add 1mL of ①BG DNA Extraction Lysis Buffer and mix thoroughly.

[0032] 2). Centrifuge at room temperature at 13000rpm for 5 minutes (if the sample is rich in pigment, a flocculent substance that cannot be precipitated will form in the supernatant. The pigment will be removed in the later washing and will not affect the subsequent experiments);

[0033] 3). Transfer the supernatant to a new 2mL centrifuge tube, be careful not to suck up the precipitate, add an equal volume of ②BGMG ForDNA (shake vigorously before use to evenly disperse the magnetic beads) (make sure that anhydrous ethanol has been added before use), shake violently 10 times or vortex for 10s (vigorously disperse the nanomagnetic beads, otherwise it will affect the purity), and let it stand at room temperature for 30s;

[0034] 4). Place the centrifuge tube containing the mixture in a magnetic rack or other form of magnetic field and let it stand for 10 seconds until the magnetic beads are completely enriched (the standing time is related to the magnetic field strength and can be determined based on the clarity of the observed solution. If a 12-well magnetic rack is used, it is recommended to use a 2ml RNase-Free centrifuge tube, which fits better with the magnetic rack);

[0035] Note: Magnetic beads may remain on the centrifuge tube cap. You can invert the magnetic stand to enrich the beads together.

[0036] 5). Pour off the supernatant in a magnetic field;

[0037] 6). Add 500μl ③DNA WB1 (make sure that anhydrous ethanol has been added before use), remove from the magnetic field, shake violently 10 times or vortex for 10s (violently disperse the nanomagnetic beads, otherwise it will affect the purity)

[0038] 7) Place the centrifuge tube back into the magnetic rack or other magnetic field and let it stand for 10 seconds (the standing time is related to the strength of the magnetic field);

[0039] 8). Pour off the supernatant in a magnetic field;

[0040] 9). Add 500 μl 75% ethanol (self-prepared), remove from the magnetic field, shake violently 10 times or vortex for 10 seconds (violently disperse the nanomagnetic beads, otherwise it will affect the purity)

[0041] 10) Place the centrifuge tube back into the magnetic rack or other magnetic field and let it stand for 10 seconds (the standing time is related to the strength of the magnetic field);

[0042] 11). Pour off the supernatant in a magnetic field;

[0043] 12). Add 500 μl 75% ethanol again, remove from the magnetic field, shake violently 10 times or vortex for 10 seconds (violently disperse the nanomagnetic beads, otherwise the purity will be affected)

[0044] 13). Place the centrifuge tube back into the magnetic rack or other magnetic field and let it stand for 10 seconds (the standing time is related to the strength of the magnetic field);

[0045] 14). Pour off the supernatant in a magnetic field;

[0046] 15). Remove residual ethanol*;

[0047] *Removal of residual ethanol solution:

[0048] a) Use a pipette tip to suck away the remaining liquid on the bottom and lid, and open the lid to allow the ethanol to evaporate for 10-15 minutes. During this time, liquid will gather at the bottom of the tube again and need to be sucked away again;

[0049] b) After instant centrifugation, place the centrifuge tube back into the magnetic rack and discard the residual liquid at the bottom of the tube. The time for evaporating alcohol is related to parameters such as ambient wind speed, temperature, and the amount of residual alcohol, and needs to be fine-tuned according to actual conditions.

[0050] See also Figure 1-Figure 3

[0051] EccDNA purification of whole genome samples: (Purification kit A&A Biotechnology plasmid miniAX)

[0052] 1.) Suspend the genome in 600 μl of L1 cell suspension.

[0053] 2.) Add 600 μl of L2 Lysis Solution and mix gently. Keep at room temperature for 3 minutes.

[0054] 3.) Add 600 μl of L3T neutralization solution and mix gently until the red berries of the lysate disappear.

[0055] 4.) Centrifuge at 10,000-15,000 rpm (about 12,000 x g) for 5 minutes.

[0056] 5.) Place the Plasmid 20 column into a 20 ml tube (included). Set up the column with the tube in a rack.

[0057] 6.) Apply 1 ml of K1 equilibrated solution to the Plasmid 20 column. Wait for the solution to flow through the column.

[0058] 7.) Apply the clarified lysate (supernatant) to the Plasmid 20 column. Wait for the lysate to flow through the column.

[0059] 8.) Add 4 ml of K2P washing solution and wait for the solution to flow through the column.

[0060] 9.) Apply 200 μl of K3 elution solution directly onto the membrane of the Plasmid 20 column. Wait for the eluate to flow through the column.

[0061] 10.) Transfer the Plasmid 20 column to a new 2 ml precipitation tube (included).

[0062] 11.) Add 1 ml of K3 eluent. Wait for the eluent to flow through the column. Remove the plasmid 20 column.

[0063] 12.) Add 800 μl of PM precipitation mix to the eluted DNA.

[0064] 13.) Mix the sample by inverting the tube several times and centrifuge at 10,000 RPM (approximately 10,000 x g) for 10 minutes.

[0065] 14.) Carefully discard the supernatant. Be careful not to dislodge the DNA pellet at the bottom of the tube.

[0066] 15.) Add 500 μl 70% ethanol (not included). Mix the sample and centrifuge at 10,000 RPM for 5 minutes (approximately 10,000 x g).

[0067] 16.) Carefully discard the supernatant. Be careful not to dislodge the DNA pellet at the bottom of the tube.

[0068] 17.) Air dry the plasmid DNA pellet at room temperature for 5 minutes.

[0069] 18.) The dried DNA pellet can be dissolved in 50-150 μl of TE buffer (included) or sterile water (not included).

[0070] 19.) Store plasmid DNA at 4-8°C.

[0071] EccDNA amplification: (Amplification kit RCA DNA Amplification Kit GS-MB-002)

[0072] 1. RCA reaction

[0073] 1) Preheat the PCR instrument to 95°C (>100°C heated cover).

[0074] 2) Prepare the following reaction system in a PCR tube, vortex to mix, and centrifuge briefly to allow the liquid to settle at the bottom of the tube.

[0075] 3) Place the sample in step 2) in a PCR instrument preheated at 95°C and incubate for 3 minutes, then cool the PCR tube at room temperature for 5 minutes.

[0076] 4) Transfer the PCR tube to ice, add 2 μL RCA Enzyme, mix gently by pipetting, and centrifuge briefly to allow the liquid to settle at the bottom of the tube.

[0077] 5) Transfer the PCR tube to the PCR instrument and run the RCA reaction program:

[0078] (1) 30℃, 16 hours*; (*: can be extended to 48 hours)

[0079] (2) 65°C, 10 min;

[0080] (3) 4°C, hold;

[0081] 6) The RCA product can be diluted and used directly in Qubit quantification or PCR reactions, or it can be purified by Ampure magnetic beads and used in Nanodrop quantification or other downstream reactions.

[0082] EccDNA RT-PCR detection

[0083] 1. Detect and balance the EccDNA concentration on Nanodrop2000.

[0084] 2. Configure the reaction system

[0085]

[0086]

[0087] 3. On-machine testing

[0088] The results are as follows Figure 4 As shown, EccDNA of No. 14, No. 16, and No. 17 has a good linear correlation with radiation dose;

[0089] EccDNA information of No. 14: chromosome position: chr4:37474771-37475031; size: 260bp; F: tctgcaaccctatagctgga (SEQ ID NO: 4); R: ccctgtgatccatccaatagc (SEQ ID NO: 5).

[0090] Full length sequence of No. 14:

[0091] TCCCAGATATAGCTGTTTCTTGTGAGACTAGGCCGGGGCCTAGCAGACAC

[0092] AGAAGTGGATGCTCACAATCAGCTATTGGATGGATCACAGGGCTCCCAAT

[0093] GGAGGAGCTAGAGAAAGTACCCAGGGAGCTAAAGGGATCTGCAACCCTAT

[0094] AGCTGGAACAACATTCTGAACTAACCAGTACCCCAGAGCTCTTGACTCTA

[0095] GCTGCATATGTATCAAAAGATGGCCTAGTCGGCCATCCCTGGAAAGAGAGGCCCATTGGAC(SEQ IDNO:1)

[0096] EccDNA information of chromosome 16: Chromosomal location: chr17:23907891-23908063; Size: 172bp; F: agtacactgtagctgtcttc(SEQ ID NO:6); R: aaatgcttcctagtttga(SEQ ID NO:7).

[0097] Full-length sequence of chromosome 16:

[0098] CCACTGGGCCTGCAGCTTGGTCCGGACTTCAAACTAGGAAGCATTTCTTT

[0099] TTTTCTTTTTTAAAAGATTAATTAATTAATGACATAAGTACACTGTAGCTGTC

[0100] TTCAGACACACCAGAAGAGGGCATCTGATCTCATTACAGATGGTTGTAAGCCACCATGTGGGTGCTGGGA(SEQ ID NO:2)

[0101] EccDNA information of chromosome 17: Chromosomal location: chr2:83791547-83791751; Size:

[0102] 204bp; Primer: F: ttggtggcatgtgtacagag(SEQ ID NO:8);

[0103] R: tgcatgtacttctaattccttgc (SEQ ID NO: 9).

[0104] Full length sequence of No. 17:

[0105] GAATGTCCTCACCACTTGATAAGACTGTTGTGAGAATTATGACAAAAGAAT

[0106] AATTCGTCTTTTTAGCAAAGCCAGCAAGGAATTAGAAGTACATGCACAG

[0107] ATGTAATGTGACATTGGTGGCATGTGTACAGAGCCATGCTCCTGTGAGGGC

[0108] TACCAGCGTTCAGTCGCACAATGTGGGGCACTGGACTTGCATCCAGTGTGCTATT(SEQ ID NO:3)

[0109] Experimental conclusion:

[0110] The expression levels of EccDNA at different doses and time points after irradiation were analyzed by linear regression analysis. 2 =0.8915,24h,Y=0.1368*X+2.430; R 2 =0.9470,72h,Y=0.2750*X+3.103, and its expression level has a good linear correlation with the radiation dose.

[0111] The expression levels of EccDNA at different doses and time points after irradiation were analyzed by linear regression. 2 =0.8621,24h,Y=0.7674*X+1.680; R 2 =0.8132,72h,Y=0.6969*X-0.003240 Its expression level has a good linear correlation with the radiation dose.

[0112] The expression levels of EccDNA at different doses and time points after irradiation were analyzed by linear regression. 2 =0.6951,24h,Y=1.440*X-0.9475; R 2 =0.8236,72h,Y=0.5123*X+0.07596, and its expression level has a good linear correlation with the radiation dose.

[0113] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An EccDNA for detecting radiation dose, wherein the nucleotide sequence is selected from one or more of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO:

3.

2. A primer pair for amplifying EccDNA, which is selected from one or more of the first primer pair, the second primer pair or the third primer pair; The nucleotide sequences of the first primer pair are SEQ ID NO: 4 and SEQ ID NO: 5; The nucleotide sequences of the second primer pair are SEQ ID NO: 6 and SEQ ID NO: 7; The nucleotide sequences of the third primer pair are SEQ ID NO:8 and SEQ ID NO:

9.

3. A method for detecting radiation dose, characterized in that: include: 1) Extract the whole genome of peripheral blood samples; 2) purifying the peripheral blood whole genome by EccDNA; 3) Use primer pairs to amplify and detect specific EccDNA content; The nucleotide sequence of the specific EccDNA is SEQ ID NO:1, SEQ ID NO:2 and / or SEQ ID NO:

3.

4. The method according to claim 3, characterized in that The primer pair is selected from one or more of a first primer pair, a second primer pair, or a third primer pair; The nucleotide sequences of the first primer pair are SEQ ID NO: 4 and SEQ ID NO: 5; The nucleotide sequences of the second primer pair are SEQ ID NO: 6 and SEQ ID NO: 7; The nucleotide sequences of the third primer pair are SEQ ID NO:8 and SEQ ID NO:

9.

5. A reagent or kit for detecting radiation dosage, comprising the EccDNA as claimed in claim 1, and / or the primer pair as claimed in claim 2.

6. Use of the EccDNA according to claim 1 or the primer pair according to claim 2 in the preparation of a reagent or kit for detecting radiation dose.

Images