SNP (Single Nucleotide Polymorphism) molecular marker related to multi-week-age weight of chicken and application of SNP molecular marker

Abstract

The invention discloses an SNP molecular marker related to the weight of chickens at multiple weeks and application thereof, and particularly relates to an SNP site related to the weight of chickens at multiple weeks such as two weeks, four weeks, six weeks, eight weeks, ten weeks and twelve weeks, the SNP site chr1: 170585684 is located in an RCBTB1 intron region, the weight of chickens at multiple weeks is measured and recorded, and the weight of chickens at multiple weeks can be obtained. According to the invention, 1164 chickens are sequenced by using a re-sequencing technology, whole genome association analysis is carried out to obtain an SNP locus influencing weights of different week ages, the SNP frequency of the SNP locus in other re-sequenced low-weight chicken breeds and high-weight chicken breeds is counted, and it is found that the SNP locus has significant differences in the low-weight chicken breeds and the high-weight chicken breeds. T in high-body-weight chickens is a dominant allele, C in low-body-weight chickens is a dominant allele, and in a low-body-weight group, the body weight of the breeding group can be increased by selecting individuals of the allele T at the site.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to a SNP molecular marker associated with the weight of a chicken at multiple weeks of age and an application thereof, and specifically to a SNP molecular marker associated with the weight of a chicken at two weeks of age, four weeks of age, six weeks of age, eight weeks of age, ten weeks of age and twelve weeks of age and an application thereof. Background Art

[0002] Chicken is one of the main meat varieties in China. It has the characteristics of high protein, low fat and low cholesterol. In recent years, my country's chicken production has continued to grow. Improving muscle yield and improving chicken quality have become the work that breeding scientists have been exploring for a long time. Classical breeding methods have made great contributions to the improvement of agricultural animal production traits. With the continuous advancement of genomic work and the extensive development of genetic markers, breeding scientists can select chickens with good yield and quality characteristics for breeding based on specific genetic markers. These genetic markers can help breeding scientists more accurately evaluate and select the genetic potential of chickens and accelerate the breeding process.

[0003] SNP (Single Nucleotide Polymorphism) is one of the common forms of genetic variation in genetics. SNP has the advantages of large quantity, high frequency, and low mutation rate, and plays an important role in genetic research and molecular selection breeding. However, there is still a lack of molecular markers with clear functions and significant effects in the current molecular breeding practice of broilers. Therefore, mining molecular markers with large effects and accuracy is the current research focus. If we can find SNP molecular markers related to the target traits of chickens and ultimately analyze the molecular mechanism of this site, it will greatly promote the genetic improvement of chickens and bring breakthrough progress to the field of poultry breeding. Summary of the invention

[0004] In view of the deficiencies in the prior art, the present invention aims to provide a SNP molecular marker associated with the weight of chickens at multiple weeks of age and an application thereof. Resequencing technology was used to sequence 1164 individuals of a hybrid chicken population with different weight records at different weeks of age, and GWAS analysis was performed to obtain a SNP site significantly associated with the weight of chickens at two, four, six, eight, ten, and twelve weeks of age. The SNP is rs13971913 (chr1:170585684) located in the genome version GRCg6a104. The polymorphism of the SNP molecular marker is C and T, including three genotypes of CC, TT and CT. The SNP frequency of the SNP in other low-weight chicken breeds and high-weight chicken breeds in resequencing was statistically analyzed, and it was found that there was a significant difference between the low-weight chicken breeds and the high-weight chicken breeds. T was the dominant allele in the high-weight chickens, and C was the dominant allele in the low-weight chickens. In the group with lower weight, the weight of the chickens can be increased by selecting individuals with allele T.

[0005] In order to solve the above technical problems, the technical solution provided by the present invention is:

[0006] A SNP molecular marker associated with chicken weight at multiple weeks of age,

[0007] The SNP molecular marker is located at chr1:170585684 of genome GRCg6a 104, and the alleles of the SNP site are T and C; including three genotypes of TT, TC and CC;

[0008] The economic traits are the weight of chickens at two weeks of age, four weeks of age, six weeks of age, eight weeks of age, ten weeks of age, and twelve weeks of age;

[0009] T is the dominant allele in high-weight chickens, and C is the dominant allele in low-weight chickens.

[0010] Preferably,

[0011] The SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO.1.

[0012] The application of the above-mentioned SNP molecular markers in the detection of weight traits of chickens at multiple weeks of age.

[0013] The above application includes the following steps:

[0014] (1) detecting the genotype of the sample chicken at the SNP site;

[0015] (2) Select sample chickens with T / T genotype for breeding of superior strains.

[0016] Preferably,

[0017] The step (1) can be performed by direct sequencing, or by first amplifying the gene fragment containing the SNP molecular marker and then detecting it. For example, primers are designed to amplify the fragment containing the SNP molecular marker from the sequence shown in SEQ ID NO.1, and then the allele at the site is detected.

[0018] A primer pair for amplifying the SNP site fragment according to claim 1, wherein the sequences of the primer pair are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0019] The application of the above-mentioned SNP molecular markers in marker-assisted selection breeding,

[0020] Select chickens with T / T genotype for breeding.

[0021] The beneficial effects of the present invention are:

[0022] The present invention provides a SNP molecular marker related to the weight of chickens at multiple weeks of age and its application. By performing genotyping on the SNP site chr1:170585684 of 1164 chickens, SNP frequency analysis was performed on the site in low-weight chickens and high-weight chickens, and it was found that T was a dominant allele in high-weight chickens and C was a dominant allele in low-weight chickens. In a group with lower weight, the weight of the group can be increased by selecting individuals with allele T. The site is used as a SNP molecular marker in the selection and breeding of excellent chickens, and can predict the weight early, quickly, at low cost and effectively. It has broad application prospects in chicken breed improvement and can achieve excellent economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0024] Figure 1A Manhattan plot of the GWAS results for body weight at two weeks of age

[0025] Figure 1B Manhattan plot of the GWAS results for body weight at four weeks of age

[0026] Figure 1C Manhattan plot of the GWAS results for weight at six weeks of age

[0027] Figure 1D Manhattan plot of the GWAS results for weight at eight weeks of age

[0028] Figure 1E Manhattan plot of the GWAS results for body weight at ten weeks of age

[0029] Figure 1F Manhattan plot of the GWAS results for weight at 12 weeks of age DETAILED DESCRIPTION

[0030] The preferred embodiments of the present invention are described below in conjunction with the accompanying drawings. It should be understood that the following embodiments are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0031] The invention provides a SNP molecular marker related to the weights of chickens at multiple weeks of age and an application thereof. The SNP molecular marker is located in an intron region of RCBTB1, chr1:170585684 of genome GRCg6a 104, and is located at the 101st base in the nucleotide sequence shown in SEQ ID NO.1; the alleles of the SNP site are C and T; the economic traits are the weights of the chickens at two weeks of age, four weeks of age, six weeks of age, eight weeks of age, ten weeks of age and twelve weeks of age; T is a dominant allele in high-weight chickens, and C is a dominant allele in low-weight chickens; in a group with lower weight, the weight of the chickens can be increased by selecting individuals with allele T.

[0032] SEQ ID NO.1(chr1:170585584-170585784)

[0033] caccgtaacaaggctacagtcccagtcacgacatgcattttcctttttattttcaataagaagctgagtcattagcacaacttaat

[0034] gaagccattcgctctggatgagacaccctaaaaaacccacctatattccagcaagacgcataacagaaataagaatgcaaag

[0035] gccccacggagtaaggctccaaagatttgttctc

[0036] Example 1 Genome-wide association analysis of body weight in chickens at different ages

[0037] 1. Test materials

[0038] The chickens were taken as the research objects, and the body weights of 1164 chickens were measured at two weeks, four weeks, six weeks, eight weeks, ten weeks and twelve weeks of age. The measurements were carried out strictly in accordance with the internal regulations of the chicken farm.

[0039] 2. Test methods

[0040] 2.1 Phenotypic determination

[0041] When the chickens reach the corresponding age, place each chicken on the weighing device and wait for the chicken to remain relatively quiet and balanced, then record the displayed weight value and record the gender.

[0042] 2.2 Chicken whole-genome SNP typing method based on resequencing technology

[0043] The sequencing data were aligned to the GRCg6a 104 reference genome using gtx align, SNP sites were detected using Basevar, and the genotype probability of all individuals was estimated using STITCH. For the SNP sites obtained by typing, they were filtered according to MAF < 0.05, site call rate < 0.95, and info score < 0.4, and a total of 7,901,521 SNPs were retained for high-quality sites.

[0044] The specific steps of amplification are as follows: blood tissue of the hybrid population sample is taken and DNA is extracted using the total DNA extraction kit of Beijing Tiangen Biotechnology Co., Ltd. The OD value of the extracted DNA is detected by a spectrophotometer, i.e., OD 260 / OD 280 and OD 260 / OD 230 The concentration and purity of DNA were determined by the ratio, and the integrity of DNA was detected by agarose gel electrophoresis. The genome of the hybrid population sample was used as a template, and the corresponding primers were designed for its sequence using Oligo7 software. The sequence was amplified using Novozyme 2×Taq Master Mix. The reaction system was as follows: 95℃, pre-denaturation for 3min; 95℃, denaturation for 15s, 60℃, annealing for 15s, 72℃, extension for 15s, 30 cycles; 72℃, complete extension for 5min. Finally, agarose gel electrophoresis was used to detect the size of the product fragment.

[0045] Primer pair sequence for amplifying the fragment containing the above SNP site:

[0046] The primer pair sequences are:

[0047] F:CACCGTAACAAGGCTACAGT(SEQ ID NO.2)

[0048] R:GAGAACAAATCTTTGGAGC(SEQ ID NO.3)

[0049] 2.3 Genome-wide association analysis

[0050] FastGWA was used to conduct genome-wide association analysis on the body weight phenotypes of 1164 chickens at two weeks, four weeks, six weeks, eight weeks, ten weeks and twelve weeks.

[0051] 2.4 SNP loci significantly associated with body weight traits

[0052] The detection of significant sites at the genome level was performed, and the significant sites were identified based on FDR < 0.05.

[0053] 3. Results and Analysis

[0054] The present invention used 1164 chickens from a hybrid population as the subjects, and used 7,901,521 SNPs obtained by resequencing technology to perform GWAS analysis on the weight of chickens at different ages, and identified a SNP (chr1: 170585684) site that was significantly correlated with the weight of chickens at different ages, as shown in Figure 1.

[0055] Example 2 Frequency distribution of SNP (chr1: 170585684) in different breeds of chickens

[0056] 1. Test materials

[0057] Low-weight chicken breeds: Bearded chicken (n=15), Beijing Oily chicken (n=25), Camellia chicken (n=30), Daweishan miniature chicken (n=33), Silky chicken (n=57) and Tibetan chicken (n=154).

[0058] High-weight chicken breeds: Lingnan yellow-feathered broilers (n=16), white-feathered broilers (n=20), Cobb chickens (n=33) and recessive white-feathered chickens (n=113).

[0059] 2. Test methods

[0060] 2.1 Data Collection

[0061] The whole genome resequencing data from the above six low-weight chicken breeds and four high-weight chicken breeds were downloaded from the SRA database of NCBI (https: / / ncbi.nlm.nih.gov / sra).

[0062] 2.2 SNP typing using GATK

[0063] The GTX server gtx wgs command was used to construct gVCF for the above resequencing samples based on the GRCg6a 104 reference genome, and then the gtx gi and gtxjoint commands were used to perform joint variation detection on all gVCF samples and obtain the genotype VCF file.

[0064] 2.3 SNP Filtering and Quality Control

[0065] After the joint variation detection was completed, the SelectVariants tool of the GATK software package was used to extract SNPs sites, and then the VariantFiltration tool of the GATK software package was used to perform quality control on the whole genome resequencing data according to the following hard filtering parameters: MQ<40.0, FS>60.0, SOR>3.0, MQRankSum<-12.5, ReadPosRankSum<-8.0, QUAL<30. After the above quality control, a total of 44,272,587 resequencing SNPs sites were obtained.

[0066] 2.4 Calculate the allele frequency of chr1:170585684 in different chicken breeds

[0067] The allele frequency of chr1:170585684 in different chicken breeds was calculated using vcftools--freq2.

[0068] 3. Results and Analysis

[0069] The SNP frequency distribution results of SNP (chr1: 170585684) in different low-weight chicken breeds and high-weight chicken breeds are shown in Table 1. There are significant differences between low-weight chicken breeds and high-weight chicken breeds. T is the dominant allele in high-weight chickens, and C is the dominant allele in low-weight chickens.

[0070] Table 1 SNP frequency of SNP (chr1: 170585684) in different low-weight and high-weight chicken breeds

[0071]

[0072]

[0073] The analysis found a SNP molecular marker associated with the weight traits of chickens at multiple weeks of age. In a group with lower body weight, the weight of the breeding group can be increased by breeding individuals with the T / T allele.

[0074] The contents not described in detail in this specification belong to the prior art known to professional and technical personnel in this field.

[0075] Finally, it should be noted that the above description is only a preferred example of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A SNP molecular marker associated with the weight of chickens at multiple weeks of age, characterized in that: The SNP molecular marker is located at chr1:170585684bp of the genome GRCg6a 104, and the alleles of the SNP site are T and C; including three genotypes of TT, TC and CC; The economic traits are the weight of chickens at two weeks of age, four weeks of age, six weeks of age, eight weeks of age, ten weeks of age, and twelve weeks of age; T is the dominant allele in high-weight chickens, and C is the dominant allele in low-weight chickens.

2. The SNP molecular marker associated with the weight of chickens at multiple weeks of age according to claim 1, characterized in that: The SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO.

1.

3. Use of the SNP molecular marker described in claim 1 in detecting weight traits of chickens at multiple weeks of age.

4. The use according to claim 3, characterized in that: The following steps are involved: (1) detecting the genotype of the sample chicken at the SNP site; (2) Select sample chickens with T / T genotype for breeding of superior strains.

5. The use according to claim 4, characterized in that: The step (1) can be performed by direct sequencing, or by first amplifying the gene fragment containing the SNP molecular marker and then testing.

6. A primer pair for amplifying a fragment containing the SNP site according to claim 1, characterized in that: The primer pair sequences are shown in SEQ ID NO.2 and SEQ ID NO.

3.

7. Use of the SNP molecular marker according to claim 1 in marker-assisted selection breeding, characterized in that: Select chickens with T / T genotype for breeding.

Images