Kit for evaluating sensitivity of non-small cell lung cancer to ferroptosis and immunotherapy

Abstract

The invention discloses a kit for evaluating the sensitivity of non-small cell lung cancer to ferroptosis and immunotherapy, the invention provides a reagent for detecting the expression quantity of ALDH16A1 for preparing the kit for evaluating the sensitivity of the non-small cell lung cancer to ferroptosis and immunotherapy, the Ensembl registration number of an ALDH16A1 gene is ENST00000293350.9, the kit comprises the reagent for detecting the expression quantity of the ALDH16A1, and the reagent for detecting the expression quantity of the ALDH16A1 is a reagent for detecting the expression quantity of the ALDH16A1. According to the present invention, qRT-PCR is adopted to detect the expression of ALDH16A1 in total RNA, GAPDH is adopted as a reference gene, the low expression of ALDH16A1 prompts that the non-small cell lung cancer patient is tolerant to immunotherapy, and the high expression of ALDH16A1 prompts that the non-small cell lung cancer patient is sensitive to immunotherapy, such that the auxiliary pre-determination of the sensitivity of the non-small cell lung cancer patient to immunotherapy can be provided, therefore, the applicability of the patient in immunotherapy of the non-small cell lung cancer is evaluated.

Description

Technical Field

[0001] The invention belongs to the field of biomedical technology, and in particular relates to a kit for evaluating the sensitivity of non-small cell lung cancer to ferroptosis and immunotherapy. Background Art

[0002] Lung cancer is the most common tumor with the highest mortality rate, and its incidence and mortality rate rank first among all tumors. Lung cancer is mainly divided into non-small cell lung cancer and small cell lung cancer, among which non-small cell lung cancer is the most common subtype. In recent years, immunotherapy has been widely used in the diagnosis and treatment of non-small cell lung cancer: through immune checkpoint inhibitors, immune cells in the tumor microenvironment are activated to kill tumor cells, thereby achieving the effect of eliminating tumors and prolonging patient survival, bringing good news to patients with non-small cell lung cancer. However, only a part of patients can benefit from immunotherapy, and many patients still have the problem of resistance to immunotherapy. Therefore, there is an urgent need for a series of reliable biomarkers to assist clinicians in predicting the sensitivity of non-small cell lung cancer patients to immunotherapy, which is of great significance to improving the treatment effect of patients and reducing the burden on society.

[0003] At present, some reports have proposed some possible biomarkers (such as tumor mutation load) for predicting the sensitivity of non-small cell lung cancer patients to immunotherapy. However, due to the cumbersome detection process, low accuracy, and verification only in cell or animal models, their clinical application is still very limited. It is still necessary to develop markers with higher sensitivity, specificity and application value for personalized immunotherapy of patients with non-small cell lung cancer.

[0004] Ferroptosis was first proposed by Dr. Brent R. Stockwell of Columbia University in 2012. It is an iron-dependent, new type of programmed death that is different from apoptosis, necrosis, and pyroptosis. Its main mechanism is that external stimuli induce imbalance of reactive oxygen species (ROS) in cells, thereby causing peroxidation of polyunsaturated fatty acids (PUFA) on the biomembrane in the Fenton reaction catalyzed by divalent iron, thereby causing changes in the structure of the phospholipid bilayer, rupture of the cell membrane, and finally cell death. Ferroptosis, as an important form of cell death, participates in a series of pathological and physiological processes. In recent years, ferroptosis has received extensive attention from researchers. Research on the mechanism of ferroptosis and its application in disease diagnosis and treatment has emerged in an endless stream, especially in tumors. At present, many studies have reported that immunotherapy can induce ferroptosis of tumor cells. However, there have been no reports on intervening in ferroptosis-related genes to regulate the level of ferroptosis in tumors and thus improve the resistance of tumors to immunotherapy. Summary of the invention

[0005] In view of the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide a kit for evaluating the sensitivity of non-small cell lung cancer to ferroptosis and immunotherapy. By detecting the expression level of acetaldehyde dehydrogenase 16A1 (ALDH16A1), the sensitivity of non-small cell lung cancer patients to ferroptosis of tumor cells caused by immunotherapy can be judged, and the suitability of immunotherapy for non-small cell lung cancer can be evaluated.

[0006] Based on a series of cell experiments and clinical data verification, the present invention found that the gene ALDH16A1 plays an important mediating role in ferroptosis, and its expression level is correlated with the sensitivity of non-small cell lung cancer cells to ferroptosis inducers and immunotherapy. It can be used as a biomarker to assist in predicting the sensitivity of non-small cell lung cancer patients to immunotherapy, thus filling the gap in this field.

[0007] To achieve the above object, the technical solution adopted by the present invention is:

[0008] The present invention provides use of a reagent for detecting the expression amount of ALDH16A1 in preparing a kit for evaluating the sensitivity of non-small cell lung cancer to ferroptosis and immunotherapy, wherein the Ensembl registration number of the ALDH16A1 gene is ENST00000293350.9.

[0009] Preferably, the kit is used to evaluate whether a patient with non-small cell lung cancer is sensitive or tolerant to immunotherapy.

[0010] Preferably, the kit is used to evaluate the tolerance of patients with small cell lung cancer to the ferroptosis inducer Erastin.

[0011] Preferably, the kit further comprises amplification primers for detecting ALDH16A1 expression, the sequences of which are shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0012] The present invention provides a kit for evaluating the sensitivity of non-small cell lung cancer to ferroptosis and immunotherapy, which comprises a reagent for detecting the expression amount of ALDH16A1, wherein the Ensembl registration number of the ALDH16A1 gene is ENST00000293350.9.

[0013] Preferably, the test sample comes from tumor tissue of a patient with non-small cell lung cancer.

[0014] Preferably, the kit further comprises amplification primers for detecting ALDH16A1 expression, the sequences of which are shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0015] The present invention also provides a method for evaluating the sensitivity of non-small cell lung cancer to ferroptosis and immunotherapy, comprising the following steps:

[0016] Step A: Extracting total RNA from tumor tissue samples of patients with non-small cell lung cancer;

[0017] Step B: qRT-PCR was used to detect the expression of ALDH16A1 in the total RNA, and GAPDH was used as an internal reference gene, wherein the primer sequences for detecting ALDH16A1 are shown in SEQ ID NO:1 and SEQ ID NO:2, and the primer sequences for detecting GAPDH are shown in SEQ ID NO:3 and SEQ ID NO:4;

[0018] Step C: Follow up the survival of patients once a year. The median △CT value of ALDH16A1 relative to the internal reference GAPDH is 10.589 as the cutoff value to distinguish high expression from low expression. △CT>10.589 is low expression, and △CT≤10.589 is high expression. If the low expression of ALDH16A1 in the tissue sample indicates that the patient with non-small cell lung cancer is tolerant to immunotherapy, the high expression of ALDH16A1 indicates that the patient with non-small cell lung cancer is sensitive to immunotherapy.

[0019] Preferably, the total period of follow-up of patient survival is greater than 5 years.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows: first, a high-throughput technology is used to comprehensively and systematically analyze the changes in the sensitivity of A549 non-small cell lung cancer cells to the iron death inducer Erastin after random knockout of a gene, and it is found that the cells are more tolerant to Erastin after ALDH16A1 knockout, and further verified in a co-culture model that knocking out ALDH16A1 in non-small cell lung cancer cells leads to greater tolerance to the killing effect of immune cells, indicating that the expression level of ALDH16A1 is suitable for predicting the sensitivity of non-small cell lung cancer patients to immunotherapy. Subsequently, the expression difference of this gene in non-small cell lung cancer patients and its robust application value in judging the sensitivity to immunotherapy are further confirmed. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The drug toxicity curves of A549 and H358 non-small cell lung cancer cells with ALDH16A1 knockout or overexpression and control to different concentrations of Erastin in the examples are shown.

[0022] Figure 2 These are the results of cell viability testing after co-culture of LLC mouse non-small cell lung cancer cells with ALDH16A1 knockout or overexpression with CD8+ T cells in the examples.

[0023] Figure 3 The prognostic results of the ALDH16A1 expression level in non-small cell lung cancer tissues in the examples. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in combination with the embodiments and drawings. Obviously, the described embodiments are part of the embodiments of the present invention, not all of them, and all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] In the following examples, the whole genome CRISPR / Cas9 knockout screening technology was first used to find that knocking out ALDH16A1 significantly improved the tolerance of A549 non-small cell lung cancer cells to the ferroptosis inducer Erastin, and cell experiments further confirmed this result.

[0026] Considering that immunotherapy also has the effect of causing ferroptosis, ALDH16A1 was knocked out or overexpressed in the LLC mouse non-small cell lung cancer cell line expressing ovalbumin (which can be recognized and killed by CD8+T cells from OT-1 mice), and then co-cultured with CD8+T cells from OT-1 mice at a ratio of 1:1. After 24 hours, the non-adherent CD8+T cells in the supernatant were cleared, and the activity of LLC cells was tested. The results showed that after ALDH16A1 was knocked out, the killing effect of immune cells on tumor cells was significantly reduced, while overexpression of ALDH16A1 led to the opposite effect. It can be inferred that ALDH16A1 is suitable as a prognostic indicator to judge the sensitivity of non-small cell lung cancer patients to immunotherapy.

[0027] Subsequently, the qPCR method was used to detect the expression of ALDH16A1 in surgical resection specimens of 17 patients with non-small cell lung cancer who received anti-PD1 or anti-PD-L1 immunotherapy, and their prognosis was analyzed. The results showed that patients with high expression of ALDH16A1 were more sensitive to immunotherapy than patients with low expression, suggesting a better prognosis. The expression level of ALDH16A1 can be used to predict whether patients with non-small cell lung cancer are sensitive or resistant to immunotherapy.

[0028] Example 1

[0029] 1. Crispr / Cas9 whole-genome high-throughput drug resistance gene screening

[0030] First, a series of sgRNAs were constructed based on the existing Crispr / Cas9 knockout library and transfected into non-small cell lung cancer cells A549. By using an appropriate amount of virus, it was ensured that only one sgRNA or no sgRNA was transferred into each cell, and then puromycin was used to kill cells that had not been transferred into sgRNA. In each A549 cell obtained in this way, a random gene gene was knocked out. Subsequently, the knocked-out cells were treated with the ferroptosis inducer Erastin for screening, and sensitive cells were inhibited or even died, while the normal proliferation of resistant cells was not affected. By performing high-throughput sequencing analysis on sgRNAs in cells before and after treatment, the changes in cell activity after knocking out each gene can be inferred. After this step, it was found that the ALDH16A1 knocked-out cell subpopulation increased significantly compared with the control after Erastin treatment, and the experimental data are shown in Table 1.

[0031] Table 1

[0032] Gene <![CDATA[Log(Fc) Erastin ]]> <![CDATA[Log(Fc) DMSO ]]> <![CDATA[Log(Fc) Erastin -Log(Fc) DMSO ]]> ALDH16A1 3.015 0.374 2.641

[0033] Among them, Log(Fc) Erastin It indicates the logarithm of the expression value of a certain sgRNA after cells were treated with Erastin for 3 days compared with that before drug treatment, while Log(Fc) DMSO It represents the logarithm of the change in expression value of the control group, that is, the same sgRNA after 3 days of DMSO treatment and before drug treatment. It can be seen that after ALDH16A1 knockout, the tolerance of A549 cells to Erastin is enhanced.

[0034] 2. Changes in Erastin and Immunotherapy Resistance in Non-small Cell Lung Cancer Cells after ALDH16A1 Knockout or Overexpression

[0035] ALDH16A1 and corresponding controls were knocked out or overexpressed in A549 and H358 non-small cell lung cancer cells, respectively. The transfected cells were then treated with Erastin, and CCK8 was used to detect cell activity. It was found that compared with the control, the tolerance of cells with ALDH16A1 knockout to Erastin was significantly higher than that of the control group, while overexpression of ALDH16A1 led to increased sensitivity of cells to these two drugs ( Figure 1 ).

[0036] At the same time, in LLC cells expressing Ovalbumin, ALDH16A1 was knocked out or overexpressed, and then co-cultured with CD8+T cells from OT-1 mice. It was found that knocking out ALDH16A1 significantly reduced the killing effect of CD8+T cells on tumor cells, while overexpression produced the opposite effect. Moreover, adding Ferrostatin-1, a specific inhibitor of ferroptosis, to the culture system significantly reduced the killing effect of CD8+T cells on tumor cells, suggesting that immune cells induce ferroptosis of tumor cells and eliminate the difference in sensitivity of LLC cells to immune cells caused by ALDH16A1 knockout / overexpression. It can be seen that knocking out ALDH16A1 significantly enhances the tolerance of non-small cell lung cancer cells to ferroptosis caused by immune cells ( Figure 2 ).

[0037] 3. Expression of ALDH16A1 in tumor tissues of non-small cell lung cancer patients receiving immune checkpoint inhibitors and analysis of patient prognosis

[0038] qRT-PCR was used to detect the expression of ALDH16A1 in tumor tissues of 17 patients with non-small cell lung cancer who received immunotherapy. The patients were then followed up for up to 5 years to compare the association between the gene and the patient's prognosis. The specific steps are as follows:

[0039] (1) Extract total RNA from tissue samples.

[0040] (2) qRT-PCR detection of ALDH16A1 expression: The expression of ALDH16A1 was detected by using the qPCR SYBR Green Master Mix was tested on the QuantStudio 5 fluorescent quantitative PCR instrument provided by Thermo Fisher, and the primer sequences were:

[0041] ALDH16A1:

[0042] Forward: CACCTCGCTGGAGTACGGA (SEQ ID NO: 1);

[0043] Reverse: CCATTCACATAGTGGCCCAAG (SEQ ID NO: 2);

[0044] Internal reference gene GAPDH:

[0045] Forward: AGAAGGCTGGGGCTCATTTG (SEQ ID NO: 3);

[0046] Reverse: AGGGGCCATCCACAGTCTTC (SEQ ID NO: 4).

[0047] The above primers were provided by Shanghai Sangon Biotechnology Co., Ltd.

[0048] (3) Follow-up of patient survival (>5 years) was conducted once a year.

[0049] (4) Survival curve analysis test results, taking the median △CT value of ALDH16A1 relative to the internal reference GAPDH of 10.589 as the cutoff value, so as to distinguish the high / low expression groups, corresponding to different survival conditions, such as Figure 3 As shown, for patients with non-small cell lung cancer receiving immunotherapy, high expression of ALDH16A1 in tumor tissue samples means a better prognosis, suggesting that the patient responds well to immunotherapy. The expression level of ALDH16A1 can be used to predict the sensitivity of patients with non-small cell lung cancer to immunotherapy.

[0050] The expression of ALDH16A1 in tumor samples of patients with non-small cell lung cancer was detected. If the expression of ALDH16A1 was low (i.e., △CT>10.589), the patient was tolerant to immunotherapy. If the expression of ALDH16A1 was high (i.e., △CT≤10.589), the patient was sensitive to immunotherapy.

[0051] The above is only a preferred embodiment of the present invention, but the present invention should not be limited to the contents disclosed in this embodiment. Any equivalent or modification completed without departing from the spirit disclosed in the present invention shall fall within the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting the expression of ALDH16A1 in the preparation of a kit for evaluating the sensitivity of non-small cell lung cancer to ferroptosis and immunotherapy, wherein the Ensembl registration number of the ALDH16A1 gene is ENST00000293350.

9.

2. The use according to claim 1, characterized in that: The kit is used to evaluate whether a patient with non-small cell lung cancer is sensitive or tolerant to immunotherapy.

3. The use according to claim 1, characterized in that: The kit is used to evaluate the tolerance of patients with small cell lung cancer to the ferroptosis inducing agent Erastin.

4. The use according to claim 1, characterized in that: The kit also includes amplification primers for detecting ALDH16A1 expression, and the sequences are shown in SEQ ID NO: 1 and SEQ ID NO:

2.

5. A kit for evaluating the sensitivity of non-small cell lung cancer to ferroptosis and immunotherapy, characterized in that: The method comprises a reagent for detecting the expression level of ALDH16A1, wherein the Ensembl accession number of the ALDH16A1 gene is ENST00000293350.

9.

6. The kit for evaluating the sensitivity of non-small cell lung cancer to ferroptosis and immunotherapy according to claim 5, characterized in that: The kit also includes amplification primers for detecting ALDH16A1 expression, and the sequences are shown in SEQ ID NO: 1 and SEQ ID NO:

2.

7. The kit for evaluating the sensitivity of non-small cell lung cancer to ferroptosis and immunotherapy according to claim 5, characterized in that: The test samples came from tumor tissues of patients with non-small cell lung cancer.

8. A method for evaluating the sensitivity of non-small cell lung cancer to ferroptosis and immunotherapy, characterized in that: The following steps are involved: Step A: Extracting total RNA from tumor tissue samples of patients with non-small cell lung cancer; Step B: qRT-PCR was used to detect the expression of ALDH16A1 in the total RNA, and GAPDH was used as an internal reference gene, wherein the primer sequences for detecting ALDH16A1 are shown in SEQ ID NO:1 and SEQ ID NO:2, and the primer sequences for detecting GAPDH are shown in SEQ ID NO:3 and SEQ ID NO:4; Step C: Follow up the survival of patients once a year, and take the median △CT value of ALDH16A1 relative to the internal reference GAPDH as 10.589 as the cutoff value to distinguish high and low expression of ALDH16A1. △CT>10.589 is low expression, and △CT≤10.589 is high expression; If ALDH16A1 is lowly expressed in tissue samples, it indicates that patients with non-small cell lung cancer are tolerant to immunotherapy; if ALDH16A1 is highly expressed in tissue samples, it indicates that patients with non-small cell lung cancer are sensitive to immunotherapy.

Images