Specific primer of molecular marker of fecundity-related gene HIRA of muxu sheep and application of specific primer

Abstract

The invention belongs to the field of molecular biology, and particularly relates to a specific primer of a molecular marker of a muxusewu sheep fecundity related gene HIRA and application of the specific primer. The invention relates to a specific primer of a molecular marker of a Muru sheep fecundity related gene HIRA. The sequences of the primer are as shown in SEQ ID NO.1 and SEQ ID NO.2. The invention further discloses a kit for detecting the Muru sheep fecundity related gene HIRA. Specific primers are designed, whether G-> A mutation exists at the position of 1273bp of an HIRA gene coding region in a genome of the wuzhu sheep or not is detected, the genotype of an individual wuzhu sheep at the site is determined, and detection on the HIRA gene c.1273Ggt; carrying out single nucleotide polymorphism detection on A so as to compare the HIRA gene c.1273Ggt with the HIRA gene c.1273Ggt; the polymorphism of A in the variety of the Wuzhu muuseu sheep is shown in the specification. According to the invention, an HIRA gene c.1273Ggt is utilized; the A polymorphism assists the breeding of the Wuzhu Qinseuo sheep, increases the lambing number of the Wuzhu Qinseuo sheep, and can be used as an effective method for assisting in improving the multifetal character of the Wuzhu Qinseuo sheep.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to specific primers of molecular markers of Ujumchin sheep fertility-related gene HIRA and applications thereof. Background Art

[0002] Wuzhumuqin sheep are produced in Wuzhumuqin grassland in the eastern part of Xilin Gol League, Inner Mongolia, and are mainly distributed in East Wuzhumuqin Banner, West Wuzhumuqin Banner and other areas. They are suitable for year-round grazing and have the characteristics of fast fattening, strong fat accumulation ability, high meat production rate, early sexual maturity, etc. They are suitable for grazing and fattening or planned fat lamb production during the peak growth period of forage. At the same time, Wuzhumuqin sheep are also good recipient sheep for purebred breeding embryo transplantation. The offspring lambs have strong physique, strong disease resistance and good adaptability.

[0003] HIRA (histone cell cycle regulator Gene, HIRA) is a histone cell cycle regulator and a histone chaperone. The sheep HIRA gene is located on chromosome 17, contains 24 exons, has a coding region length of 3063bp, and encodes 1021 amino acids. Its product HIR / HIRA is a chaperone protein of histones. HIRA participates in various chromatin regulatory processes, such as gene transcription and sperm chromatin remodeling. In eukaryotes, DNA binds to histones to form a stable structure called nucleosomes, which participate in various biological processes (such as DNA replication, repair and transcription, myoblast differentiation, heart development, and embryonic development). Buhe et al. found that HIRA is essential for transcriptional regulation and DNA methylation during mouse oogenesis. HIRA deficiency in primordial follicle cells can lead to severe developmental defects, resulting in the death of a large number of oocytes. After in-depth research on vertebrates, it was found that HIRA is mainly involved in fertilization or embryonic development, but has no significant effect on oogenesis or meiosis. It can be seen that HIRA has a wide range of effects, and there is currently no research on the specific role of the HIRA gene in the breeding process of Ujumchin sheep. Summary of the invention

[0004] The purpose of the present invention is to provide a specific primer for the molecular marker of the Ujumchin sheep fertility-related gene HIRA.

[0005] Another object of the present invention is to provide applications of the above-mentioned specific primers.

[0006] The present invention adopts DNA sequencing technology to detect whether there is a G→A mutation at 1273bp in the HIRA gene coding region in the Ujumchin sheep genome, and determines the genotype of the Ujumchin sheep individual at this site, performs single nucleotide polymorphism detection on the HIRA gene c.1273G>A, compares the polymorphism of the HIRA gene c.1273G>A in the Ujumchin sheep breed, and determines that c.1273G>A is a molecular marker related to the polygenic trait of the Ujumchin sheep.

[0007] The nucleotide sequence of the Ujumchin sheep HIRA gene c.1273G>A is the NCBI Reference Sequence NC_056070.1, which is the region from 72677979bp to 72726550bp on chromosome 17 of the sheep.

[0008] According to the specific primers of the molecular marker of the Ujumqin sheep fertility-related gene HIRA in the specific embodiment of the present invention, the primer sequences are as follows:

[0009] SEQ ID NO.1: 5'-CCGAGGGTCTCAATTTCAGTT-3';

[0010] SEQ ID NO. 2: 5'-TGCAGCCACAAGCACAGG-3'.

[0011] The specific primers of the molecular marker of the Ujumchin sheep fertility-related gene HIRA of the present invention can be applied to a kit for detecting the multi-birth trait of Ujumchin sheep, or can be applied to assisting Ujumchin sheep breeding.

[0012] Preferably, the present invention provides the use of specific primers for molecular markers of the Ujumchin sheep fertility-related gene HIRA in assisting in determining the fertility of Mongolian sheep.

[0013] Preferably, the present invention provides a Ujumchin sheep polygyny trait detection kit, which includes the above primers. More preferably, the kit includes 1 μL of each specific primer, 1 μL of template, 6 μL of premix, and 11 μL of deionized water. The PCR amplification program suitable for the above kit is 95°C pre-denaturation for 3 min, 98°C denaturation for 10 s, 62°C annealing for 15 s, 68°C extension for 57 s, 30 cycles, 68°C extension for 7 min, 4°C storage, and then sequencing.

[0014] According to a specific embodiment of the present invention, the method for improving the fertility of Ujumchin sheep comprises the step of amplifying the genomic DNA of Ujumchin sheep using the above-mentioned specific primers.

[0015] Specifically, according to a method for improving the fertility of Ujumqin sheep according to a specific embodiment of the present invention, the method comprises the following steps:

[0016] (1) extracting genomic DNA of the Ujumqin sheep to be tested;

[0017] (2) using the genomic DNA of the Ujumchin sheep extracted in step (1) as a template, performing PCR amplification with specific primers to obtain an amplified product;

[0018] (3) Determine the genotype of the 1273rd nucleotide of the HIRA gene in the Ujumchin sheep genome in the amplified product, and select the Ujumchin sheep with the AA genotype at the 1273rd nucleotide in the HIRA gene coding region as the breeding parent.

[0019] The detection method of c.1273G>ASNP of the HIRA gene in the Ujumqin sheep genome is:

[0020] The fragment of nucleotides 72677979 to 72726550 of the Ujumchin sheep HIRA gene GenBank Accession Number NC_056070.1 was amplified by PCR, and the amplified product was sequenced;

[0021] If a single peak appears at the 72697217th base of chromosome 17 and the genotype is G, then the genotype is GG.

[0022] If an overlapping peak appears at the position of the 72697217th base of chromosome 17, the genotype is GA. If a single peak appears at the position of the 72697217th base of chromosome 17 and the genotype is A, the genotype is AA.

[0023] The amino acid corresponding to the mutation at the site is selected from alanine at position 425 of the amino acid sequence. When the site is G, the corresponding amino acid is alanine; when the site is A, the corresponding amino acid is threonine;

[0024] The average number of lambs born of Ujumchin sheep with genotype AA was higher than that with genotype GA, and the average number of lambs born of Ujumchin sheep with genotype GA was higher than that with genotype GG.

[0025] In the present invention, the fertility of the Ujumchin sheep is specifically embodied as the number of lambs produced by the Ujumchin sheep per litter.

[0026] According to the method for improving the fertility of Gaowuzhumuqin sheep in a specific embodiment of the present invention, during the PCR amplification in step (2), the total volume of the amplification system is 20 μL, including 1 μL of each upstream and downstream primers, 1 μL of template, 6 μL of premix, and 11 μL of deionized water.

[0027] According to the method for evaluating the fertility of Gaowuzhumuqin sheep in a specific embodiment of the present invention, the PCR amplification program in step (2) is 95°C pre-denaturation for 3 minutes, 98°C denaturation for 10 seconds, 62°C annealing for 15 seconds, 68°C extension for 57 seconds, 30 cycles, 68°C extension for 7 minutes, 4°C storage, and then sequencing.

[0028] Beneficial effects of the present invention:

[0029] The present invention found that the molecular marker related to the polygynous trait of Ujumchin sheep exists in the region from 72677979bp to 72726550bp of chromosome 17 of sheep with the nucleotide sequence NCBI Reference Sequence NC_056070.1 of HIRA gene c.1273G>T.

[0030] The present invention designs specific primers and uses DNA sequencing technology to detect whether there is a G→A mutation at 1273bp in the HIRA gene coding region in the Ujumchin sheep genome, determines the genotype of the Ujumchin sheep individual at this site, and realizes the single nucleotide polymorphism detection of the HIRA gene c.1273G>A, so as to compare the polymorphism of the HIRA gene c.1273G>A in the Ujumchin sheep breed.

[0031] The statistical results show that the specific primers of the present invention can detect the molecular marker, and thus can be used to assist in the breeding of Ujumchin sheep, screen for Ujumchin sheep with high fertility, and increase the number of lambs born by Ujumchin sheep. The method of the present invention can be used as an effective method to assist in improving or screening the multi-birth trait of Ujumchin sheep. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on this drawing without paying creative work.

[0033] Figure 1 This is a diagram of the PCR product of NC_056070.1:c.1273G>A of HIRA of the present invention.

[0034] Figure 2 This is a diagram of the sequencing results of NC_056070.1:c.1273G>A of HIRA of the present invention. DETAILED DESCRIPTION

[0035] To make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described in detail below. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other implementation methods obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0036] Example 1 Establishment of a method for detecting molecular markers of the fecundity trait of Ujumqin sheep

[0037] 1) Formwork material preparation

[0038] Blood samples were collected from Ujumchin sheep and the number of lambs and parity were recorded. The Ujumchin sheep were from East Ujumchin Banner, Xilin Gol League, Inner Mongolia. The blood samples were stored in anticoagulant tubes for later use.

[0039] 2) PCR product sequencing

[0040] Twelve Wujumchin sheep (6 ewes that gave birth to twin lambs consecutively and 6 ewes that gave birth to single lambs consecutively) were selected for PCR product sequencing, and the SNP site located in the coding region of the HIRA gene was found, namely NC_056070.1:c.1273G>A.

[0041] 3) Primer design

[0042] According to the sheep gene sequence reported by GeneBank (GeneBank accession number: NC_056070.1), the present invention designed upstream and downstream primers F and R by itself, and finally obtained the primer sequence as follows through comparison and screening:

[0043] F:5'-CCGAGGGTCTCAATTTCAGTT-3';

[0044] R: 5′-TGCAGCCACAAGCACAGG-3′.

[0045] The genome extracted from the experimental materials of Ujumchin sheep was used as a template and amplified using the above primers.

[0046] The amplification system of the upstream and downstream primers was consistent, and the total volume of the amplification system was 20 μL, including 1 μL of each upstream and downstream primers, 1 μL of template, 6 μL of premix, and 11 μL of deionized water.

[0047] The amplified products were sequenced after 30 cycles of pre-denaturation at 95°C for 3 min, denaturation at 98°C for 10 s, annealing at 62°C for 15 s, extension at 68°C for 57 s, and extension at 68°C for 7 min. The products were stored at 4°C.

[0048] The PCR amplification results of HIRA NC_056070.1:c.1273G>A are shown in Figure 1 .

[0049] The nucleotide sequence of the PCR product is shown in SEQ ID NO.3:

[0050] Ccgagggtctcaatttcagttcagcgagagtttcttgctatttgttctgcgtcagacctgccagagggtcaggcattcactcgcatccccaggtgtagacgccttgaaggctgtaagcgcccgagtagggtgcagggccgctcctgacacgtagtcagcagcaggcaggccgcgggagggctcagggaccctgcccggggccccgtcttccctgagtggggagctactcacaacttgcccacgggtgggcagcgtcacacccctcaatcggccttccccagagccgcatccaccaggccacctacggcaagagcctggccatcatgaccgaggcccagctgtccaccgctgtcatcgagaaccccgagatgctgcagtaccagcacaggcagcagcagctggaccacaagggccccgcggccagggacgccgcacccgcggccagggacacaggctccgccccctcggtcgctggcgtcgtcaatggggagagcctggaggacattcggaaggtgagggctgggcctggtgctccgaggacactgcccacagcctttccagagcggtgcacccagggcagtgggcctcgggccctgccctctggagactatcagctccttgtctttccttgggcgccgtgctcccctggggtgcgggtgcgggtggggggggtgggaagggcaacgacggagct gggggctaaagccatccccaggtgctcgtgcagggcgccccccgcccccggtggagcgcacacagggtgcggcgggagccctcggttatgagcctttggtgggaagcttttacaaaccatggtttagagacaggaggtcaggtctcgcccggtaggtgactccgcgtggagcctgtgcttgtggctgca

[0051] The sequencing results are shown in Figure 2If a single peak appears at the 72697217th base position of chromosome 17 and the genotype is G, then the genotype is GG. If an overlapping peak appears at the 72697217th base position of chromosome 17, then the genotype is GA. If a single peak appears at the 72697217th base position of chromosome 17 and the genotype is A, then the genotype is AA.

[0052] Example 2 Statistical analysis of HIRA genotypes and their relationship with the fecundity traits of the Ujumqin sheep population

[0053] The Ujumchin sheep were subjected to gene detection according to the primers designed in Example 1, and the genotype frequency and allele frequency of the Ujumchin sheep were calculated. Please refer to Table 1 for the statistical results.

[0054] Table 1 Statistical results of genotype frequency and allele frequency of Ujumqin sheep

[0055]

[0056] Note: The numbers in brackets are sample numbers.

[0057] The results are shown in Table 1. The genotype frequencies of GG, GA and AA of Ujumchin sheep were 0.700, 0.248 and 0.052, respectively. The frequencies of G and A alleles were 0.824 and 0.176, respectively. The G allele was the dominant allele.

[0058] The HIRA genotype and its association with the fecundity of Ujumchin sheep were analyzed. The specific experiments are as follows:

[0059] (1) Individual genotype analysis was performed on some loci in the selected test sample population to calculate the allele frequency and genotype frequency. 2 test.

[0060] (2) The gene frequency and genotype frequency of the locus were calculated based on the test results, and the distribution of the genotype of the locus was subjected to the chi-square fitness test of Hardy-Weinberg equilibrium. SPSS19.0 software was used to analyze the association between the fecundity trait and the genotype of the Ujumchin sheep population. The statistical model included genotype as a fixed effect and ram as a random effect, and a mixed linear model (MLM) was constructed as follows:

[0061] Y=μ+G+R+e;

[0062] Among them: Y is the recorded value of lambing number; μ is the population average; G is the genotype effect, R is the ram effect; e is the random residual effect.

[0063] The mean values ​​and standard errors of the number of lambs born by different genotypes in Ujumchin sheep are shown in Table 2.

[0064] Table 2 Statistical results of the mean and standard error of the number of lambs born by Ujumqin sheep with different genotypes

[0065]

[0066] Note: a, c: p<0.01.

[0067] The results are shown in Table 2. The AA genotype has a 0.38 higher number of lambs than the GG genotype, which indicates that the mutation of the G allele to the A allele has a significant effect on the lambing traits of Ujumchin sheep, and the difference in the number of lambs between different genotypes at this site is significant (p<0.01). The results show that the genetic diversity of this site can be used to screen for breeding sheep that improve the fecundity traits of Ujumchin sheep.

[0068] Example 3 Method for improving the fertility of Ujumchin sheep

[0069] The method for improving the fertility of Ujumqin sheep of the present embodiment comprises the following steps:

[0070] (1) extracting genomic DNA of the Ujumqin sheep to be tested;

[0071] (2) PCR amplification using specific primers;

[0072] The genome extracted from the experimental material of Ujumchin sheep was used as a template, and the primers described in Example 1 were used for amplification. The total volume of the amplification system was 20 μL, including 1 μL of upstream and downstream primers, 1 μL of template, 6 μL of premix, and 11 μL of deionized water;

[0073] Pre-denaturation at 95°C for 3 min, denaturation at 98°C for 10 s, annealing at 62°C for 15 s, extension at 68°C for 57 s, 30 cycles, extension at 68°C for 7 min, storage at 4°C, and sequencing;

[0074] (3) Determine the genotype of the 1273rd nucleotide of the HIRA gene in the Ujumqin sheep genome,

[0075] If a single peak appears at the 72697217th base of chromosome 17 and the genotype is G, the genotype is GG; if an overlapping peak appears at the 72697217th base of chromosome 17, the genotype is GA; if a single peak appears at the 72697217th base of chromosome 17 and the genotype is A, the genotype is AA;

[0076] The Ujumchin sheep with AA genotype at position 1273 in the HIRA gene coding region were selected as breeding parents.

[0077] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. Specific primers for molecular markers of the Ujumqin sheep fertility-related gene HIRA, characterized in that: The specific primer sequences are as follows: SEQ ID NO.1: 5'-CCGAGGGTCTCAATTTCAGTT-3'; SEQ ID NO. 2: 5'-TGCAGCCACAAGCACAGG-3'.

2. Use of specific primers for molecular markers of the Ujumchin sheep fertility-related gene HIRA as described in claim 1.

3. Use of the specific primers for the molecular marker of the Ujumchin sheep fertility-related gene HIRA described in claim 1 in assisting Ujumchin sheep breeding.

4. A method for selecting high-fertility Ujumqin sheep, characterized in that: The method comprises the step of amplifying the genomic DNA of Ujumchin sheep using the specific primers described in claim 1.

5. The method for screening high-fertility Ujumqin sheep according to claim 4, characterized in that: The method comprises the following steps: (1) extracting genomic DNA of the Ujumqin sheep to be tested; (2) using the genomic DNA of the Ujumchin sheep extracted in step (1) as a template, performing PCR amplification with specific primers to obtain an amplified product; (3) Determine the genotype of the 1273rd nucleotide of the HIRA gene in the Ujumchin sheep genome in the amplified product, and select the Ujumchin sheep with the AA genotype at the 1273rd nucleotide in the HIRA gene coding region as the breeding parent.

6. The method for screening high-fertility Ujumchin sheep according to claim 5, characterized in that: During the PCR amplification in step (2), the total volume of the amplification system is 20 μL, including 1 μL of each specific primer, 1 μL of template, 6 μL of premix, and 11 μL of deionized water.

7. The method for screening high-fertility Ujumchin sheep according to claim 5, characterized in that: The amplification program of step (2) is: pre-denaturation at 95°C for 3 min, denaturation at 98°C for 10 s, annealing at 62°C for 15 s, extension at 68°C for 57 s, 30 cycles, and extension at 68°C for 7 min.

8. A kit for detecting the fetal trait of Ujumqin sheep, characterized in that: The kit includes specific primers for molecular markers of the Ujumqin sheep fertility-related gene HIRA, and the sequences of the specific primers are as follows: SEQ ID NO.1: 5'-CCGAGGGTCTCAATTTCAGTT-3'; SEQ ID NO. 2: 5'-TGCAGCCACAAGCACAGG-3'.

9. The Ujumqin sheep multiple birth trait detection kit according to claim 8, characterized in that: The kit includes 1 μL of each specific primer, 1 μL of template, 6 μL of premix, and 11 μL of deionized water.

Images