Bladder cancer detection kit and application

Abstract

The invention discloses a bladder cancer detection kit and application, and belongs to the field of biological medicine. The bladder cancer detection kit comprises a first combination and / or a second combination, wherein the first combination comprises a TERT amplification primer and a TERT methylation detection probe, and the sequence of the TERT amplification primer is SEQ ID NO.9; the combination II comprises a DMRTA2 amplification primer and a DMRTA2 methylation detection probe, and the sequence of the DMRTA2 methylation detection probe is SEQ ID NO. 12. The kit provided by the invention provides a non-invasive detection means for bladder cancer, and has excellent accuracy and specificity.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a bladder cancer detection kit and application thereof. Background Art

[0002] At present, the commonly used diagnostic methods for bladder cancer in clinical practice include urine exfoliated cytology, urine tumor markers, ultrasound and other imaging, cystoscopy, etc. Among them, although urine exfoliated cytology is a non-invasive diagnostic method with high specificity, it has low sensitivity and is easy to miss. In addition, if the patient has inflammation or is undergoing chemotherapy, the accuracy will also be affected. Most urine tumor markers are protein tests, which are prone to false positive results due to the patient's diet, medication, etc. Ultrasound and other imaging methods have a low recognition rate for bladder carcinoma in situ. Cystoscopy is an invasive examination, which causes great pain to patients and poor compliance. The accuracy of the examination results is also easily affected by the experience and skills of the operator, and the medical costs are high. As a bladder cancer screening method, it is subject to certain restrictions in clinical work and cannot be diagnosed early. Therefore, a non-invasive and highly accurate detection method is very important for early detection of bladder cancer and early monitoring and detection of its recurrence after surgery.

[0003] Bladder cancer (BCa) patients have a high recurrence rate and require close, long-term follow-up based on the patient's risk profile, which leads to high survival costs (follow-up content: regular cystoscopy; urine cytology; regular upper urinary tract imaging. The intensity and invasiveness of these examinations can lead to complication rates, decreased patient quality of life, and economic burden). Approximately 50% of patients who undergo radical cystectomy experience recurrence or metastasis after surgery, of which local recurrence accounts for 10% to 30%, and most of the rest are distant metastases. Both patients and urologists face the challenge of recurrence and subsequent cancer progression of non-muscle invasive bladder cancer after transurethral resection. Summary of the invention

[0004] In view of the deficiencies of the prior art, the present invention provides a bladder cancer detection kit and its application.

[0005] The purpose of the present invention can be achieved through the following technical solutions:

[0006] The first aspect of the present application relates to a bladder cancer detection kit, comprising combination one and / or combination two:

[0007] The combination 1 comprises:

[0008] TERT amplification primers,

[0009] And, TERT methylation detection probe, the sequence is: SEQ ID NO.9;

[0010] The second combination includes:

[0011] DMRTA2 amplification primers,

[0012] And, DMRTA2 methylation detection probe, the sequence is: SEQ ID NO.12.

[0013] Optionally, PCR-related reagents are also included.

[0014] Optionally, a combination three for internal reference gene amplification and detection is also included.

[0015] Optionally, the TERT amplification primers include: a TERT forward primer, the sequence of which is: SEQ ID NO.7; and a TERT reverse primer, the sequence of which is: SEQ ID NO.8;

[0016] The DMRTA2 amplification primers include: a DMRTA2 forward primer, the sequence of which is SEQ ID NO.10; and a DMRTA2 reverse primer, the sequence of which is SEQ ID NO.11.

[0017] Optionally, the concentration of the TERT methylation detection probe and the DMRTA2 methylation detection probe is 50 nM.

[0018] Optionally, the combination three includes:

[0019] ACTB forward primer, sequence: SEQ ID NO.13;

[0020] ACTB reverse primer, sequence: SEQ ID NO.14;

[0021] And, ACTB methylation detection probe, the sequence is: SEQ ID NO.15.

[0022] Optionally, the concentration of the TERT forward primer and the TERT reverse primer is 250 nM, and the concentration of the DMRTA2 forward primer and the DMRTA2 reverse primer is 750 nM.

[0023] Optionally, the PCR-related reagents include: conversion components, PCR buffer, dNTPs, Taq enzyme and quality control components.

[0024] Optionally, the quality control components include CpG methylated human genomic DNA and Human HCT116 DKONon-Methylated DNA; the conversion components include ammonium bisulfite, conversion buffer, conversion rinse solution and conversion elution solution.

[0025] The second aspect of the present application relates to the use of the kit in preparing a product for diagnosing bladder cancer.

[0026] Beneficial effects of the present invention:

[0027] 1) Compared with cystoscopy, which is currently a common diagnostic method for bladder cancer in clinical practice, the kit of the present application is a non-invasive detection method.

[0028] 2) Compared with the current clinical diagnostic technologies, urine cytology requires professional pathologists to interpret, and cystoscopy requires professional equipment. The kit of this application overcomes the difficulties in operation and interpretation, adopts the method of fluorescent quantitative PCR, and can be operated by inspectors with a little training. The result judgment is intuitive, and the clinical application and promotion are simple.

[0029] 3) Based on current clinical research data, the accuracy of the test kit of this application exceeds 90%, and the product performance is extremely excellent. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The present invention will be further described below in conjunction with the accompanying drawings.

[0031] Figure 1 Amplification curves of each channel for 3% positive sample detection used in this application;

[0032] Figure 2 This is an amplification curve diagram of an embodiment of the present application. DETAILED DESCRIPTION

[0033] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] The human telomerase reverse transcriptase (TERT) gene encodes the telomerase catalytic reverse transcriptase subunit that maintains telomere length. The TERT promoter is an important element for telomerase expression. It contains many binding sites for cellular transcription activators and repressors that directly or indirectly regulate gene expression and has become a target for cancer-specific mutations. The high GC content around the transcription start site of the TERT promoter confers epigenetic regulation through methylation and chromatin remodeling. DNA methylation of the TERT promoter has been identified as an epigenetic regulatory mechanism for telomerase activation in various cancers. The DMRTA2 gene is located on chromosome 1 p32.3 and encodes Dmrta2, a protein in the Dmrt family of transcription factors. This protein family plays a role in the developing reproductive system. Studies have shown that the DMRTA2 gene is hypermethylated in 8 of 9 bladder cancer cell lines compared with the normal bladder epithelial cell line SV-HUC-1. In a study of 477 clinical samples, the methylation level of DMRTA2 can also distinguish bladder cancer from other interfering urinary tract cancers and benign tumors. However, single methylation marker testing is not sensitive for diagnosing Ta, T3, and T4 stages of bladder cancer, suggesting the need for combined use of different markers.

[0035] The present invention designs primer probe sequences for the methylation regions of the above two bladder cancer-related genes, respectively, with GRCh37.p13 as the reference genome, wherein the DMRTA2 gene region is Chr1:50888967-50889064, the reference sequence is SEQ ID NO.1, and the methylation sequence is SEQ ID NO.2. The TERT gene region is Chr5:1295319-1295465, the reference sequence is SEQ ID NO.3, and the methylation sequence is SEQ ID NO.4. The ACTB gene is set as an internal reference gene, and its gene region is Chr7:5571727-5571863, the reference sequence is SEQ ID NO.5, and the methylation sequence is SEQ ID NO.6.

[0036] Primer probes were designed based on the methylation sequences of the above gene regions. The specific sequences are as follows:

[0037]

[0038] SEQ ID NO.1:

[0039] GTCGCGGGTTCCAACCACGCGGCCCGCAGACGAGCCTCCGACCCGGATTT

[0040] CTGAAGGGAGGGTTGGACTGCGCTGCGTTCTGAGGGGTCCGGAAGTTC SEQ ID NO.2:

[0041] GTCGCGGGTTTTAATTACGCGGTTCGTAGACGAGTTTTCGATTCGGATTTT

[0042] TGAAGGGAGGGTTGGATGCGTTGCGTTTTGAGGGGTTCGGAAGTTC

[0043] SEQ ID NO.3:

[0044] CCCGGGTCCCCAGTCCCTCCGCCACGTGGGAAGCGCGGTCCTGGGCGTCT

[0045] GTGCCCGCGAATCCACTGGGAGCCCGGCCTGGCCCCGACAGCGCAGCTGC

[0046] TCCGGGCGGACCCGGGGGTCTGGGCCGCGCTTCCCCGCCCGCGCGCCSEQ ID NO.4:

[0047] GGAGGGACTGGGGACCCGGGCACCCGTCCTGCCCCTTCACCTTCCAGCTC

[0048] CGCCTCCTCCGCGCGGACCCCGCCCCGTCCCGACCCCTCCCGGGTCCCCG

[0049] GCCCAGCCCCCTCCGGGCCCTCCCAGCCCCTCCCCTTCCTTTCCGCGSEQ ID NO.5

[0050] GGTGGTGATGGAGGAGGCTCAGCAAGTCTTCTGGACTGTGAACCTGTGTC

[0051] TGCCACTGTGTGCTGGGTGGTGGTCATCTTTCCCACCAGGCTGTGGCCTCT

[0052] GCAACCTTCAAGGGAGGAGCAGGTCCCATTGGCTGASEQ ID NO.6

[0053] GGTGGTGATGGAGGAGGTTTAGTAAGTTTTTTGGATTGTGAATTTGTGTTT

[0054] GTTATTGTGTGTTGGGTGGTGGTTATTTTTTTTATTAGGTTGTGGTTTTTGT

[0055] AATTTTTAAGGGAGGAGTAGGTTTTATTGGTTGA

[0056] The above primer-probe combination of the kit of this embodiment is designed by ourselves and commissioned to be synthesized by Sangon Biotech (Shanghai) Co., Ltd. The information of other components involved in this reagent is as follows:

[0057]

[0058] The kit of this example studies the addition amount of the main components of the above reagents, and the research uses a SLAN-96S real-time fluorescence quantitative PCR instrument:

[0059] 1) Target primer concentration study

[0060] Dilute the DMRTA2 and TERT target primers to 10 μM, and the probes to 10 μM. Prepare the reaction system with 5 concentrations of each target primer according to the usage range of the primers, as shown in the following table:

[0061]

[0062] CpG methylated human genomic DNA and Human HCT116 DKO Non-Methylated DNA were configured into positive samples (10 ng / μL) and negative samples (10 ng / μL) with a methylation content of 3%, and transformed according to the confirmed conversion procedure and elution volume. The conversion products were detected. The positive samples (10 ng / μL) with a methylation content of 3% were tested in 4 replicates, and the negative samples were tested in 4 replicates.

[0063] The test results are as follows:

[0064]

[0065] Conclusion: Based on the experimental results, the Ct value, CV value and primer dosage of each fluorescent channel were comprehensively evaluated, and the target primer addition amount of the PCR reaction system of this kit was selected as shown in the following table:

[0066]

[0067]

[0068] 2) Target probe concentration study

[0069] The target probe was prepared into a 10 μM concentration solution, and the concentration of each target probe was 5 reaction systems, as shown in the following table:

[0070]

[0071] The test results are as follows:

[0072]

[0073]

[0074] Conclusion: According to the experimental results, the Ct values ​​of each fluorescent channel and the amount of primers were comprehensively evaluated, and the final concentrations of the target probes added to the PCR reaction system of this kit were selected as follows:

[0075]

[0076] 3) Internal standard primer concentration screening

[0077] The internal standard primers were prepared into a 10 μM mixed solution at a ratio of 1:1, and the reaction system with 5 concentrations of internal standard primers was prepared according to the usage range of the primers, as shown in the following table:

[0078]

[0079] The test results are as follows:

[0080]

[0081] Conclusion: According to the experimental results, comprehensive evaluation of the detection Ct value and primer dosage, the internal standard primer ACTB-F / R (10μM) of the PCR reaction system of this kit was selected with an addition volume of 0.4μL and a final concentration of 200nM.

[0082] 4) Internal standard probe concentration screening

[0083] The internal standard probe was configured into a 10 μM solution. The probe concentration was set to 5 concentrations of the reaction system, as shown in the following table:

[0084]

[0085] The test results are as follows:

[0086]

[0087] Conclusion: According to the experimental results, the Ct value and the amount of probe were comprehensively evaluated, and the optimal volume of the PCR reaction system of this kit was selected as 0.01 μL, and the final concentration of the reaction system was 5 nM.

[0088] 5) Formulation of amplification test solution

[0089] Based on the above test, the preferred formula of the kit of this embodiment is shown in the following table.

[0090] Reagent name Optimize concentration Standard formula (μL) EpiArt MethyLight qPCR Mix / 10 TERT-F / R(10um) 250nM 0.5 TERT-P(10um) 50nM 0.1 DMRTA2-F / R(10um) 750nM 1.5 DMRTA2-P(10um) 50nM 0.1 ACTB-F / R(10um) 200nM 0.4 ACTB-P(1um) 5nM 0.1 <![CDATA[H2O]]> / 5.3 template / 2

[0091] In some embodiments of the present application, the optimal reaction conditions of the kit were studied:

[0092] 1) Selection of annealing temperature in amplification reaction

[0093] The annealing temperature of the fluorescence collection step in the PCR amplification stage was explored and optimized, and was set to 55°C, 58°C, 60°C, and 64°C, and the amplification effects of different annealing temperatures were compared.

[0094] CpG methylated human genomic DNA and Human HCT116 DKO Non-Methylated DNA were configured into methylation content 20% positive samples (10ng / μL), 3% positive samples (10ng / μL), and negative samples (10ng / μL) and transformed according to the confirmed transformation program and elution volume. The transformation products were detected. The methylation content 3% positive sample (10ng / μL) was detected in 8 replicates, and the other samples were detected in 4 replicates. After the reaction was completed, the results were analyzed, and the optimal annealing temperature was selected according to the Ct value detected in each fluorescence channel.

[0095] The test results are as follows:

[0096]

[0097]

[0098] According to the experimental results, the Ct values ​​detected by each fluorescence channel of the first group of annealing temperatures in the PCR amplification program are optimal, so the annealing temperature of 55°C is selected as the annealing temperature of the PCR amplification program of this kit.

[0099] 2) Determination of amplification steps and amplification cycle numbers in amplification reactions

[0100] The steps of PCR amplification were explored and optimized, and the program was set as follows: ①step1: 95℃5min; step2 (40 cycles): 95℃15sec 55℃30sec (fluorescence collection) 72℃20sec, and ②step1: 95℃5min; step2 (40 cycles): 95℃15sec 55℃30sec (fluorescence collection), and the amplification effects of the two-step method and the three-step method were compared.

[0101] The positive samples with 20% methylation content (10ng / μL), 3% positive samples (10ng / μL), and negative samples (10ng / μL) were transformed according to the confirmed conversion procedure and elution volume, and the conversion products were detected. The negative samples (10ng / μL) were tested in 8 replicates, and the other samples were tested in 4 replicates.

[0102] The test results are as follows:

[0103]

[0104] Both procedures ① and ② meet the requirements, but procedure ② takes less time, so we choose to use procedure ②.

[0105] 3) Confirmation of reaction program cycle number

[0106] The number of amplification cycles in the PCR amplification stage was explored and optimized, and the program was set as follows: ①step1: 95℃5min step2 (5 cycles): 95℃15sec 60℃30sec step3 (35 cycles): 95℃30sec 55℃30sec (fluorescence collection), program ②step1: 95℃5min step2 (5 cycles): 95℃15sec 60℃30sec step3 (38 cycles): 95℃15sec 55℃30sec (fluorescence collection), program ③step1: 95℃5min step2 (5 cycles): 95℃15sec 60℃30sec step3 (40 cycles): 95℃15sec 55℃30sec (fluorescence collection) to compare the amplification effects of two-round gradient PCR and one-round PCR reaction programs.

[0107] The positive samples with 20% methylation content (10ng / μL), 3% positive samples (10ng / μL), and negative samples (10ng / μL) were transformed according to the confirmed conversion procedure and elution volume, and the conversion products were detected. The negative samples (10ng / μL) were tested in 8 replicates, and the other samples were tested in 4 replicates.

[0108] The test results are as follows:

[0109]

[0110]

[0111] Amplification curves Figure 2 As shown:

[0112] The above results show that the Ct values ​​of each channel of Program ①, Program ② and Program ③ are not much different, but the fluorescence signal intensity of Program ③ reaches the highest, so gradient Program ③ is selected as the reaction program.

[0113] In some embodiments of the present application, the kit of the present application is used to test clinical samples, and 64 samples of bladder cancer patients and 29 samples of urinary tract inflammation / stones patients were collected from Xuzhou Central Hospital and tested using the kit developed according to the preferred conditions of the above embodiments in accordance with the product instructions.

[0114] The specific operation method is as follows:

[0115] 1. DNA nucleic acid was extracted from clinical samples according to the instructions of the selected genomic DNA extraction kit (magnetic bead universal DNA kit, IVD3102, Guangzhou Meiji Biotechnology Co., Ltd.).

[0116] 2. Sulfite Conversion and Purification

[0117] 1) Take 20 μL of the sample DNA to be tested into a 0.2 mL PCR reaction tube, and at the same time take 20 μL of the negative control and positive control into the corresponding quality control tubes and process them simultaneously with the sample to be tested.

[0118] Note: The recommended sample input volume is less than 2000ng. If it is less than 20μL, add water to make up to 20μL.

[0119] 2) Add 100 μL of conversion solution to each of the sample tube and the quality control tube.

[0120] 3) Close the tube cap tightly, oscillate for 15 seconds to mix the reaction solution, and centrifuge briefly to allow the liquid to accumulate at the bottom of the tube.

[0121] 4) Place the PCR reaction tube in the PCR instrument and perform the transformation reaction according to the table below.

[0122] temperature time Heating cover 105℃ On 98℃ 10min 54℃ 60min 4℃ Hold(<24h)

[0123] 5) Take a new 1.5mL centrifuge tube and add 400μL of buffer MB, 200μL of isopropanol,

[0124] 120 μL of the transformed product and 20 μL of magnetic bead solution were shaken and mixed, then placed on a constant temperature mixer, incubated at room temperature (10-30°C) at 1700 rpm for 10 min, and centrifuged instantly.

[0125] Note: The magnetic beads must be fully shaken and mixed before use. The magnetic beads settle quickly, so when adding magnetic beads continuously, they must be mixed several times.

[0126] 6) Place the centrifuge tube on a magnetic rack and let it stand for 30 seconds, then discard the waste liquid.

[0127] 7) Add 500 μL of washing buffer WB to the centrifuge tube, mix by pipetting or shaking, centrifuge instantly, place on a magnetic stand for 30 seconds, and discard the waste liquid.

[0128] 8) Add 200 μL of buffer DB to the centrifuge tube, mix by pipetting or shaking, place on a constant temperature mixer, incubate at room temperature (10-30°C) at 1700 rpm for 15-20 min, centrifuge instantly, place on a magnetic stand and let stand for 30 s, and discard the waste liquid.

[0129] 9) Add 500 μL of washing buffer WB to the centrifuge tube, mix by pipetting or shaking, centrifuge briefly, place on a magnetic rack and let stand for 30 seconds, then discard the waste liquid.

[0130] 10) Add 200 μL of washing buffer WB to the centrifuge tube, mix by pipetting or shaking, centrifuge briefly, place on a magnetic rack and let stand for 30 seconds, discard the waste liquid as much as possible, and dry at room temperature for 5-10 minutes (observe with the naked eye that the surface of the magnetic beads becomes matte and the beads are not cracked).

[0131] 11) Add 30-80 μL of elution buffer to the centrifuge tube, mix well by pipetting or vortexing, and place on a constant temperature mixer, incubate at 65℃1700rpm for 10 min, centrifuge briefly, and place on a magnetic rack for 30 s. Transfer the eluted product to a new centrifuge tube for later use (it is best to test immediately. If downstream testing is not performed immediately, please store the eluted product below -20℃).

[0132] Sample addition: Take 2 μL of the transformation product and add it to the 18 μL reaction solution prepared above, with a total volume of 20 μL.

[0133] 3. PCR amplification (amplification region)

[0134] Place the PCR reaction tubes into the sample slot of the fluorescence quantitative PCR instrument and record the placement order. Set the instrument parameters according to the following table:

[0135]

[0136] The test results are as follows:

[0137]

[0138]

[0139]

[0140] Test result explanation:

[0141] 1) The VIC signal of the sample to be tested should have an amplification curve with an obvious exponential growth period, and the Ct value should be ≤27, otherwise the experimental results are invalid. It is recommended to increase the sample amount and repeat the experiment.

[0142] 2) If the ROX channel of the sample to be tested is amplified and the channel Ct value is ≤40, or if the CY5 channel of the sample to be tested is amplified and the channel Ct value is ≤37, the sample is positive.

[0143] 3) If there is no amplification in both ROX and CY5 channels, the sample is negative.

[0144] The sensitivity of this test on clinical samples was 96% (24 / 25), the specificity was 94% (50 / 53), and the overall accuracy was 95%.

[0145] The above results indicate that the kit of the present application can achieve certain diagnostic purposes.

[0146] It should be noted that the diagnostic kit of the present application is preferably used in combination with multiple indicators for the diagnosis of early bladder cancer. However, for the diagnosis of non-early bladder cancer or other situations, a single indicator kit can be used. In other embodiments, those skilled in the art should know that other diagnostic indicators or clinical symptoms known in the art can also be used in combination with the kit of the present application to achieve higher accuracy or specificity.

[0147] In the description of this specification, the description with reference to the terms "one embodiment", "example", "specific example", etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner.

[0148] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and these changes and improvements all fall within the scope of the present invention to be protected.

Claims

1. A bladder cancer detection kit, characterized in that: Includes Combination 1 and / or Combination 2: The combination 1 comprises: TERT amplification primers, And, TERT methylation detection probe, the sequence is: SEQ ID NO.9; The second combination includes: DMRTA2 amplification primers, And, DMRTA2 methylation detection probe, the sequence is: SEQ ID NO.

12.

2. The bladder cancer detection kit according to claim 1, characterized in that Also includes PCR related reagents.

3. The bladder cancer detection kit according to claim 1, characterized in that: Also included is combination three for internal reference gene amplification and detection.

4. The bladder cancer detection kit according to claim 1, characterized in that The TERT amplification primers include: a TERT forward primer, the sequence of which is SEQ ID NO.7; and a TERT reverse primer, the sequence of which is SEQ ID NO.8; The DMRTA2 amplification primers include: a DMRTA2 forward primer, the sequence of which is SEQ ID NO.10; and a DMRTA2 reverse primer, the sequence of which is SEQ ID NO.

11.

5. The bladder cancer detection kit according to claim 1, characterized in that: The concentration of the TERT methylation detection probe and the DMRTA2 methylation detection probe is 50 nM.

6. The bladder cancer detection kit according to claim 3, characterized in that: The combination three includes: ACTB forward primer, sequence: SEQ ID NO.13; ACTB reverse primer, sequence: SEQ ID NO.14; And, ACTB methylation detection probe, the sequence is: SEQ ID NO.

15.

7. The bladder cancer detection kit according to claim 4, characterized in that: The concentrations of the TERT forward primer and the TERT reverse primer are 250 nM, and the concentrations of the DMRTA2 forward primer and the DMRTA2 reverse primer are 750 nM.

8. The bladder cancer detection kit according to claim 2, characterized in that: The PCR-related reagents include: conversion components, PCR buffer, dNTP, Taq enzyme and quality control components.

9. The bladder cancer detection kit according to claim 8, characterized in that: The quality control components include CpG methylated human genomic DNA and Human HCT116 DKO Non-Methylated DNA; the conversion components include ammonium bisulfite, conversion buffer, conversion rinsing solution and conversion elution solution.

10. Use of the kit according to any one of claims 1 to 9 in the preparation of a product for diagnosing bladder cancer.

Images