Molecular genetic marker influencing porcine sexual maturity and application thereof

Abstract

The invention discloses a molecular genetic marker influencing porcine sexual maturity and application thereof. According to the invention, RBP1 is taken as a research object, and a molecular and cell biological method is adopted to research the relevance between RBP1 and an initial estrus period: six SNP loci in an RBP1 promoter region are related to the initial estrus period. The further research shows that the g.80408109Tgt is a g.80408109 The activity of the promoter of the CC genotype of the C site is obviously higher than that of the promoter of the TT genotype, g.80409632At; the activity of the promoter of the AA genotype at the G site is obviously higher than that of the promoter of the GG genotype, and the RBP1 is proved to be capable of inhibiting ferroptosis of granulosa cells. Therefore, the mutation of the RBP1 promoter region can influence the expression of the RBP1, and the RBP1 accelerates the initial estrus initiation by inhibiting ferroptosis of the porcine ovarian granular cells. The method has good application value in research on ovarian follicle development, initial estrus initiation and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of cell engineering and gene engineering, and specifically relates to a molecular genetic marker affecting pig sexual maturity and an application thereof. Background Art

[0002] As an important part of my country's animal husbandry, pig farming plays an important role in ensuring the supply of pork and rural economic development. In the actual production process, the incidence of gilts only giving birth to one litter is relatively high. However, for pig farms, if gilts cannot give birth to three litters in a row, it will cause huge losses in production benefits. Therefore, it is crucial to improve the productivity of pig farms by breeding gilts with high reproductive performance.

[0003] Sexual maturity refers to the physiological state in which an animal reaches the stage of sexual reproduction, which is usually manifested by the maturation of gonads, the increase of sex hormone levels and the appearance of sexual behavior. The first estrus is one of the obvious manifestations of sexual maturity, which indicates the period of time when an animal first shows estrus or ovulates. Studies have found that the earlier the sexual maturity, the higher the possibility of multiple births and the longer the sow's useful life.

[0004] Retinol-binding protein 1 (RBP1) belongs to the RBPs family and can bind to retinol and retinal with high affinity to promote the biosynthesis of retinoic acid. Previous studies have found that RBP1 can drive the differentiation of granulosa cells and is enriched in the adenosine triphosphate-dependent activity regulation pathway. Studies have found that the expression of RBP1 protein in large bovine follicles is significantly higher than that in small follicles, and the protein level of RBP1, E2 concentration and retinoic acid concentration in follicular fluid are positively correlated. The protein expression of RBP1 in the ovaries of buffaloes in puberty is significantly higher than that before the onset of puberty. This suggests that RBP1 plays an important role in sexual maturation.

[0005] The promoter is an important component of gene expression regulation, which can recruit transcription complexes to the start transcription site of the gene and initiate the transcription process of the gene. Single nucleotide polymorphism (SNP) in the promoter region may affect the expression level of related genes, thereby affecting sexual maturity.

[0006] Ferroptosis is a non-apoptotic cell death that is dependent on iron and oxidative stress. Studies have found that iron accumulation in GCs can trigger ferroptosis and hinder the development of follicles. Inhibiting the ferroptosis pathway can reduce the excessive death of granulosa cells, thereby improving the growth and maturation of follicles and affecting sexual maturation. Summary of the invention

[0007] In order to overcome the shortcomings and deficiencies of the prior art, one of the objectives of the present invention is to provide a molecular genetic marker that affects the sexual maturity of pigs.

[0008] The second object of the present invention is to provide the application of the above-mentioned molecular genetic markers that affect pig sexual maturity.

[0009] The purpose of the present invention is achieved through the following technical solutions:

[0010] A molecular genetic marker that affects the sexual maturity of pigs, comprising at least one of the following SNP molecular markers:

[0011] (1) The SNP site corresponding to the T>C mutation at position g.80408109 (i.e., -782 bp in the promoter region of the retinol binding protein 1 (RBP1) gene) on chromosome 13 of the pig reference genome Sscrofa11.1;

[0012] (2) The SNP site corresponding to the T>C mutation at position g.80408854 (i.e., -1527 bp in the promoter region of the retinol binding protein 1 (RBP1) gene) on chromosome 13 of the pig reference genome Sscrofa11.1;

[0013] (3) The SNP site corresponding to the G>A mutation at position g.80408992 (i.e., -1665 bp in the promoter region of the retinol binding protein 1 (RBP1) gene) on chromosome 13 of the pig reference genome Sscrofa11.1;

[0014] (4) The SNP site corresponding to the C>T mutation at position g.80409145 (i.e., -1818 bp in the promoter region of the retinol binding protein 1 (RBP1) gene) on chromosome 13 of the pig reference genome Sscrofa11.1;

[0015] (5) The SNP site corresponding to the A>G mutation at position g.80409353 (i.e., -2026 bp in the promoter region of the retinol binding protein 1 (RBP1) gene) on chromosome 13 of the pig reference genome Sscrofa11.1;

[0016] (6) The SNP site corresponding to the A>G mutation at position g.80409632 (i.e., -2305 bp in the promoter region of the retinol binding protein 1 (RBP1) gene) on chromosome 13 of the pig reference genome Sscrofa11.1;

[0017] (7) The SNP site corresponding to the A>G mutation at position g.80409169 (i.e., -1842bp in the promoter region of the retinol binding protein 1 (RBP1) gene) on chromosome 13 of the pig reference genome Sscrofa11.1.

[0018] Furthermore, the molecular genetic marker that affects the sexual maturity of pigs is preferably at least one of SNP molecular marker (1) and SNP molecular marker (6).

[0019] The application of the molecular genetic markers affecting pig sexual maturity includes at least one of the following applications:

[0020] A. Application in assessing the age of first estrus in pigs;

[0021] B. Application in judging the onset of puberty in pigs;

[0022] C. Application in breeding high-yield pigs.

[0023] Further, in the application A, the genotype of the g.80408109 locus is detected, and the age of first puberty of individuals with the genotype of CC is shorter than that of TC and TT individuals; and / or, the genotype of the g.80408854 locus is detected, and the age of first puberty of individuals with the genotype of CC is shorter than that of TC and TT individuals; and / or, the genotype of the g.80408992 locus is detected, and the age of first puberty of individuals with the genotype of AA is shorter than that of GA and GG individuals; and / or, the genotype of the g.80409145 locus is detected. The genotype of the g.80409353 locus is detected, and the age at first puberty of individuals with the genotype of TT is shorter than that of individuals with the genotype of CT and CC; and / or, the genotype of the g.80409353 locus is detected, and the age at first puberty of individuals with the genotype of GG is shorter than that of individuals with the genotype of AG and AA; and / or, the genotype of the g.80409632 locus is detected, and the age at first puberty of individuals with the genotype of AA is shorter than that of individuals with the genotype of GA and GG; and / or, the genotype of the g.80409169 locus is detected, and the age at first puberty of individuals with the genotype of GG is shorter than that of individuals with the genotype of AG and AA.

[0024] Further, in the application B, the genotype of the g.80408109 locus is detected, and the individuals with the genotype of CC have the onset of puberty faster than the TC and TT individuals; and / or, the genotype of the g.80408854 locus is detected, and the individuals with the genotype of CC have the onset of puberty faster than the TC and TT individuals; and / or, the genotype of the g.80408992 locus is detected, and the individuals with the genotype of AA have the onset of puberty faster than the GA and GG individuals; and / or, the genotype of the g.80409145 locus is detected. The genotype of the g.80409353 locus is detected, and the first puberty of the individual with the genotype of TT is faster than that of the CT and CC individuals; and / or, the genotype of the g.80409353 locus is detected, and the first puberty of the individual with the genotype of GG is faster than that of the AG and AA individuals; and / or, the genotype of the g.80409632 locus is detected, and the first puberty of the individual with the genotype of AA is faster than that of the GA and GG individuals; and / or, the genotype of the g.80409169 locus is detected, and the first puberty of the individual with the genotype of GG is faster than that of the AG and AA individuals.

[0025] Further, in the application C, the genotype of the g.30088284 locus is detected, and individuals with genotypes of GA and AA are selected as breeding pigs; and / or, the genotype of the g.30088004 locus is detected, and individuals with genotypes of TT are selected as breeding pigs; the genotype of the g.80408109 locus is detected, and individuals with genotypes of CC are selected as breeding pigs; and / or, the genotype of the g.80408854 locus is detected, and individuals with genotypes of CC are selected as breeding pigs; and / or, the genotype of the g.8040899 locus is detected. The genotype of the g.2 site is detected, and the individuals with the genotype of AA are selected as breeding pigs; and / or, the genotype of the g.80409145 site is detected, and the individuals with the genotype of TT are selected as breeding pigs; and / or, the genotype of the g.80409353 site is detected, and the individuals with the genotype of GG are selected as breeding pigs; and / or, the genotype of the g.80409632 site is detected, and the individuals with the genotype of AA are selected as breeding pigs; and / or, the genotype of the g.80409169 site is detected, and the individuals with the genotype of GG are selected as breeding pigs.

[0026] Furthermore, the pigs include any one of Duroc and its synthetic lines.

[0027] The above applications are for non-diagnostic purposes.

[0028] A primer for identifying the above-mentioned molecular genetic markers affecting pig sexual maturity, comprising:

[0029] F: 5′-ACACAGATCCCCTCTCTC-3′;

[0030] R: 5′-GAAATTCTCGTTGGCCAGCATCT-3′.

[0031] Application of the RBP1 gene in regulating ferroptosis of pig ovarian granulosa cells, wherein the application is any one or more of the following applications:

[0032] I. Application of overexpression of RBP1 gene to inhibit ferroptosis of ovarian granulosa cells in vitro;

[0033] II. Application of knocking down RBP1 gene to promote ferroptosis of ovarian granulosa cells in vitro.

[0034] Furthermore, the overexpression of RBP1 gene is achieved by the following method: connecting the nucleic acid molecule encoding the pig RBP1 gene to the pcDNA3.1 plasmid to construct an overexpression vector; and then transfecting the overexpression vector containing the RBP1 gene into sow ovarian granulosa cells cultured in vitro.

[0035] Furthermore, the knockdown of RBP1 gene is achieved by transfecting siRNA, and the siRNA sequence is as follows: RBP1-siRNA: 5′-GCAAACAGGACATCGTCTT-3′.

[0036] The promotion or inhibition of ferroptosis is determined by measuring the total iron and malondialdehyde (MDA) content and comparing the mRNA and protein expression levels of pathway marker genes.

[0037] The verification results of the present invention are as follows:

[0038] 1. The RBP1 promoter region with a length of 2071 bp was cloned.

[0039] 2. It was found that there were 14 SNPs sites in the promoter region of RBP1 gene, namely g.80407902A>G, g.80408010G>T, g.80408050C>G, g.80408083C>T, g.80408109T>C, g.80408237C>A, g.80408481G>A, g.80408854T>C, g.80408992G>A, g.80409145C>T, g.80409169A>G, g.80409353A>G, g.80409546A>C, and g.80409632A>G.

[0040] 3. It was found that there were two genotypes at the above six loci: g.80407902A>G, g.80408010G>T, g.80408050C>G, g.80408083C>T, g.80408237C>A, and g.80408481G>A, and three genotypes at the above eight loci: g.80408109T>C, g.80408854T>C, g.80408992G>A, g.80409145C>T, g.80409169A>G, g.80409353A>G, g.80409546A>C, and g.80409632A>G.

[0041] 4. It was found that g.80407902A>G site AA is the dominant genotype, g.80408010G>T site GG is the dominant genotype, g.80408050C>G site CC is the dominant genotype, g.80408083C>T site CC is the dominant genotype, g.80408109T>C site CC and TC genotype frequencies are the same, g.80408237C>A site CC is the dominant genotype, g.80408481G>A site GG is the dominant genotype. Genotype, g.80408854T>C site CC is the dominant genotype, g.80408992G>A site AA is the dominant genotype, g.80409145C>T site TT is the dominant genotype, g.80409169A>G site GG is the dominant genotype, g.80409353A>G site GG is the dominant genotype, g.80409546A>C site AA is the dominant genotype, and g.80409632A>G site AG is the dominant genotype.

[0042] 5. g.80407902A>G site, heterozygosity is 0.04136, effective number of alleles is 1.043, polymorphic information content is 0.04051, and the P value of Hardy-Weinberg equilibrium is 0. g.80408010G>T site, heterozygosity is 0.13695, effective number of alleles is 1.159, polymorphic information content is 0.12757, and the P value of Hardy-Weinberg equilibrium is 1.751e-30. g.80408050C>G site, heterozygosity is 0.13695, effective number of alleles is 1.159, polymorphic information content is 0.12757, and the P value of Hardy-Weinberg equilibrium is 1.751e-30. g.80408083T>C site, heterozygosity is 0.15473, effective number of alleles is 1.183, polymorphic information content is 0.14276, and the P value of Hardy-Weinberg equilibrium is 1.424e-22. g.80408109T>C site, heterozygosity is 0.48324, effective number of alleles is 1.935, polymorphic information content is 0.36648, and the P value of Hardy-Weinberg equilibrium is 5.643e-01. g.80408237C>A site, heterozygosity is 0.14293, effective number of alleles is 1.167, polymorphic information content is 0.13271, and the P value of Hardy-Weinberg equilibrium is 1.829e-27. g.80408481G>A site, heterozygosity is 0.12485, effective number of alleles is 1.143, polymorphic information content is 0.11706, and the P value of Hardy-Weinberg equilibrium is 4.236e-38. g.80408854T>C site, heterozygosity is 0.49446, effective number of alleles is 1.978, polymorphic information content is 0.37221, and the P value of Hardy-Weinberg equilibrium is 3.157e-01. g.80408992G>A site, heterozygosity is 0.49688, effective number of alleles is 1.988, polymorphic information content is 0.37344, and the P value of Hardy-Weinberg equilibrium is 2.831e-01. g.80409145C>T site, heterozygosity is 0.49688, effective number of alleles is 1.988, polymorphic information content is 0.37344, and the P value of Hardy-Weinberg equilibrium is 2.831e-01. g.80409169A>G site, heterozygosity is 0.46182, effective number of alleles is 1.858, polymorphic information content is 0.35518, and the P value of Hardy-Weinberg equilibrium is 1.580e-01. g.80409353A>G site, heterozygosity is 0.48303, effective number of alleles is 1.934, polymorphic information content is 0.36637, and the P value of Hardy-Weinberg equilibrium is 2.792e-01.At the g.80409546A>C site, the heterozygosity was 0.21875, the effective number of alleles was 1.280, the polymorphic information content was 0.19482, and the P value of Hardy-Weinberg equilibrium was 1.210e-11. At the g.80409632A>G site, the heterozygosity was 0.49008, the effective number of alleles was 1.961, the polymorphic information content was 0.36999, and the P value of Hardy-Weinberg equilibrium was 6.343e-01.

[0043] 6. The RBP1 promoter region g.80408109T>C, g.80408854T>C, g.80408992G>A, g.80409145C>T, g.80409353A>G, g.80409632A>G were extremely significantly correlated with puberty (P<0.01), and g.80409169A>G was significantly correlated with puberty (P<0.05).

[0044] 7. The promoter activity of CC genotype at g.80408109T>C site was significantly higher than that of TT genotype. The promoter activity of AA genotype at g.80409632A>G site was significantly higher than that of GG genotype.

[0045] 8. OE-NC, OE-RBP1 at a concentration of 0.25 ng / μL and 100 nM siRNA-NC (hereinafter referred to as KD-NC), siRNA-RBP1 (hereinafter referred to as KD-RBP1) were transfected into GCs respectively. qPCR results showed that compared with the OE-NC group, OE-RBP1 treatment significantly upregulated the expression of RBP1 mRNA (P<0.01). Compared with the KD-NC group, the KD-RBP group downregulated the expression of RBP1 by 86%, and the knockdown effect was better, reaching a significant level (P<0.05). Therefore, a plasmid concentration of 0.25 ng / μL and 100 nM siRNA were selected for subsequent experiments. WB was used to detect the changes in intracellular RBP1 protein expression after treatment with OE-NC, OE-RBP1, KD-NC and KD-RBP1. The results showed that compared with the OE-NC group, the RBP1 protein expression level in the OE-RBP1 group was increased, and compared with the KD-NC group, the RBP1 protein expression level in the KD-RBP1 group was decreased.

[0046] 9. The volcano plot analysis showed that compared with the OE-NC group, there were 976 genes upregulated and 1643 genes downregulated in the OE-RBP1 group. Based on the significantly different genes between the two groups, GO enrichment analysis was performed on the differentially expressed genes, and the results showed that the differentially expressed genes were mainly involved in biological processes such as cell death and glutathione metabolism.

[0047] 10. Compared with the OE-NC group, the intracellular Fe content in the OE-RBP1 group was extremely significantly decreased (P<0.01). Compared with the KD-NC group, the intracellular Fe content in the KD-RBP1 group was significantly increased (P<0.05).

[0048] 11. Compared with the OE-NC group, the MDA concentration in the OE-RBP1 group was significantly decreased (P<0.05). Compared with the KD-NC1 group, the MDA concentration in the KD-RBP1 group was significantly increased (P<0.05).

[0049] 12. Compared with the control group, overexpression of RBP1 significantly upregulated the mRNA levels of GPX4, SLC7A11, FTH1 and CBS (P<0.05), significantly downregulated the mRNA levels of P53, NOX1, NOX2, LPCAT3 and ACSL4 (P<0.05), and extremely significantly downregulated the mRNA levels of TFRC and COX2 (P<0.01). At the same time, the protein expression of GPX4 and FTH1 was upregulated and the protein expression of P53 was downregulated. After knocking down RBP1, the mRNA levels of GPX4 and FTH1 were significantly downregulated (P<0.05), the mRNA levels of SLC7A11 and CBS were extremely significantly downregulated (P<0.01), the mRNA level of COX2 was significantly upregulated (P<0.05), and the mRNA levels of TFRC, P53, NOX1, NOX2, LPCAT3 and ACSL4 were extremely significantly upregulated (P<0.01). At the same time, it downregulated the protein expression of GPX4 and FTH1 and upregulated the protein expression of P53.

[0050] Compared with the prior art, the present invention has the following advantages and effects:

[0051] 1. The present invention uses a binary hybrid population of Duroc and Country Black pigs as the research object, collects Duroc Black pig ear samples, clones the nucleotide sequence of the RBP1 promoter region of each pig by PCR technology, and performs Sanger sequencing of a single sample, and a total of 14 SNPs were found.

[0052] 2. The SNPs loci were successfully genotyped using SnapGene 4.2.4 software.

[0053] 3. The genotype frequencies and gene frequencies of 14 SNPs loci as well as the population genetic structure were obtained, and the loci that affect the sexual maturity of sows were found, providing molecular genetic markers for breeding.

[0054] 4. The present invention uses pig ovarian granulosa cells as experimental materials and adopts RNA-seq sequencing technology to study the biological process of ovarian granulosa cells regulated by RBP1.

[0055] 5. In general, the present invention takes RBP1 as the research object and adopts molecular and cell biology methods to study its correlation with puberty: the RBP1 promoter region g.80408109T>C, g.80408854T>C, g.80408992G>A, g.80409145C>T, g.80409353A>G, g.80409632A>G are extremely significantly correlated with puberty (P<0.01), and g.80409169A>G is significantly correlated with puberty (P<0.05). Further studies have shown that the promoter activity of the CC genotype at the g.80408109T>C site is significantly higher than that of the TT genotype, and the promoter activity of the AA genotype at the g.80409632A>G site is significantly higher than that of the GG genotype, and it is confirmed that RBP1 can inhibit ferroptosis of granulosa cells. It can be seen that mutations in the promoter region of RBP1 affect the expression of RBP1, and RBP1 accelerates the onset of puberty by inhibiting ferroptosis in pig ovarian granulosa cells. The present invention has great application value in studying ovarian follicle development and puberty onset.

[0056] 6. The technical solution of the present invention is well designed and the results are reliable. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 This is the electrophoresis detection result of the PCR amplification product of the RBP1 promoter region.

[0058] Figure 2 It is the genotyping diagram of 14 SNPs loci.

[0059] Figure 3 This is the promoter activity diagram of different genotypes at the g.80408109 and g.80409632 sites.

[0060] Figure 4 It is the efficiency detection diagram of overexpression or interference of RBP1; Note: A. RBP1 mRNA level overexpression efficiency diagram; B. RBP1 protein level overexpression efficiency; C. RBP1 mRNA level knockdown efficiency; D. RBP1 protein level knockdown efficiency. * represents P < 0.05, ** represents P < 0.01.

[0061] Figure 5 This is the transcriptome diagram of the effect of RBP1 on pig ovarian granulosa cells; Note: A. Statistical diagram of differentially expressed genes between OE-NC group and OE-RBP1 group; B. Volcano diagram of differentially expressed genes; C. GO enrichment classification bar chart of differentially expressed genes.

[0062] Figure 6 This is a graph showing the effect of RBP1 on the intracellular Fe content in pig ovarian granulosa cells.

[0063] Figure 7This is a diagram showing the effect of RBP1 on MDA levels in pig ovarian granulosa cells.

[0064] Figure 8 This is a graph showing the effect of RBP1 on the expression levels of ferroptosis-related genes in pig ovarian granulosa cells; Note: A. The effect of overexpressing RBP1 on the mRNA levels of ferroptosis-related genes; B. The effect of overexpressing RBP1 on the protein levels of ferroptosis-related genes; C. The effect of knocking down RBP1 on the mRNA levels of ferroptosis-related genes; D. The effect of knocking down RBP1 on the protein levels of ferroptosis-related genes. DETAILED DESCRIPTION

[0065] The present invention is further described in detail below in conjunction with the examples and drawings, but the embodiments of the present invention are not limited thereto. The experimental methods in the following examples where specific conditions are not specified are usually carried out under conventional conditions. Unless otherwise specified, the reagents and raw materials used in the present invention can be obtained commercially.

[0066] The present invention applies statistical methods to analyze the results of three independent experiments in each embodiment, calculate the "mean ± standard deviation", and use one-way analysis of variance to perform significant difference analysis (in the figure, "*" indicates P < 0.05, and "**" indicates P < 0.01).

[0067] The test samples collected in the following embodiments are ear samples of a binary hybrid pig of Duroc and country black pig (abbreviated as Duroc black pig). The sampling site is located at the Niujiaowan R&D Farm of Guangdong No. 1 Food Co., Ltd., and all pigs are fed and managed using unified standards.

[0068] Example 1: DNA extraction from pig ear samples

[0069] (1) Cut 30 mg of pig ear sample into a 1.5 mL centrifuge tube and cut it into pieces with scissors. Add 200 mL of TL Buffer and 25 μL of OB Protease Solution to each centrifuge tube, vortex to mix the sample and solution thoroughly, and incubate in a 55°C water bath for 12 h.

[0070] (2) Centrifuge the tube at 13,000 × g for 5 min. Transfer the supernatant to a new 1.5 mL centrifuge tube. If there is floating precipitate, centrifuge again and transfer the supernatant to the centrifuge tube.

[0071] (3) Add 220 μL BL Buffer, vortex to mix thoroughly, and incubate in a 70°C water bath for 10 min. Add 220 μL anhydrous ethanol, vortex to mix thoroughly.

[0072] (4) Place the column ( DNA Mini Column) into a 2 mL collection tube. Transfer all samples in the centrifuge tube to the column, centrifuge at 13000×g for 1 min, and discard the filtrate.

[0073] (5) Add 500 μL of HBC Buffer diluted with isopropanol to the column, centrifuge at 13,000 × g for 1 min, and discard the filtrate and collection tube.

[0074] (6) Place the column in a new 2 mL collection tube, add 700 μL of DNA Wash Buffer diluted with anhydrous ethanol, centrifuge at 13,000 × g for 1 min, and discard the filtrate. Repeat once to wash the DNA again.

[0075] (7) Centrifuge the empty column at 13,000 × g for 2 min and dry for 3 min. Transfer the column to a 1.5 mL centrifuge tube that does not contain nucleic acid. Add 100 μL of Elution Buffer preheated to 70°C to the column. Let stand at room temperature for 2 min, and centrifuge at 13,000 × g for 1 min to elute the DNA.

[0076] (8) The purity and integrity of the DNA were detected by ultraviolet spectrophotometer, and the obtained high-quality DNA was stored at -20°C for future use.

[0077] Example 2: Primer design for the RBP1 promoter region

[0078] The nucleotide sequence of porcine RBP1 (NC_010455.5, ID: 100156666) was searched using NCBI online data, and the 5'UTR end 3000bp upstream and 500bp downstream were screened out. The primers were designed using the Pick Primers module, and the designed primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0079] F: 5′-ACACAGATCCCCTCTCTC-3′;

[0080] R: 5′-GAAATTCTCGTTGGCCAGCATCT-3′.

[0081] Example 3: Cloning of the RBP1 promoter region

[0082] The promoter regions of RBP1 and PLPP3 were obtained by amplifying the extracted gDNA of the ear sample of the pig as a template using Taq enzyme. The reaction system and reaction procedure are shown below (Table 1, Table 2).

[0083] Table 1. PCR reaction system

[0084]

[0085] Table 2. PCR reaction program

[0086]

[0087] Example 4: Identification of the RBP1 promoter region

[0088] Weigh 0.6g of agarose and add it to a conical flask containing 40mL of 1×TAE, and heat it in a microwave for 1min. Observe that the agarose is completely dissolved, and put the conical flask into cold water. When it cools to room temperature, add 2μL of nucleic acid dye, shake it gently, pour it into the gel tank and insert the comb. Let it stand for 30min at room temperature. After the liquid solidifies, take it out and put it into the electrophoresis instrument for spotting, and select a DNA Maker with a length of 10000bp according to the size of the target fragment. Set the voltage to 150V and time it for 20-25min. After the electrophoresis is completed, use the fully automatic chemiluminescence image analysis system to observe the band position. If it meets the expected product size, the amplified product will be sent to Sangon Biotech (Shanghai) Co., Ltd. for Sanger sequencing.

[0089] Example 5: SnapGene 4.2.4 software was used to splice the sequencing results and analyze the SNP site genotype. Excel was used to calculate the genotype frequency, genotype frequency, heterozygosity, effective allele number, polymorphic information content, and whether the site was in Hardy-Weinberg equilibrium.

[0090] Example 6: Association Analysis

[0091] The genetic association between SNP and puberty was analyzed using R language (v4.03) and general linear model (GLM). The model is as follows:

[0092] Yij=L+Gj

[0093] where Yij is the observed age at puberty for the ith animal, L is the mean age at puberty; Gj represents the genotype effect, which is coded as a dummy variable for different genotypes through categorical variables. Statistics are presented as “mean ± SD”.

[0094] Example 7: Isolation and culture of porcine ovarian granulosa cells

[0095] The commercial sow ovaries collected from Kongwangji slaughterhouse were washed twice with phosphate buffered saline (PBS) containing 1% penicillin-streptomycin, immersed in PBS, and transported back to the laboratory in a low-temperature environment. In the laboratory, the ovaries were placed in a cleaned beaker, washed with PBS containing 1% penicillin-streptomycin until there was no blood, and then 75% alcohol was added to soak for 30 seconds, and then the alcohol was poured out, and washed several times with PBS containing 1% penicillin-streptomycin, and then sealed and placed in the cell room transfer window.

[0096] Use a 1mL disposable sterile syringe to draw 1-2mL of follicular fluid from follicles with a diameter of about 3-5mm, put it into a 15mL centrifuge tube containing 4mL of complete culture medium, and centrifuge it at 1000rpm for 5min at room temperature. Discard the supernatant, add 3mL of PBS containing 1% penicillin-streptomycin, gently blow and resuspend, centrifuge, discard the supernatant, and repeat once. Add 3mL of complete culture medium to resuspend the cells, then inoculate the cells in a cell culture bottle, shake it gently in a "cross" to mix, and place it in a 37℃, 5% CO2 incubator for static culture. After 48h, change the medium and observe the cell adhesion and growth status, and continue to culture.

[0097] Example 8: Isolation, culture and transfection of porcine ovarian granulosa cells

[0098] When the fusion degree of porcine GCs reaches about 80%, discard the culture medium in the bottle, wash twice with PBS containing 1% penicillin-streptomycin, and discard PBS. Add 3mL of trypsin to the bottle, put it in the cell culture incubator for digestion for 5min, and observe the cell adhesion under a microscope. When most of the cells are round and float with the liquid, it means that the digestion is complete. Add 4mL of complete culture medium to terminate the digestion. After blowing the wall of the culture bottle with a pipette tip, transfer the mixed solution in the bottle to a 15mL centrifuge tube and centrifuge at 1000rpm for 5min at room temperature. Discard the supernatant, wash twice with PBS containing 1% penicillin-streptomycin, and discard the supernatant. Add 3mL of complete culture medium to resuspend the cells and inoculate them in the cell culture plate. After gently shaking the "cross" to mix, place it in a 37℃, 5% CO2 incubator for static culture. Observe the cell adhesion and growth status after 24h. When the fusion degree of GCs reaches 70-80%, discard the complete culture medium, wash twice with PBS, and add incomplete culture medium.

[0099] Prepare solution A: Opti-MEM and Lipofectamine TM 3000 and mix well. Prepare solution B: Opti-MEM, overexpression plasmid and P3000, or Opti-MEM and small RNA fragments, and mix gently. Add solution A to solution B, pipette and mix gently, and incubate at room temperature in the dark for 15 minutes. The overexpression plasmid is constructed as follows:

[0100] Basic plasmid: pcDNA3.1 plasmid

[0101] Insertion sites: BamHI and EcoRI

[0102] The sequence of the inserted target fragment: ATGCCGGTCGACTTTACCGGGTACTGGAAGATGCTGGCCAACGAGAATTTCGAGGAGTATCTGCGTGCGCTGGATGTCAATGTGGCCTTGCGCAAAATTGCCAACTTGCTGAAGCCAGACAAAGAGATCGTGCAGGACGGCAACCACATGATCATCCGCACGCTGAGCACTTTTAGGAACTACATCATGGACTTCGAGG TTGGAAAGGAGGTTTGAGGAGGATCTGACCGGCATAGACGACCGCAAGTGCATGACCACAGTGAGCTGGGATGGGGACAAGCTCGAGTGTGTGCAGAAGGGTGAGAAGGAGGGACGTGGCTGGACCCAGTGGATTGAAGGTGACGAGCTGCACCTGGAGATGAGAGTGCAGGGCGTGGCCTGCAAGCAAGTGTTCAAAAAGGTGAACTGA.

[0103] The sequence of the small RNA fragment siRNA is as follows: 5'-AGGTTGGAAAGGAGTTTGA-3'.

[0104] Add the AB solution mixture to the cell culture plate, shake it gently in a "cross" pattern to fully mix the mixture with the culture medium, and then place the culture plate in a constant temperature 5% CO2 cell culture incubator for culture and transfection for 24 hours. Perform subsequent experiments according to the experimental design.

[0105] Example 9: RNA extraction and quality control

[0106] (1) Total RNA of cells was extracted according to the instructions of RNAfast200 total RNA extraction kit.

[0107] ① Discard the cell culture medium, wash the cells twice with PBS, and digest them with trypsin at 37°C for 5 minutes. Use complete culture medium to terminate the digestion, transfer the cells to a centrifuge tube, centrifuge at 10,000 rpm for 5 minutes, collect the cells, wash them twice with PBS, and collect the cell pellet by centrifugation;

[0108] ② Add 100 μL of PBS to the cell pellet, resuspend the cells, and transfer them to a 1.5 mL centrifuge tube;

[0109] ③ Add 500 μL of RA2, invert 5-10 times until the lysate is clear, and let stand for 1 min;

[0110] ④ Transfer all the lysate to the column in the collection tube and centrifuge at 12000rpm for 1min;

[0111] ⑤Discard the liquid in the collection tube and add 500 μL of washing solution diluted with anhydrous ethanol to the column, centrifuge for 1 min, discard the filtrate, and repeat this step once;

[0112] ⑥ Centrifuge for 1 min without adding washing solution;

[0113] ⑦ Move the column into a new 1.5 mL centrifuge tube and add 30 μL of elution buffer to the center of the membrane;

[0114] ⑧After standing at room temperature for 1 min, centrifuge for 1 min to obtain total RNA.

[0115] (2) The purity and integrity of total RNA were detected by UV spectrophotometer, and the obtained high-quality RNA was stored in a -80°C refrigerator for future use.

[0116] Example 10: RNA Reverse Transcription

[0117] Reaction system: 2 μL of 5× PrimeScript RT premix, ≤500 ng of total RNA, and adjust the system to 10 μL with RNase-free H2O.

[0118] Reaction program: 37°C for 15 min, 85°C for 5 s.

[0119] The cDNA obtained by reverse transcription was stored in a -20°C refrigerator.

[0120] Example 11: qPCR detection of gene mRNA expression

[0121] The CDS region sequence of the target gene was searched through the NCBI database, and the Primer Blast module in the NCBI database was used to design quantitative primers. Table 3 lists all the primers for qPCR.

[0122] use qPCR SYBR Green Master Mix (2×) and CFX96 Touch Real-Time PCR System were used to quantify the relative mRNA levels of genes. GAPDH was selected as an endogenous control and analyzed by the 2-ΔΔct method. The total reaction volume of each sample was 20 μL, including 10 μL of SYBR Green Master Mix, 0.3 μL of forward primer, 0.3 μL of reverse primer, 1 μL of diluted cDNA template, and 7.8 μL of RNA-free water. The cycling conditions were as follows: 95°C pre-denaturation for 10 min, 1 cycle, 95°C denaturation for 15 s, 40 cycles, 60°C annealing / extension for 1 min, 40 cycles.

[0123] Table 3. qPCR primer list

[0124]

[0125]

[0126] The above primer species are all pigs.

[0127] Example 12: Protein extraction, concentration determination and denaturation

[0128] (1) Protein extraction: 24 hours after cell transfection, discard the culture medium in the six-well plate and wash twice with 1×PBS. Add 100 μL of RIPA lysis buffer containing 1% protease inhibitor to each well and incubate on ice for 15 min. Repeatedly blow the cells in the well to fully lyse them, then transfer them to a 2 mL centrifuge tube and centrifuge at 12,000 rpm at 4°C for 10 min to collect the supernatant.

[0129] (2) Protein concentration determination: The operation steps were based on the instructions of the BCA protein assay kit. A standard curve was drawn based on the obtained results, and the corresponding protein sample concentration was calculated.

[0130] (3) Protein denaturation: Add 5× protein loading buffer (containing DTT) and ddH2O, quantify the protein concentration to 1000 ng / μL, denature at 99°C for 10 min, and store in a -20°C refrigerator for later use.

[0131] Example 13: Western Blot

[0132] (1) Load 12 μL of protein sample onto a 10% protein precast gel and perform electrophoresis at 130 V for 50 min.

[0133] (2) Accurately and quickly cut the gel strip containing the target protein according to the Protein Maker and transfer it to the polyvinylidene fluoride (PVDF) membrane, making sure there are no bubbles between the gel strip and the PVDF membrane.

[0134] (3) Using eBlot TM The L1 membrane converter transfers the proteins on the strip to the PVDF membrane. After the transfer is completed, the PVDF membrane is washed 3 times with TBST, each time for 5-10 minutes.

[0135] (4) The PVDF membrane was placed in 5% skimmed milk powder and sealed at room temperature at a low speed for 2 h.

[0136] (5) Pour away the milk powder and wash the membrane three times with TBST, each time for 5-10 min.

[0137] (6) Incubate the membrane in primary antibody dilution buffer at 4°C overnight.

[0138] (7) Wash the membrane three times with TBST, each time for 5-10 min.

[0139] (8) Place the PVDF membrane in the secondary antibody dilution solution and incubate on a shaker at room temperature for 1.5-2 h.

[0140] (9) Wash the membrane three times with TBST, each time for 5-10 min.

[0141] (10) Add ECL developer and use a fully automatic chemiluminescence image analysis system for on-machine development.

[0142] Example 14: Determination of total iron content

[0143] The total iron content in cells was extracted according to the instructions of the total iron colorimetric test kit.

[0144] (1) Sample preparation

[0145] ①Discard the cell culture medium, wash the cells twice with PBS, and collect the cells into a 1.5 mL centrifuge tube using trypsin digestion.

[0146] ② Add 200 μL of reagent 1 to each tube, mix well by pipetting, and place on ice for 10 minutes to lyse.

[0147] ③ Centrifuge at 15000×g for 10 min at room temperature, transfer the supernatant to a new 1.5mL centrifuge tube, and store it in a 4℃ refrigerator for later use.

[0148] (2) Operation steps

[0149] ① Prepare iron standards of different concentrations according to the instructions (prepare immediately before use).

[0150] ② Add 80 μL of standards of different concentrations to the corresponding wells of the ELISA plate as standard wells, and add 80 μL of the sample to be tested as the measurement wells.

[0151] ③ Add 80 μL of reagent 2 to the standard wells and measurement wells.

[0152] ④ Gently shake the ELISA plate to mix the solution thoroughly and incubate it in an incubator at 37°C for 40 minutes.

[0153] ⑤ Use an ELISA reader to measure the OD value of each well at 593 nm.

[0154] (3) Calculation results

[0155] Standard product fitting curve: y = a x + b

[0156] Cell samples:

[0157] Note: y: OD value of standard - blank OD value (OD value when the concentration of standard is 0); x: concentration of standard; a: slope of calibration curve; b: intercept of calibration curve; ΔA: absolute OD value of sample (OD value of assay well - OD value of blank well); N: number of cell samples used for lysis / 106; V: amount of reagent 1 added during cell sample processing (mL); f: dilution factor of sample before adding to the detection system.

[0158] Example 15: Determination of malondialdehyde (MDA) content

[0159] The malondialdehyde content in the cells was extracted according to the instructions of the malondialdehyde (MDA) colorimetric test kit.

[0160] (1) Sample preparation

[0161] Discard the cell culture medium, wash the cells twice with PBS, scrape the cells with a cell scraper, transfer the cells to a centrifuge tube with a pipette, add 500 μL of reagent five extract, place on a vertical mixer and shake for 2 minutes to fully mix the extract and cells, then use an ultrasonic disruptor to disrupt the cells, prepare a suspension, and store in a 4°C refrigerator for later use.

[0162] (2) Operation steps

[0163] ① Prepare several 1.5mL centrifuge tubes and divide them into 3 groups, including the following parts:

[0164] Blank tube: Add 100 μL of anhydrous ethanol.

[0165] Standard tube: add 100 μL of 10 nmol / mL standard.

[0166] Sample tube: Add 100 μL of the sample to be tested.

[0167] ② Add 1 mL of working solution to each tube.

[0168] ③ Turn the centrifuge tube upside down to mix the solution thoroughly, cover the lid of the centrifuge tube with plastic wrap, poke a small hole in the plastic wrap, place it in a 100℃ water bath, and incubate for 40 minutes.

[0169] ④ Cool it to room temperature using running water and centrifuge at 1078×g for 10 min.

[0170] ⑤ Carefully pipette 250 μL of supernatant into a 96-well ELISA plate.

[0171] ⑥ Use an ELISA reader to measure the OD value of each well at 532 nm.

[0172] (3) Calculation results

[0173] The calculation formula of malondialdehyde content in cells is:

[0174] Note: ΔA1: OD value of the test tube - OD value of the blank tube; ΔA2: OD value of the standard tube - OD value of the blank tube; C: concentration of the standard (10nmol / mL); f: dilution factor of the sample before adding it to the detection system; Cpr: protein concentration of the sample to be tested (mgprot / mL).

[0175] Example 16: Transfection of recombinant plasmid and dual fluorescence activity detection

[0176] (1) Transfection

[0177] ① When the GCs confluence in the cell culture plate reaches 70-80%, discard the complete medium, wash twice with PBS, and then add incomplete medium.

[0178] ②Prepare transfection mixture. Prepare solution A: Opti-MEM and Lipofectamine TM 3000 and mix well. Prepare Solution B: Opti-MEM, recombinant pGL-3 plasmid, pGL-TK plasmid and P3000 and mix gently. Add Solution A to Solution B, pipette gently to mix, incubate at room temperature in the dark for 15 minutes, and add to the cell culture plate. Note that the mass of the recombinant pGL-3 plasmid: the mass of the pRL-TK plasmid is 19:1.

[0179] Among them, pRL-TK plasmid is a commercially available plasmid obtained from the Key Laboratory of Agricultural Animal Genomics and Molecular Breeding of Guangdong Province; the recombinant plasmids include wild-type and mutant vectors of g.80408109T>C site, named WT-8109 and Mut-8109; and wild-type and mutant vectors of g.80409632A>G site, named WT-9632 and Mut-9632; all were commissioned to Wuhan Jinkairui Bioengineering Co., Ltd. for synthesis, the basic plasmid used was pGL3-basic, the cloning sites were KpnI and XhoI, and the target sequences were as follows:

[0180] WT-8109 target sequence (g.80408109T): CTCGAGCTTCTCACTGCTTGGAGTGTCCCCGCTTTACAGATGTGGCAACTGAGGCACAGAAGGGAGGAGCCACTTAACCGAGACCACTCAGCTACACAGTGACATGACCAGCTTCAAACCTTACCCTCTGCCTCTCGAGCCTGTCCTCACAACCAACCCCCAGCTACCCAGAATAGCACAGCCAACAGGGTCTGCCCTTGGGAGGGTACC

[0181] Mut-8109 target sequence (g.80408109C): CTCGAGCTTCTCACTGCTTGGAGTGTCCCCGCTTTACAGATGTGGCAACTGAGGCACAGAAGGGAGGAGCCACTTAACCGAGACCACTCAGCTACACAGTGACACGACCAGCTTCAAACCTTACCCTCTGCCTCTCGAGCCTGTCCTCACAACCAACCCCCAGCTACCCAGAATAGCACAGCCAACAGGGTCTGCCCTTGGGAGGGTACC

[0182] WT-9632 target sequence (g.80409632G): CTCGAGCCCGCCAGGTGGGAAATGAGATGTGCTCCAAGGTCTTCACTGCGGTACTGTTTCTAACAGTCAAAGATCGGAAACGACATCAATGTCCATCAGGGGCCAGGCTGGATAGACAATGGAATATCCTGCAAAAGAATGAGGGTGCTTTCTATGTATGGGTATGGAAAGGGCTCCAGAAGAGAGTAAGTGGAAAAAGAAAATGGTACC

[0183] Mut-9632 target sequence (g.80409632A): CTCGAGCCCGCCAGGTGGGAAATGAGATGTGCTCCAAGGTCTTCACTGCGGTACTGTTTCTAACAGTCAAAGATCGGAAACGACATCAATGT CCATCAGGGGCCAAGCTGGATAGACAATGGAATATCCTGCAAAAGAATGAGGGTGCTTTCTATGTATGGGTATGGAAAGGGCTCCAGAAGAGAGTAAGTGGAAAAAGAAAATGGTACC.

[0184] (2) Dual fluorescence activity detection

[0185] The activity detection of the promoter region refers to the instructions of the Dual-Luciferase Reporter Gene Assay Kit.

[0186] ①Discard the culture medium, add cell culture lysis buffer, and gently rotate the culture plate to allow the lysis buffer to completely cover the cells.

[0187] ②Incubate on ice for 5 minutes to fully lyse the cells.

[0188] ③ Centrifuge at 10000-16000rpm for 1min and take the supernatant.

[0189] ④ Take 20 μL of lysate and add it to a 96-well culture plate, with 3 replicates per group. Add 100 μL of firefly luciferase reaction solution to detect the luminescence value of firefly luciferase; add 100 μL of Renilla luciferase reaction solution to detect the activity of Renilla luciferase.

[0190] ⑤Calculation: Relative activity = luminescence value of firefly luciferase / luminescence value of Renilla luciferase

[0191] Example 17: RNA-Seq

[0192] (1) Sample processing: There were 4 treatment groups, with 3 replicates in each group. pcDNA3.1, pcDNA3.1-RBP1, siRNA-NC, and siRNA-RBP1 were transfected into GCs, respectively, and treated for 24 h. The cells were digested and collected, washed twice with PBS, and Trizol was added. The cells were named according to the treatments, and RNA-Seq was commissioned to BGI.

[0193] (2) Data analysis: After correcting for sequencing depth and gene or transcript length, the FPKM value of the gene is obtained and then subsequent analysis is performed. The FPKM value of each gene is used to detect the significantly differentially expressed genes between the comparison groups and perform volcano plot analysis. The differentially expressed genes are mapped to each term in the GO database and the number of differentially expressed genes in each term is calculated to obtain a list of differentially expressed genes with specific GO functions and their number statistics. The hypergeometric test method is then used to compare with background genes to identify GO entries that are significantly enriched in the differentially expressed genes.

[0194] Result analysis:

[0195] 1. Cloning of the RBP1 promoter region

[0196] The promoter region of RBP1 was amplified by PCR using primers of RBP1 promoter and DNA of Douro pig as template. The PCR product was subjected to agarose gel electrophoresis. The results were as follows: Figure 1 As shown, a specific band consistent with the expected size was obtained, and then a large amount of PCR amplification was performed, and the PCR product was sent to Biotechnology for Sanger sequencing.

[0197] 2. SNPs mutation in the promoter region of RBP1

[0198] Snapgene 4.2.4 software was used to view the sequencing peak graph, and the sequence was compared with the pig RBP1 gene sequence in NCBI to screen the SNPs sites and perform genotyping. There are 14 SNPs sites in the RBP1 promoter region ( Figure 2 ), respectively, g.80407902A>G, g.80408010G>T g.80408050C>G, g.80408083T>C, g.80408109T>C, g.80408237C>A, g.80408481G>A, g.80408854T>C, g.80408992G>A, g.80409145C>T, g.80409169A>G, g.80409353A>G, g.80409546A>C, and g.80409632A>G. Among them, 6 loci had two genotypes and 8 loci had three genotypes.

[0199] 3. Genotype frequency and allele frequency of SNPs in the RBP1 promoter region

[0200] The genotype results were statistically analyzed according to the peak graph and the genotype frequency and allele frequency of the SNPs loci were calculated. As shown in Table 4, g.80407902A>G site AA is the dominant genotype, g.80408010G>T site GG is the dominant genotype, g.80408050C>G site CC is the dominant genotype, g.80408083C>T site CC is the dominant genotype, and g.80408109T>C site CC and TC genotype frequencies are the same, both are dominant genotypes. g.80408237C>A site CC is the dominant genotype, g.80408481G>A site GG is the dominant genotype, g.80408854T>C site CC is the dominant genotype, g.80408992G>A site AA is the dominant genotype, g.80409145C>T site TT is the dominant genotype, g.80409169A>G site GG is the dominant genotype, g.80409353A>G site GG is the dominant genotype, g.80409546A>C site AA is the dominant genotype, and g.80409632A>G site GA is the dominant genotype.

[0201] 4. Population genetic structure analysis of SNPs in the RBP1 promoter region

[0202] The results of population genetic structure analysis of SNPs in the promoter region of RBP1 gene are shown in Table 5. The chi-square test showed that the g.80408109T>C, g.80408854T>C, g.80408992G>A, g.80409145C>T, g.80409169A>G, g.80409353A>G and g.80409632A>G sites in this population were in Hardy-Weinberg equilibrium (P>0.05).

[0203] 5. Association analysis between SNPs in the promoter region of RBP1 and puberty

[0204] The single-factor analysis of variance was used to conduct an association analysis between different individual genotypes and puberty. As shown in Table 6, the promoter region of RBP1 g.80408109T>C, g.80408854T>C, g.80408992G>A, g.80409145C>T, g.80409353A>G, g.80409632A>G were extremely significantly correlated with puberty (P<0.01), and g.80409169A>G was significantly correlated with puberty (P<0.05).

[0205] 6. Effects of different genotypes of polymorphic sites in the promoter region of porcine RBP1 on transcriptional activity

[0206] The promoter activity of CC genotype at g.80408109T>C was significantly higher than that of TT genotype, indicating that CC genotype may promote the expression of RBP1. The promoter activity of AA genotype at g.80409632A>G was significantly higher than that of GG genotype, indicating that AA genotype may promote the expression of RBP1.

[0207] 7. Efficiency detection of overexpression or knockdown of RBP1

[0208] After transfection with 0.25ng / μL of empty and overexpression plasmids, qPCR and WB detection revealed that the mRNA and protein expression levels of RBP1 increased, indicating that the overexpression efficiency was good. After transfection with 100nM siRNA, the mRNA and protein expression levels of RBP1 decreased, indicating that the knockdown efficiency was good. The concentrations of overexpression plasmids and siRNA can be used for subsequent experiments ( Figure 4 ).

[0209] 8. Effect of RBP1 on the transcriptome of porcine ovarian granulosa cells

[0210] After overexpression and knockdown of intracellular RBP1, RNA-seq detection revealed that the differentially expressed genes caused by changes in RBP1 expression were mainly involved in biological processes such as cell death and glutathione metabolism, indicating that RBP1 can regulate the ferroptosis pathway of porcine granulosa cells ( Figure 5 ).

[0211] 9. Effect of RBP1 on ferroptosis of porcine ovarian granulosa cells

[0212] Overexpression of RBP1 downregulated intracellular Fe content, inhibited lipid peroxide formation, and inhibited cell ferroptosis by upregulating GPX4 and FTH1 and downregulating P53 mRNA and protein expression. Knockdown of RBP1 upregulated intracellular Fe content, promoted lipid peroxide formation, and promoted cell ferroptosis by downregulating GPX4 and FTH1 and upregulating P53 mRNA and protein expression. Figure 6 , Figure 7 , Figure 8 ).

[0213] Table 4 Statistical results of SNP locus typing

[0214]

[0215]

[0216] Table 5 Analysis of population genetic structure indicators

[0217]

[0218] Table 6 Effects of gene polymorphisms on the age of sexual maturity in Dorado pigs

[0219]

[0220]

[0221] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A molecular genetic marker that affects sexual maturity in pigs, characterized in that: Includes at least one of the following SNP molecular markers: (1) The SNP site corresponding to the T>C mutation at position g.80408109 on chromosome 13 of the pig reference genome Sscrofa11.1; (2) The SNP site corresponding to the T>C mutation at position g.80408854 on chromosome 13 of the pig reference genome Sscrofa11.1; (3) The SNP site corresponding to the G>A mutation at position g.80408992 on chromosome 13 of the pig reference genome Sscrofa11.1; (4) The SNP site corresponding to the C>T mutation at position g.80409145 on chromosome 13 of the pig reference genome Sscrofa11.1; (5) The SNP site corresponding to the A>G mutation at position g.80409353 on chromosome 13 of the pig reference genome Sscrofa11.1; (6) The SNP site corresponding to the A>G mutation at position g.80409632 on chromosome 13 of the pig reference genome Sscrofa11.1; (7) The SNP site corresponding to the A>G mutation at position g.80409169 on chromosome 13 of the pig reference genome Sscrofa11.

1.

2. The use of the molecular genetic markers affecting pig sexual maturity as described in claim 1, characterized in that: Includes at least one of the following applications: A. Application in assessing the age of first estrus in pigs; B. Application in judging the onset of puberty in pigs; C. Application in breeding high-yield pigs.

3. The use of molecular genetic markers affecting pig sexual maturity according to claim 2, characterized in that: In the application A, the genotype of the g.80408109 locus is detected, and the age of first puberty of individuals with the genotype of CC is shorter than that of TC and TT individuals; and / or, the genotype of the g.80408854 locus is detected, and the age of first puberty of individuals with the genotype of CC is shorter than that of TC and TT individuals; and / or, the genotype of the g.80408992 locus is detected, and the age of first puberty of individuals with the genotype of AA is shorter than that of GA and GG individuals; and / or, the genotype of the g.80409145 locus is detected. The genotype of the g.80409353 locus was detected, and the age at first puberty of the individuals with the genotype of TT was shorter than that of the individuals with the genotype of CT and CC; and / or, the genotype of the g.80409353 locus was detected, and the age at first puberty of the individuals with the genotype of GG was shorter than that of the individuals with the genotype of AG and AA; and / or, the genotype of the g.80409632 locus was detected, and the age at first puberty of the individuals with the genotype of AA was shorter than that of the individuals with the genotype of GA and GG; and / or, the genotype of the g.80409169 locus was detected, and the age at first puberty of the individuals with the genotype of GG was shorter than that of the individuals with the genotype of AG and AA.

4. The use of molecular genetic markers affecting pig sexual maturity according to claim 2, characterized in that: In the application B, the genotype of the g.80408109 locus is detected, and the individuals with the genotype CC have a faster onset of puberty than the TC and TT individuals; and / or, the genotype of the g.80408854 locus is detected, and the individuals with the genotype CC have a faster onset of puberty than the TC and TT individuals; and / or, the genotype of the g.80408992 locus is detected, and the individuals with the genotype AA have a faster onset of puberty than the GA and GG individuals; and / or, the genotype of the g.80409145 locus is detected. Due to genotype, individuals with genotype TT onset first puberty faster than those with CT and CC; and / or, by detecting the genotype of the g.80409353 locus, individuals with genotype GG onset first puberty faster than those with AG and AA; and / or, by detecting the genotype of the g.80409632 locus, individuals with genotype AA onset first puberty faster than those with GA and GG; and / or, by detecting the genotype of the g.80409169 locus, individuals with genotype GG onset first puberty faster than those with AG and AA.

5. The use of molecular genetic markers affecting pig sexual maturity according to claim 2, characterized in that: In the application C, the genotype of the g.30088284 locus is detected, and individuals with genotypes of GA and AA are selected as breeding pigs; and / or, the genotype of the g.30088004 locus is detected, and individuals with genotypes of TT are selected as breeding pigs; the genotype of the g.80408109 locus is detected, and individuals with genotypes of CC are selected as breeding pigs; and / or, the genotype of the g.80408854 locus is detected, and individuals with genotypes of CC are selected as breeding pigs; and / or, the genotype of the g.80408992 locus is detected, and individuals with genotypes of CC are selected as breeding pigs. The genotype of the g.80409145 site is detected, and the individuals with the genotype of AA are selected as breeding pigs; and / or, the genotype of the g.80409145 site is detected, and the individuals with the genotype of TT are selected as breeding pigs; and / or, the genotype of the g.80409353 site is detected, and the individuals with the genotype of GG are selected as breeding pigs; and / or, the genotype of the g.80409632 site is detected, and the individuals with the genotype of AA are selected as breeding pigs; and / or, the genotype of the g.80409169 site is detected, and the individuals with the genotype of GG are selected as breeding pigs.

6. The use of molecular genetic markers affecting pig sexual maturity according to any one of claims 2 to 5, characterized in that: The pigs include any one of Duroc and its synthetic lines.

7. A primer for identifying molecular genetic markers that affect sexual maturity in pigs, characterized in that: include: F: 5′-ACACAGATCCCCTCTCTC-3′; R: 5′-GAAATTCTCGTTGGCCAGCATCT-3′.

8. Application of RBP1 gene in regulating ferroptosis of pig ovarian granulosa cells, characterized in that: The application is any one or more of the following applications: I. Application of overexpression of RBP1 gene to inhibit ferroptosis of ovarian granulosa cells in vitro; II. Application of knocking down RBP1 gene to promote ferroptosis of ovarian granulosa cells in vitro.

9. The use of the RBP1 gene in regulating ferroptosis of porcine ovarian granulosa cells according to claim 8, characterized in that: The overexpression of RBP1 gene is achieved by the following method: connecting the nucleic acid molecule encoding pig RBP1 gene to the pcDNA3.1 plasmid to construct an overexpression vector; and then transfecting the overexpression vector containing RBP1 gene into sow ovarian granulosa cells cultured in vitro.

10. The use of the RBP1 gene in regulating ferroptosis of porcine ovarian granulosa cells according to claim 8, characterized in that: The knockdown of RBP1 gene is achieved by transfecting siRNA, and the siRNA sequence is as follows: RBP1-siRNA: 5′-GCAAACAGGACATCGTCTT-3′.

Images