SNP (Single Nucleotide Polymorphism) molecular marker related to eight-week-old weight of chicken and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to the weight of a chicken at the age of 8 weeks and application of the SNP molecular marker, and belongs to the field of molecular biology, the position of an SNP site in a genome is the 10th nucleotide, the 617th nucleotide and the 483th nucleotide of a chromosome 3, and the SNP name is rs315282035. The GWAS result shows that the SNP site presents G / A polymorphism, and G has a positive effect on the weight of the 8-week-old chicken. For the site, genotype statistical analysis is carried out in other high-weight and low-weight chicken populations, and the GG genotype is the dominant genotype of the high-weight chicken. Therefore, the chicken of which the site is GG genotype can be preferably selected, and early selection of high-weight chickens is expected to be carried out, so that genetic breeding of the chickens is accelerated.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to a SNP molecular marker associated with the weight of chickens at 8 weeks of age and an application thereof. Background Art

[0002] Among the meat consumption of Chinese residents, the consumption of chicken ranks second only to pork. In recent years, with the change of consumption concepts of Chinese residents, the per capita consumption of chicken has also been increasing. After years of development, my country's broiler farming industry has become one of the world's largest broiler producers. Broiler farming occupies an important position in China's agriculture. It not only meets the consumption needs of the domestic market, but also occupies a certain share in the international market. With the upgrading of domestic consumption structure and the improvement of residents' living standards, the demand for high-quality broilers continues to grow, further promoting the development of the broiler farming industry.

[0003] With the rapid growth of demand, increasing production and improving quality have become the key directions in the breeding field. The traditional breeding method of selecting chicken varieties with excellent traits is labor-intensive, cumbersome and inefficient. With the advancement of genomic research and the development of genetic marker technology, breeding scientists can select genotypes with excellent traits for breeding, thereby promoting further improvement in chicken production and quality.

[0004] SNP (single nucleotide polymorphism) is an important form of genetic variation, which is characterized by abundant quantity, wide distribution and high stability. It is widely used in molecular breeding and genetic research. However, in the molecular breeding practice of broiler chickens, markers that can clearly define functions and significantly affect traits are still scarce. Therefore, in-depth exploration of molecular markers with strong effects and high applicability has become a current research hotspot. In particular, if the key SNPs associated with the target traits can be accurately located and the molecular mechanisms behind them can be elucidated, it will provide new ideas for the genetic improvement of chickens and promote major breakthroughs in the field of poultry breeding.

[0005] The weekly weight of chickens is a core trait. By discovering SNP molecular markers that are significantly correlated with the weekly weight of chickens, the production efficiency of the group can be significantly improved by selecting chicken breeds that grow fast and weigh more. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a SNP molecular marker related to chicken body weight traits and its application.

[0007] The technical solution of the present invention is: a method for breeding chickens with high weight traits, extracting genomic DNA from chicken samples, detecting the genotype at position 10,617,483 of chromosome 3 of the chicken samples, selecting individuals with a genotype of GG at the site as having a higher weight trait than other genotypes, and the reference genome version is GRCg6a.

[0008] The invention discloses an application of a material for detecting SNP site polymorphism or genotype in assisting breeding of chickens with high weight traits. The SNP site is located at position 10,617,483 of chromosome 3 of chicken and has a G / A polymorphism. Individuals with a genotype of GG at this site have a higher weight trait than those with other genotypes. The reference genome version is GRCg6a.

[0009] Furthermore, the substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.2.

[0010] The invention discloses an application of a substance for detecting polymorphism or genotype of a SNP site in preparing a chicken high body weight trait auxiliary breeding kit, wherein the SNP site is located at the 436th position of the nucleotide sequence shown in SEQ ID No.3.

[0011] Furthermore, the substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.2.

[0012] A kit comprises a primer pair as shown in SEQ ID No.1 and SEQ ID No.2.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] The SNP molecular marker of the present invention is significantly correlated with the weight of chickens at 8 weeks of age. The GG genotype is the dominant genotype of high-weight chickens, and the proportion of the GG genotype in high-weight chickens is significantly higher than that in low-weight chickens. Therefore, chickens with the GG genotype at this site can be preferred, which is expected to be selected early for high-weight chickens, thereby accelerating the genetic breeding of chickens. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Association between chromosome 3 SNP and chicken weight at 8 weeks of age;

[0016] Figure 2 Genotype distribution of different chicken breeds;

[0017] Figure 3 The proportion of different genotypes in high- and low-weight chickens. DETAILED DESCRIPTION

[0018] The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all purchased from commercial channels unless otherwise specified.

[0019] Example 1 Mining of SNP Molecular Markers

[0020] The resequencing technology was used to sequence the individuals of the hybrid population of chickens, and the identified SNPs were quality-controlled and filtered, from which a SNP site significantly associated with the weight of chickens at 8 weeks of age was selected ( Figure 1 ).

[0021] The SNP is located at position 10,617,483 on chromosome 3 of the genome version GRCg6a (https: / / ftp.ensembl.org / pub / release-106 / fasta / gallus_gallus / dna / Gallus_gallus.GRCg6a.dna.chromosome.1.fa.gz) (SNP name is rs315282035). The SNP was detected in 1155 chicken individuals, and the allele frequency, effect value and significant P value are shown in Table 1. The G allele showed a strong positive phase with body weight (BETA=23.5741), so the G allele has an advantage in high-weight chicken breeds.

[0022] Table 1 Allele frequencies and effect sizes

[0023]

[0024] Example 2 Validation of SNP Molecular Markers

[0025] 1. Experimental Materials

[0026] High-weight chicken breeds: Luxi fighting chicken (n=9), Nanjiang fighting chicken (n=8), Cornish chicken (n=1), Langshan chicken (n=10), White Plymouth chicken (n=1), Guangxi chicken (n=6), Miyi chicken (n=5), Yuanbao chicken (n=24).

[0027] Low-weight chicken breeds: Daweishan small chicken (n=8), Jiangxi silk-feather chicken (n=20), Tibetan chicken (n=1), Tibetan chicken (Aba, n=6), Tibetan chicken (Haiyan, n=6), Tibetan chicken (Lhasa, n=27), Tibetan chicken (Shigatse, n=35), Tibetan chicken (Shannan, n=26).

[0028] 2. Test methods

[0029] The genotype data of 928 chickens were downloaded from Galbase (http: / / animal.omics.pro / code / index.php / ChickenVar). The genotypes of rs315282035 in 64 high-weight chicken breeds and 129 low-weight chicken breeds were extracted using a self-written script, and the genotype distribution of each chicken breed was statistically analyzed ( Figure 2 ).

[0030] 3. Results Analysis

[0031] The frequency of allele G of chr3:10,617,483 in the high-weight chicken group was 0.73, and the frequency in the low-weight group was 0.45, which was significantly different, with a P value of 7.95×10 -08 . Therefore, the G genotype is the dominant allele for high-weight chickens. The genotype analysis found that the proportion of the GG genotype in high-weight chickens was 0.64, and the proportion of the GG genotype in low-weight chickens was 0.26. The frequency of the GG genotype in high-weight chickens was 2.46 times that of low-weight chickens, which was statistically significant, with a P value of 3.87×10 -07 ( Figure 3 ). Thus, by comparing the SNP frequency and genotype distribution of the groups of higher-weight and lower-weight chickens, the SNP molecular marker was confirmed. By selecting individuals with the GG allele at this site, the weight of the breeding population can be increased.

[0032] Example 3 Detection of SNP Molecular Markers

[0033] (1) Based on the upstream and downstream sequence information of the SNP molecular marker, primers for amplifying the fragment containing the SNP site were designed;

[0034] Forward primer F: CTGGGCAAAAGGAGACTTGA (SEQ ID No. 1)

[0035] Reverse primer R: AGGAACAAGGCTGCACAGAT (SEQ ID No. 2)

[0036] (2) Extracting genomic DNA from the chicken sample to be tested as a template, performing PCR amplification using the primer pair designed in (1) to obtain an amplified product of 861 bp in size containing the SNP site, the sequence of which is shown in SEQ ID No. 3. The SNP site is located at position 436 of the sequence shown in SEQ ID No. 3.

[0037] (3) The amplified product is subjected to Sanger sequencing to obtain the genotype of the SNP site.

Claims

1. A method for breeding high-weight chickens, characterized in that: The genomic DNA of the chicken samples was extracted, and the genotype of position 10,617,483 of chromosome 3 of the chicken samples was tested. Individuals with the genotype of GG at this site were selected to have a higher body weight trait than other genotypes. The reference genome version was GRCg6a.

2. Application of substances for detecting SNP site polymorphism or genotype in assisting breeding of high weight traits in chickens. The SNP site is located at position 10,617,483 of chromosome 3 of chicken and has G / A polymorphism. Individuals with the genotype GG at this site have a higher weight trait than those with other genotypes. The reference genome version is GRCg6a.

3. The use according to claim 2, characterized in that: The substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.

2.

4. Use of a substance for detecting SNP site polymorphism or genotype in the preparation of a chicken high weight trait assisted breeding kit, wherein the SNP site is located at position 436 of the nucleotide sequence shown in SEQ ID No.

3.

5. The use according to claim 4, characterized in that: The substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.

2.

6. A kit comprising the primer pair shown as SEQ ID No.1 and SEQ ID No.2.

Images