Application of REXO2 as glioblastoma diagnosis / prognosis biomarker and treatment target

Abstract

The invention relates to the technical field of biological medicines, and discloses application of REXO2 as a glioblastoma diagnosis / prognosis biomarker and a treatment target spot, the expression quantity of REXO2 in tumor tissues of GBM patients is higher, the survival time of the patients with high expression of REXO2 is shorter, the expression quantity of REXO2 is increased along with the increase of the malignancy degree of the patients, and the survival time of the patients with high expression of REXO2 is shortened. The invention proves that the REXO2 can be used for diagnosis and prognosis evaluation of the glioblastoma, knock-down of the REXO2 can significantly inhibit the clone formation ability of U251 cells, which indicates that the proliferation ability and tumorigenicity of the U251 cells are reduced, which indicates that the REXO2 can be used as a treatment target of the glioblastoma.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the application of REXO2 as a biomarker and therapeutic target for the diagnosis / prognosis of glioblastoma. Background Art

[0002] Glioblastoma multiforme (GBM) is the most common and deadly primary brain tumor, characterized by high morbidity, short survival, low survival rate, high malignancy and rapid development. Traditional treatments include surgical resection, radiotherapy and chemotherapy, which are limited in effectiveness due to GBM's invasion of normal brain tissue, obvious tumor heterogeneity, poor blood-brain barrier penetration ability and inherent glioma drug resistance.

[0003] Mitochondria are vital organelles in cells, and the brain is the organ with the highest mitochondrial energy demand. Slight changes in its energy production will preferentially affect the brain. Mitochondrial RNA produced during mitochondrial transcription is degraded into oligonucleotides of about 2-5bp by RNA degraders. REXO2, as the downstream of RNA degraders, can degrade 2-5bp oligonucleotides into single nucleotides to maintain RNA further circulation homeostasis. Studies have shown that knocking down the expression of this gene in Hela cells will affect cell morphology and mitochondrial structure, causing cell cycle arrest and retention in the G0\G1 phase, and changes in mtDNA and mtRNA levels; knocking out Rexo2 in mice will cause embryonic lethality, while conditional knockout of Rexo2 in cardiomyocytes has no significant effect on the body weight and heart weight of adult mice. At present, the impact and specific mechanism of REXO2 in the occurrence and development of GBM are still unclear. Whether targeting REXO2 has an effect on the development of GBM and the specific mechanism remain to be explored. Summary of the invention

[0004] The purpose of the present invention is to address the above problems and provide an application of REXO2 as a biomarker and therapeutic target for the diagnosis / prognosis of glioblastoma.

[0005] In order to achieve its purpose, the present invention adopts the following technical solution:

[0006] The first aspect of the present invention provides the use of REXO2 as a target in screening or preparing drugs for treating glioblastoma.

[0007] In the application technology scheme, the drug inhibits the expression of REXO2.

[0008] In the application technology scheme, the drug achieves the effect of treating glioblastoma by inhibiting the cloning ability of glioblastoma.

[0009] In the application technology scheme, the glioblastoma cell line is U251.

[0010] The second aspect of the present invention provides the use of a REXO2 expression inhibitor in the preparation of a medicament for treating glioblastoma.

[0011] In the application technology scheme, the drug inhibits the expression of REXO2.

[0012] In the application technology scheme, the expression inhibitor achieves the effect of treating glioblastoma by inhibiting the cloning ability of glioblastoma.

[0013] The third aspect of the present invention provides the use of REXO2 as a target in the preparation of a reagent or a kit for diagnosing glioblastoma.

[0014] A fourth aspect of the present invention provides a use of a reagent for detecting the expression level of REXO2 in the preparation of a product for diagnosing or prognosing a glioblastoma subject.

[0015] The beneficial effects of the present invention are:

[0016] The present study confirmed that REXO2 expression is higher in tumor tissues of GBM patients, and patients with high REXO2 expression have a shorter survival period. The expression of REXO2 increases with the increase of the malignancy of the patient, which proves that REXO2 can be used for the diagnosis and prognosis evaluation of glioblastoma. Subsequent verification experiments showed that knocking down REXO2 can significantly inhibit the cloning ability of U251 cells, indicating that their proliferation ability and tumorigenicity are reduced, which shows that REXO2 can be used as a therapeutic target for glioblastoma. Therefore, it is of potential significance to use REXO2 as a target in the preparation of glioblastoma diagnosis, treatment and prognosis drugs or products. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1is a survival curve of REXO2 expression and survival of GBM patients in the TCGA database in the embodiment of the present application, wherein "survival time (months)" means "survival time (months)", "Surviving" means "survival rate", "Histology: GBM; Subtype: All; Cutoff: median" means that the survival analysis is performed on the histological characteristics of glioblastoma multiforme; including all subtypes of GBM; using the median as the cutoff point, "REXO2Hign" and "REXO2Low" mean patients with high expression of REXO2 and patients with low expression of REXO2, respectively, "n" means the number of observed patient samples, "events" means the number of death events, "median" means the median, and the samples are divided into high expression group and low expression group according to the median, "HR" means Hazard Ratio, that is, risk ratio, which indicates the risk multiple of an event (such as death or disease progression) in one group relative to another group at a certain time point, and "Log-rank p value" and "Wllcoxon p value" are the same as the control group. "value" means two nonparametric test methods. If the p value is less than 0.05, the survival difference between the two groups is considered significant;

[0018] Figure 2 It is a result diagram of the REXO2 expression level of normal tissue samples and GBM patient samples in the three clinical databases of TCGA, CGGA, and Gravedeel in the embodiment of the present application, wherein "non-tumor" means healthy tissue, "GBM" means glioblastoma multiforme patient tissue, and "mRNA expression (log2)" means the expression of REXO2 mRNA transcription level;

[0019] Figure 3 It is a statistical graph of the expression of REXO2 in various grades of GBM patients in the three clinical databases of TCGA, CGGA and Gravedeel in the embodiment of the present application, wherein II, III and IV represent samples of patients with type II, type III and type IV glioblastoma, respectively, and the meaning of “mRNA expression (log2)” is the expression of REXO2 mRNA transcription level;

[0020] Figure 4is a graph of the transcription level of REXO2 in U251 after knocking down REXO2 in the examples of the present application, wherein "Scr" means the U251 cell line infected with PLKO.1-Scr, which serves as a control group, "shRNA#1 and shRNA#6" mean the U251 cell line in which REXO2 was knocked down after being infected with PLKO.1-REXO2, and "Relative mRNA expression of REXO2" means the relative expression level of REXO2 mRNA;

[0021] Figure 5 is a graph showing the experimental results of the clone formation experiment in the embodiment of the present application, wherein: Figure 5 (a) is the staining image of U251 cells before and after knocking down REXO2. Figure 5 (b) is a statistical analysis of the clone-forming ability of U251 cells before and after knocking down REXO2, where "Scr" means the U251 cell line infected with PLKO.1-Scr, which serves as the control group, "shRNA#1 and shRNA#6" mean the U251 cell line with REXO2 knocked down after being infected with PLKO.1-REXO2, and "Clone count" means the number of clones. DETAILED DESCRIPTION

[0022] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0023] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0024] Example 1

[0025] The research method of the present invention is as follows: first, the data in the open tumor clinical sample TCGA, CGGA, and Gravendeel databases were analyzed to explore the expression of REXO2 in GBM patient samples, and then the expression of REXO2 was inhibited in the glioblastoma cell line U251 by shRNA lentivirus, and a glioblastoma cell line with stable knockdown of REXO2 was constructed. Combined with the cloning experiment, it was explored whether knocking down REXO2 affects the proliferation ability and tumorigenicity of the glioblastoma.

[0026] Results: Online database analysis showed that GBM patients had higher REXO2 expression in tumor tissues, and patients with high REXO2 expression had a shorter survival period. The expression of REXO2 increased with the increase in the malignancy of the patient, which proved that REXO2 can be used for the diagnosis and prognosis evaluation of glioblastoma. Subsequent verification experiments showed that knocking down REXO2 could significantly inhibit the cloning ability of U251, indicating that its proliferation ability and tumorigenicity were reduced, indicating that REXO2 can be used as a therapeutic target for glioblastoma.

[0027] The specific experimental process is as follows:

[0028] 1. Main experimental reagents and instruments

[0029]

[0030]

[0031] For other specific conditions not specified, the experiments were carried out according to conventional conditions or those recommended by the manufacturer. Reagents or instruments used without indicating the manufacturer were conventional products that can be purchased commercially.

[0032] 2. Methods

[0033] 2.1 Clarifying the expression of REXO2 in glioma clinical samples and glioma cell lines

[0034] The online analysis website https: / / gliovis.bioinfo.cnio.es was used to analyze the genomes of GBM tumor patients in the TCGA, CGGA, and Gravendeel databases, respectively, to compare the expression levels of REXO2 in 10 normal tissue samples and 528 GBM patient samples, and to compare the expression levels of REXO2 in different grades of GBM patients.

[0035] 2.2 REXO2 regulates glioblastoma function

[0036] 2.2.1 Construction of a glioblastoma cell line with stable knockdown of REXO2

[0037] 1) Lentivirus plasmid construction: REXO2-shRNA interference lentivirus plasmid was constructed by the research group using conventional methods to connect shRNA with PLKO.1 empty plasmid;

[0038] 2) The Gene ID of REXO2 in NCBI is: 25996; the sequence of REXO2-shRNA is as follows:

[0039] sequence name Sequence (5'-3'') SEQ ID NO shREXO2-1-sense chain GCGGATGGTCTGGGTGGACCT SEQ ID NO.1 shREXO2-1-antisense strand AGGTCCACCCAGACCATCCGC SEQ ID NO.2 shREXO2-6-sense chain GAAACATCTTCATTATAGAAT SEQ ID NO.3 shREXO2-6-antisense strand ATTCTATAATGAAGATGTTTC SEQ ID NO.4

[0040] 3) Virus packaging: Prepare HEK 293T cells and culture at 37°C; when the cells grow to 90% density of a 6 cm culture dish, transfect them; the plasmid transfection system is as follows:

[0041] Plasmids Dosage pMD2.G 2.5 μg psPAX2 5μg REXO2-shRNA 2.5 μg Transfection reagent PEI 30μL (1μg / μL)

[0042] Prepare 500 μl serum-free DMEM medium + 30 μl transfection reagent PEI, mix well, and let stand for 5 min; prepare 500 μl serum-free DMEM medium + 2.5 μg target plasmid + 2.5 μg pMD2.G + 5 μg psPAX2, mix well, and let stand for 5 min; mix the two tubes of liquid together and let it stand at room temperature for 20 min; add all the mixed liquid to the 293T culture dish; collect the virus supernatant 48h and 72h after transfection, and filter it using a 0.45 μm filter; aliquot the filtered virus and store it at -20°C.

[0043] 4) Lentivirus infection step: Inoculate cells into six-well plates as needed and place them in an incubator for overnight culture. The density during infection is about 40%-50%; add 1 ml of fresh culture medium + 2 ml of virus solution; 48 hours after infection, add appropriate concentrations of puromycin for stable screening, and use wild-type cell lines plus the same concentration of puromycin for screening as a control. When all wild-type cells die during the screening process, the screening can be stopped.

[0044] 5) Collect some of the screened cells to extract RNA: routine laboratory methods.

[0045] 6) qPCR detection: U251 cells without REXO2 knockdown and with REXO2 knockdown were detected by routine laboratory methods.

[0046] 2.2.2 Clone formation assay

[0047] The cell cloning experiment is an important technical method used to detect items such as cell proliferation ability, invasiveness, and sensitivity to killing factors. On the one hand, the proliferation ability of treated cells is indicated by the cloning ability of cells on cell culture plates after treatment; on the other hand, the tumorigenicity of cells in vivo is evaluated. Not all cancer cells can form tumors in vivo, but the stronger the cloning ability in vitro, the stronger the tumorigenicity in vivo. Therefore, the cloning experiment can be used to determine whether REXO2 knockout affects the proliferation ability and tumorigenicity of glioblastoma.

[0048] 1000 cells / well were plated in a six-well plate and incubated at 37°C for 14 days. The medium was changed every 3 days. The cells were fixed and stained with crystal violet at 14 days. (Data are presented as mean + standard deviation) The experiment was repeated at least three times, and the data were analyzed with GraphPad Prism 8 statistical software. The two groups were compared with the two-tailed Student's t test, and the difference was considered statistically significant when P < 0.05.

[0049] 3. Results

[0050] 3.1 Expression of REXO2 in glioma clinical samples and glioma cell lines

[0051] The survival curve obtained by analyzing the online database is as follows Figure 1 As shown, the red line represents 242 GBM patients with high REXO2 expression, and the blue line represents 246 GBM patients with low REXO2 expression. It can be seen from the figure that patients with high REXO2 expression have a shorter survival period.

[0052] The expression results of REXO2 in normal tissue samples and GBM patient tissue samples are shown in the figure Figure 2 As shown in the figure, compared with normal tissue, the expression level of REXO2 in GBM patient tumor tissue is higher; the expression level of REXO2 in GBM patient tissues of different grades is shown in the figure Figure 3 As shown by Figure 3 It can be seen that the expression of REXO2 increases with the increase of the malignancy of the patient.

[0053] Combination Figure 1-Figure 3 It can be seen that GBM patients have higher REXO2 expression in tumor tissue, patients with high REXO2 expression have a shorter survival period, and the expression of REXO2 increases with the increase of the patient's malignancy, which proves that REXO2 can be used for the diagnosis and prognosis evaluation of glioblastoma.

[0054] 3.2 REXO2 regulates glioblastoma function

[0055] U251 cells were infected with lentivirus containing REXO2-shRNA, and the knockdown efficiency was verified by qPCR. The results are shown in Figure 4 As shown in the figure, it can be seen that the REXO2 transcription level of U251 was significantly reduced compared with the control group.

[0056] The results of clone formation experiments are as follows Figure 5 As shown, the crystal violet-stained cell colonies are monoclonal tumor cells. From the number of monoclones shown in the figure, it can be seen that after REXO2 knockdown, the clone-forming ability of U251 is reduced, indicating that its proliferation ability and tumorigenicity are reduced, and the results are statistically significant.

[0057] In summary, REXO2 can be used for the diagnosis and prognosis evaluation of glioblastoma. REXO2 can be used as a target for the development and preparation of products for the diagnosis or prognosis of glioblastoma subjects. The malignancy of glioblastoma can be determined by detecting the expression level of REXO2. Knockdown of REXO2 can significantly inhibit the cloning ability of U251, indicating that its proliferation ability and tumorigenicity are reduced, which shows that REXO2 can be used as a therapeutic target for glioblastoma. REXO2 can be used as a target for the development, screening or preparation of drugs for the treatment of glioblastoma. By inhibiting the expression of REXO2, the proliferation ability and tumorigenicity of glioblastoma can be inhibited.

Claims

1. Application of REXO2 as a target in screening or preparing drugs for treating glioblastoma.

2. The use according to claim 1, characterized in that: The drug inhibits the expression of REXO2.

3. The use according to claim 2, characterized in that: The drug achieves the effect of treating glioblastoma by inhibiting the cloning ability of glioblastoma.

4. The use according to claim 3, characterized in that: The glioblastoma cell line is U251.

5. Application of REXO2 expression inhibitors in the preparation of drugs for treating glioblastoma.

6. The use according to claim 5, characterized in that: The drug inhibits the expression of REXO2.

7. The use according to claim 5, wherein the expression inhibitor achieves the effect of treating glioblastoma by inhibiting the cloning ability of glioblastoma.

8. Use of REXO2 as a target in the preparation of reagents or kits for diagnosing glioblastoma.

9. Use of a reagent for detecting the expression level of REXO2 in the preparation of a product for diagnosing or prognosing a glioblastoma subject.

Images