A method for evaluating pig resilience, its related molecular primer pairs and kit
By identifying polymorphic sites at specific sites in the pig genome and judging the pig's resilience genotype, the problem of lack of effective evaluation of pig resilience in the prior art is solved, and accurate assessment of pig resilience and efficient screening of breeding is achieved.
Patent Information
- Application Number
- CN202510123974.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-26
- Publication Date
- 2025-04-04
AI Technical Summary
The prior art lacks effective methods to evaluate pig resilience, affecting the accuracy of breeding and management.
By designing specific primer pairs to PCR amplify the pig genome, identify the DNA fragments of the base polymorphism site at position 27429586 from the end of 5´ on chromosome 11, and judge the pig's resilience genotype (GG, TG, TT), thereby screening high or low resilience pigs.
This method can accurately evaluate the resilience of pigs, reduce breeding costs, improve breeding efficiency, and effectively increase or decrease the resilience of pigs in actual production.
Smart Images
Figure CN119753171A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for evaluating pig resilience, and a related molecular primer pair and a kit. Background Art
[0002] As global environmental conditions become more complex, pig farms are facing increasing external challenges (such as heat stress, feed resource fluctuations, etc.). Research on resilience traits provides ideas for precision breeding and intelligent management of modern pig farms. Pigs with strong resilience can recover quickly after disease or stress, thereby maintaining high production performance (such as daily weight gain, reproductive performance, feed utilization efficiency, etc.) and reducing economic losses caused by disease or stress.
[0003] The standard deviation of pig litter weight refers to the degree of variation in litter weight recorded for multiple parities. The larger the standard deviation of pig litter weight, the greater the impact of the individual on the environment and the lower the resilience. Conversely, the higher the resilience. By exploring the genetic and physiological mechanisms of resilience, not only can production efficiency be improved, but also the health level of pigs and animal welfare can be improved. At the same time, using resilience as a breeding goal and its application in genomic selection breeding and precision management will drive the breeding industry towards a more efficient, environmentally friendly and sustainable direction. Therefore, there is an urgent need in the prior art for a method for evaluating pig resilience, its related molecular primer pairs and kits. Summary of the invention
[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a method for evaluating pig resilience, a pair of related molecular primers and a kit.
[0005] The objective of the present invention is achieved through the following technical solutions: A primer pair for evaluating pig resilience, the nucleotide sequence of which is shown below: Upstream primer: 5′-CGGATCCCAGATCACTACCT-3′, SEQ ID No. 2; Downstream primer: 5′-CAAAGGGCACTTTTCTCAGC-3′, SEQ ID No. 3; The primer pair is used to amplify a DNA fragment containing the polymorphic site at base position 27429586 from the 5' end on chromosome 11 of the pig reference genome Sscrofa11.1; The pig reference genome Sscrofa11.1 is the pig reference genome sequence in the GenBank database.
[0006] The present invention also provides a kit for evaluating pig resilience, which comprises the primer pair.
[0007] A method for evaluating pig resilience comprises the following steps: using pig genomic DNA as a template and using the primer pair to perform PCR amplification to obtain a PCR amplification product; if the 190th position of the PCR amplification product from the 5' end is base G, the genotype of the pig is a GG genotype; if the 190th position of the PCR amplification product from the 5' end is base T and G, the genotype of the pig is a TG genotype; if the 190th position of the PCR amplification product from the 5' end is base T, the genotype of the pig is a TT genotype; the resilience of the GG genotype pig is higher than that of the TG genotype pig, and the resilience of the TG genotype pig is higher than that of the TT genotype pig.
[0008] Furthermore, the amplification system of the PCR amplification is: 100ng of genomic DNA; 25µL of Green Taq Mix; 200nm of upstream and downstream primers respectively; the system is supplemented to 50µL with ddH2O; the amplification program of the PCR amplification is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 62°C for 15 seconds, extension at 72°C for 60 seconds, for a total of 35 cycles; extension at 72°C for 5 minutes.
[0009] The present invention also provides a method for breeding pigs with higher resilience, comprising the following contents: the breeding method is to breed pigs with GG genotype; using the pig's genomic DNA as a template, PCR amplification is performed using the primer pair to obtain a PCR amplification product, and if the 190th position of the PCR amplification product from the 5' end is base G, then the genotype of the pig is GG genotype.
[0010] Furthermore, the amplification system of the PCR amplification is: 100ng of genomic DNA; 25µL of Green Taq Mix; 200nm of upstream and downstream primers respectively; the system is supplemented to 50µL with ddH2O; the amplification program of the PCR amplification is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 62°C for 15 seconds, extension at 72°C for 60 seconds, for a total of 35 cycles; extension at 72°C for 5 minutes.
[0011] The present invention also provides a method for breeding pigs with lower resilience, comprising the following contents: the breeding method is to breed pigs with TT genotype; using the pig's genomic DNA as a template, PCR amplification is performed using the primer pair to obtain a PCR amplification product, and if the 190th position of the PCR amplification product from the 5' end is base T, the genotype of the pig is a TT genotype.
[0012] Furthermore, the amplification system of the PCR amplification is: 100ng of genomic DNA; 25µL of Green Taq Mix; 200nm of upstream and downstream primers respectively; the system is supplemented to 50µL with ddH2O; the amplification program of the PCR amplification is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 62°C for 15 seconds, extension at 72°C for 60 seconds, for a total of 35 cycles; extension at 72°C for 5 minutes.
[0013] The beneficial effects of the present invention are as follows: the present invention determines the resilience of the selected pigs by the 190th base from the 5' end of the PCR amplification product of the pig's genomic DNA, can screen the selected pigs at an early stage, reduce breeding costs, and effectively increase or decrease the resilience of pigs in actual production. The method has high accuracy and low cost, and has high application value in pig breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figure 1 The results of the whole-genome association analysis of the standard deviation phenotype of litter weight within pigs; Figure 2 This is the phenotype of standard deviation of litter weight within pigs with different genotypes of SSC11 g.27429586T>G; Figure 3 These are the sequencing results near the g.27429586T>G polymorphic site on chromosome 11 of the reference genome Sscrofa11.1 of individual pigs with TT, TG and GG genotypes. DETAILED DESCRIPTION
[0015] The present invention is described in detail below with reference to the accompanying drawings.
[0016] The pig reference genome sequences in the following embodiments all refer to Sscrofa11.1.
[0017] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.
[0018] Example Identification of the standard deviation of total litter weight within pigs and the level of recovery 1. Experimental Animals The experimental pig groups used in the present invention are all from the Duroc breeding pig group of Chifeng Jiayu Breeding Technology Co., Ltd.
[0019] A total of 1,129 sows from this resource group were selected for this experiment. The production parities of the pigs in the group ranged from 1 to 10, and the litter weights of all pigs in each parity were accurately recorded. The standard deviation of the litter weight within the pigs was calculated by the following formula 1 to evaluate the pig's resilience. The smaller the standard deviation of the litter weight within the pigs, the higher the resilience, and vice versa. All phenotypic data were collected in accordance with the data format requirements of the National Swine Genetic Evaluation Center.
[0020] Formula 1: ; In the formula, is the total number of pig parities recorded, It's the pig in Parity litter weight ， It is the average litter weight of pigs.
[0021] 2. Genotyping of SNPs on Chip Ear samples were taken from 1,129 pigs in the above group, and whole-genome DNA was extracted by the standard phenol-chloroform method. The quality of DNA of each sample was tested by Nanodrop2000 / 2000C nucleic acid protein detector. The qualified DNA samples were sent to Beijing Compson Biotechnology Co., Ltd., and the genotypes of pig whole genome KPS® Zhongxin-1 Porcine Breeding Chip_V2 (116 pigs), KPS® Zhongxin-1 Porcine Breeding Chip_plus (663 pigs) and CAU50K (350 pigs) were determined according to the company's standard procedures. The quality control of all sample chip data was performed by PLINK software, and finally the valid genotype data of 46,358 SNPs were obtained for genome-wide association analysis of resilience phenotypes.
[0022] 3. Genome-wide association analysis The resilience phenotype effect analysis was performed using SAS9.2 software, and it was found that the field and batch effects significantly affected the internal litter weight standard deviation phenotype. Therefore, the internal litter weight standard deviation phenotype was corrected using the field and batch based on the mixed animal model, and the breeding value of the resilience phenotype was estimated based on ASReml. The association analysis between SNP and resilience phenotype was performed using GCTA software. The significance threshold for the association between SNP and resilience traits was 1.0786 × 10 -6 GWAS analysis results are as follows Figure 1 As shown. Figure 1 It can be seen that there is a locus on chromosome 11 that significantly affects the resilience of pigs. The SNP locus g.27429586T>G is extremely significantly correlated with pig resilience (P < 3.09× 10 -10 ).
[0023] There are significant differences in phenotypes among different genotypes in the population (see Figure 2 ): The standard deviation of litter weight within the TT individual pigs was significantly higher than that within the GG individual pigs, and the standard deviation of litter weight within the TG individual pigs was between the two pure and homozygous individuals. This shows that the resilience of pigs with the GG genotype is significantly higher than that of pigs with the TT genotype, and the resilience of pigs with the heterozygous TG genotype is between the two pure and homozygous individuals.
[0024] The above results indicate that this molecular marker significantly affects pig resilience and can be used for marker-assisted selection to improve the resilience of pigs in this group, thereby accelerating the breeding process for the resilience trait.
[0025] 4. Determination of the polymorphism of the porcine SNP site g.27429586T>G 1) Three pig ear samples with different genotypes and phenotypes were used as experimental materials, and genomic DNA was extracted from each of them.
[0026] 2) Primer design and synthesis According to the pig reference genome Sscrofa11.1 sequence, the following primers were designed and synthesized using Primer3 online software (Beijing Liuhe BGI Genomics Co., Ltd.): U (upstream primer): 5′- CGGATCCCAGATCACTACCT -3′ (SEQ ID No. 2); D (downstream primer): 5′-CAAAGGGCACTTTTCTCAGC -3′ (SEQ ID No. 3).
[0027] 3) PCR amplification The three pig genomic DNAs obtained in step 1 were used as templates and U and D were used as primers for PCR amplification to obtain PCR amplification products, which were named products 1, 2 and 3, respectively.
[0028] PCR amplification system: genomic DNA 100ng; Green Taq Mix 25µL; upstream and downstream primers 200nm each; use ddH2O to make up the system to 50µL.
[0029] PCR amplification program: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 62°C for 15 seconds, extension at 72°C for 60 seconds, for a total of 35 cycles; and final extension at 72°C for 5 minutes.
[0030] 4) Sequencing and sequence analysis Products 1, 2, and 3 are sequenced to obtain the sequences of products 1, 2, and 3. The three product sequences differ by only one base, which is the 190th base from the 5' end of the three sequences, as shown in SEQ ID No. 1. The 190th base from the 5' end is base M, and this site can be G, T, or T and G. The base at this site is a T / G mutation, such as Figure 3 Indicated by the arrow in the middle. This site is the 27429586th base from the 5' end on chromosome 11 of the pig reference genome Sscrofa11.1, so the site is named SSC11 g.27429586T>G.
[0031] The individual with G at the 27429586th base from the 5' end on chromosome 11 of the pig reference genome Sscrofa11.1 (or the 190th base from the 5' end of the PCR amplification product obtained in step 3) is a homozygous individual, and the genotype of this individual is named GG. The individual with T at the 27429586th base from the 5' end on chromosome 11 of the pig reference genome Sscrofa11.1 (or the 190th base from the 5' end of the PCR amplification product obtained in step 3) is a homozygous individual, and the genotype of this individual is named TT. The individual with T and G at the 27429586th base from the 5' end on chromosome 11 of the pig reference genome Sscrofa11.1 (or the 190th base from the 5' end of the PCR amplification product obtained in step 3) is a heterozygous individual, and the genotype of this individual is named TG.
[0032] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.
Claims
1. A primer pair for evaluating pig resilience, characterized in that: Its nucleotide sequence is as follows: Upstream primer: 5′-CGGATCCCAGATCACTACCT-3′, SEQ ID No. 2; Downstream primer: 5′-CAAAGGGCACTTTTCTCAGC-3′, SEQ ID No. 3; The primer pair is used to amplify a DNA fragment containing the polymorphic site at base position 27429586 from the 5' end on chromosome 11 of the pig reference genome Sscrofa11.1; The pig reference genome Sscrofa11.1 is the pig reference genome sequence in the GenBank database.
2. A kit for evaluating pig resilience, characterized in that: The kit comprises the primer pair described in claim 1.
3. A method for evaluating pig resilience, characterized in that The method comprises the following steps: using pig genomic DNA as a template and using the primer pair described in claim 1 or claim 2 to perform PCR amplification to obtain a PCR amplification product; if the 190th position of the PCR amplification product from the 5' end is base G, the genotype of the pig is a GG genotype; if the 190th position of the PCR amplification product from the 5' end is base T and G, the genotype of the pig is a TG genotype; if the 190th position of the PCR amplification product from the 5' end is base T, the genotype of the pig is a TT genotype; the resilience of the GG genotype pig is higher than that of the TG genotype pig, and the resilience of the TG genotype pig is higher than that of the TT genotype pig.
4. The method for evaluating pig resilience according to claim 3, characterized in that: The amplification system of the PCR amplification is: 100ng of genomic DNA; 25µL of Green Taq Mix; 200nm of upstream and downstream primers respectively; the system is supplemented to 50µL with ddH2O; the amplification program of the PCR amplification is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 62°C for 15 seconds, extension at 72°C for 60 seconds, for a total of 35 cycles; extension at 72°C for 5 minutes.
5. A method for breeding pigs with higher resilience, characterized in that The invention comprises the following contents: the breeding method is to breed pigs with GG genotype; using the pig's genomic DNA as a template, PCR amplification is performed using the primer pair described in claim 1 or claim 2 to obtain a PCR amplification product, and if the 190th position of the PCR amplification product from the 5' end is base G, the genotype of the pig is GG genotype.
6. The method for breeding pigs with higher resilience according to claim 5, characterized in that: The amplification system of the PCR amplification is: 100ng of genomic DNA; 25µL of Green Taq Mix; 200nm of upstream and downstream primers respectively; the system is supplemented to 50µL with ddH2O; the amplification program of the PCR amplification is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 62°C for 15 seconds, extension at 72°C for 60 seconds, for a total of 35 cycles; extension at 72°C for 5 minutes.
7. A method for breeding pigs with lower resilience, characterized in that The invention comprises the following contents: the breeding method is to breed pigs with TT genotype; using the pig's genomic DNA as a template, PCR amplification is performed using the primer pair described in claim 1 or claim 2 to obtain a PCR amplification product, and if the 190th position of the PCR amplification product from the 5' end is base T, the genotype of the pig is TT genotype.
8. The method for breeding pigs with lower resilience according to claim 7, characterized in that: The amplification system of the PCR amplification is: 100ng of genomic DNA; 25µL of Green Taq Mix; 200nm of upstream and downstream primers respectively; the system is supplemented to 50µL with ddH2O; the amplification program of the PCR amplification is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 62°C for 15 seconds, extension at 72°C for 60 seconds, for a total of 35 cycles; extension at 72°C for 5 minutes.