Primer pair for identifying dendrobium nobile germplasm from different producing areas and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a primer pair for identifying dendrobium nobile germplasm from different producing areas and application of the primer pair. According to the invention, chloroplast genomes of dendrobium nobile germplasm from different producing areas are sequenced, and three highly variable sites, including psbE-petL, ndhB-rps7 and petA-psbJ, are found, and have significant differences in Yunnan dendrobium nobile (Yunjin) and red-water dendrobium nobile (Huangjin). On the basis of the differential sequence, five special specific primer pairs are designed, and the PCR amplification effect of Yunjin and Huangjin is detected by utilizing the primer pairs. Results show that all primer pairs can obtain PCR products, and the amplification success rate is 100%. The result of further sequencing the PCR product shows that the primer group Primer 1 based on the psbE-petL sequence has remarkable specificity, the difference between the cloud gold and the red gold is most obvious, the sequencing success rate is 100%, and the Primer 1 can be used for specifically distinguishing the cloud gold and the red gold.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a primer pair for identifying Dendrobium nobile from different origins and an application thereof. Background Art

[0002] Dendrobium nobile Dendrobium nobile Lindl, also known as Jinchai Stone and Flat Jinchai, is a plant of the genus Dendrobium in the Orchidaceae family, with high medicinal and ornamental value. Lindl has rich chemical components, including alkaloids, polysaccharides, phenols, amino acids, volatile oils, lignans and other compounds. Modern research shows that the pharmacological effects of Lindl are mainly manifested in anti-tumor, hypoglycemic and protection of the nervous system, and it has great research value and development potential.

[0003] Dendrobium nobile is an important medicinal plant with a cultivation history of more than 1,500 years. Different climate, soil and ecological conditions have nurtured rich germplasm resources of Dendrobium nobile. At present, the main ones circulating in the market are Dendrobium nobile (Yunjin) produced in Yunnan and Dendrobium nobile (Chijin) produced in Chishui, Guizhou. Studies have shown that there are significant differences in the chemical composition and clinical efficacy of Yunjin and Chijin. However, for a long time, the market has failed to effectively distinguish Yunjin and Chijin, resulting in mixed use of medicinal materials; at the seedling stage, their appearance is very similar, and it is difficult to distinguish Yunjin and Chijin based on appearance alone. At present, although microscopic and physical and chemical identification methods have been used to distinguish Yunjin and Chijin, these methods have limitations such as expensive equipment and limited experimental conditions. With the development of modern molecular biotechnology, some nr DNA molecular markers have also been used to identify Dendrobium species, but the primer specificity of this method is not high, and no targeted primer design has been performed. Therefore, there is an urgent need to develop a highly specific DNA molecular marker to identify and distinguish between Yunjin and Chijin, so as to improve the accuracy and efficiency of identification of Yunjin and Chijin and promote the standardized cultivation and quality control of Dendrobium nobile medicinal materials. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a primer pair for identifying cloud gold and red gold and its application. The primer pair provided by the present invention can specifically distinguish cloud gold and red gold.

[0005] The technical solution adopted by the present invention is: The invention provides a primer for specifically distinguishing Yunjin and Chijin, wherein the primer pair comprises an upstream primer F and a downstream primer R; the nucleotide sequence of the upstream primer F is shown in SEQ ID No.1: GAGATCGTTGGAGCAATCCAT; the nucleotide sequence of the downstream primer R is shown in SEQ ID No.2: CTCAATCCAGATACGACGGT.

[0006] The present invention also provides a kit for specifically distinguishing Yunjin Gold from Chijin Gold, and the kit comprises the above-mentioned primer pair.

[0007] The present invention also provides the use of the primer pair or the kit in distinguishing Yunjin from Chijin.

[0008] The present invention also provides a method for distinguishing cloud gold from red gold, comprising the following steps: The genomic DNA of the sample to be tested was used as a template, and the PCR reaction system was prepared using the above primer pair or the above kit for PCR amplification. After sequencing the PCR product, the software CodonCode Aligner (CodonCode Co., USA) was used for sequence splicing and proofreading. First, the primer regions at both ends of the sequence were removed using the software, and then the sequencing quality was assessed and preprocessed, that is, the low-quality parts at both ends of the sequencing results were removed, and the sequence of the target fragment was obtained, see SED ID No.3 and SED ID No.4. Yunjin and Chijin were distinguished by the differential sites in the sequence. If the sequence at the 199-205 bp position of the amplified product is missing, the sample to be tested is Yunjin; if the sequence at the 199-205 bp position is AATATTC, the sample to be tested is Chijin.

[0009] Preferably, the PCR amplification reaction procedure includes: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, for a total of 30 cycles; and finally extension at 72°C for 5 min, with a termination temperature of 4°C.

[0010] Preferably, the PCR amplification reaction system is 20 μL, including 2 μL of template DNA, 1 μL of upstream and downstream primers, 10 μL of 2 × Taq Plus PCR MasterMix, and 6 μL of ddH2O.

[0011] Preferably, the concentrations of the upstream primer and the downstream primer are both 10 μmol / L.

[0012] Preferably, the concentration of the template is 30 - 60 ng / μL.

[0013] Preferably, the 2×Taq Plus PCR MasterMix is ​​purchased from Beijing Hongyue Innovation Technology Co., Ltd. and is produced under the product number DM1220.

[0014] Preferably, the sample to be tested is fresh tissue and / or a dried sample tissue whose DNA is not degraded. Beneficial Effects

[0015] The present invention provides a primer pair for specifically distinguishing Dendrobium nobile (Yun Jin and Chi Jin) from different origins, the primer pair comprising an upstream primer F and a downstream primer R; the nucleotide sequence of the upstream primer F is shown in SEQ ID No.1: GAGATCGTTGGAGCAATCCAT; the nucleotide sequence of the downstream primer R is shown in SED ID No.2: CTCAATCCAGATACGACGGT. The present invention sequences the chloroplast genomes of Yun Jin and Chi Jin, and finds three highly variable sites through sequence comparison, including psbE-petL , ndhB-rps7 and petA-psbJ , there are significant differences in Yunjin and Chijin. The present invention designs specific primer pairs based on the above difference sequences, and uses the above primer pairs to perform PCR amplification and sequencing on Yunjin and Chijin samples. Analysis of the sequencing results found that based on psbE-petL The sequence-designed primer pair Primer 1 has the most obvious difference between the two origins of Dendrobium nobile, and can accurately and effectively distinguish Yunjin and Chijin.

[0016] Specifically, the method of the present invention is as follows: (1) Fresh leaves of Dendrobium officinale and Dendrobium officinale were taken, ground thoroughly with liquid nitrogen, and the total DNA of the leaves was extracted using the Polysaccharide and Polyphenol Plant Genomic DNA Extraction Kit (TIANGEN, Beijing, China).

[0017] (2) Using the DNA extracted in step (1) as a template and the molecular specific labeled primers (AF, AR) as amplification primers, PCR amplification is performed.

[0018] The composition of the PCR reaction system per 20 μL is as follows:

[0019] PCR amplification conditions are as follows: Pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min, for a total of 30 cycles; finally extension at 72°C for 5 min, with a termination temperature of 4°C.

[0020] (3) Take 5 μL of the amplified product from step (2) and spot it on a 1% agarose gel. Use a DNA molecular weight standard (DL2000 DNA marker) as a DNA marker and perform electrophoresis in 1 × TAE buffer. The voltage and electrophoresis time are set to 100 V and 30 min, respectively. After the electrophoresis, place the agarose gel on a UV gel imaging analyzer for development. If obvious and clear DNA bands appear in the electrophoresis results, the PCR amplification product can be further sequenced. The software CodonCode Aligner (CodonCode Co., USA) is used for sequence splicing and proofreading. First, the primer regions at both ends of the sequence are removed using the software. Then, the sequencing quality is assessed and preprocessed, that is, the low-quality parts at both ends of the sequencing results are removed. The sequence of the target fragment is obtained by referring to SED ID No.3 and SED ID No.4. If the sequence at the 199-205 bp position of the amplified product is missing, the sample to be tested is Yunjin; if the sequence at the 199-205 bp position is AATATTC, the sample to be tested is Chijin.

[0021] The present invention provides a primer pair for specifically distinguishing between Yunjin and Chijin, the primer pair comprising an upstream primer F and a downstream primer R; the nucleotide sequence of the upstream primer F is shown in SEQ ID No.1: GAGATCGTTGGAGCAATCCAT; the nucleotide sequence of the downstream primer R is shown in SED ID No.2: CTCAATCCAGATACGACGGT. The present invention sequenced the chloroplast genomes of Yunjin and Chijin, and found three highly variable sites through sequence analysis, including psbE- petL, ndhB-rps7 and petA-psbJ , there are significant differences in Yunjin and Chijin. The present invention designs specific primer pairs based on the above difference sequences, and uses the above primer pairs to perform PCR amplification and sequencing on Yunjin and Chijin samples. Analysis of the sequencing results found that based on psbE-petL The sequence-designed primer pair Primer 1 has the most obvious difference between the two origins of Dendrobium nobile, and can accurately and effectively distinguish Yunjin and Chijin. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Gel electrophoresis and sequencing results of Primer 1 amplification products Figure 2 Gel electrophoresis results of the amplified products of the five designed primer pairs DETAILED DESCRIPTION

[0023] The present invention provides a primer pair for identifying Dendrobium nobile and Dendrobium chinense and its application, the primer pair comprising an upstream primer F and a downstream primer R; the nucleotide sequence of the upstream primer F is shown in SED ID No.1: GAGATCGTTGGAGCAATCCAT; the nucleotide sequence of the downstream primer R is shown in SED ID No.2: CTCAATCCAGATACGACGGT. The primer pair provided by the present invention can be used to perform PCR amplification on a Dendrobium nobile sample to be tested, and the Dendrobium nobile and Dendrobium chinense can be specifically distinguished according to the sequencing results of the amplified products.

[0024] The present invention also provides a kit for specifically distinguishing cloud gold from red gold, the kit comprising the above primer pair. The kit provided by the present invention can specifically distinguish cloud gold from red gold. The specific principle is the same as above and will not be repeated here.

[0025] The present invention also provides the use of the primer pair or the kit in distinguishing cloud gold from red gold. The primer pair or kit provided by the present invention can specifically distinguish cloud gold from red gold. The specific principle is the same as above and will not be repeated here.

[0026] The present invention also provides a method for distinguishing cloud gold from red gold, comprising the following steps: The genomic DNA of the sample to be tested was used as a template, and the PCR reaction system was prepared using the above primer pair or the above kit, and PCR amplification and sequencing were performed; after sequencing of the PCR product, the software CodonCode Aligner (CodonCode Co., USA) was used for sequence splicing and proofreading. First, the primer regions at both ends of the sequence were removed using the software, and then the sequencing quality was evaluated and preprocessed, that is, the low-quality parts at both ends of the sequencing result were removed to obtain the sequence of the target fragment. If the sequence at the position of 199-205 bp of the amplified product is missing, the sample to be tested is Yunjin; the sequence is as shown in SED ID No.3, specifically: TTTCGTGATGCAACTGTTGTTACATTAGATCCCCCCAAGAGTTCTTTCCTTATGGAACTACAATACAAAACAAAGATGGGATTCTTTAATATGGAAAGAATATAGAACCTAAAAGGGTATAAAAGGGTAATAGAAGTTGCTCTTCTTTGAATCGAGTTGGTCCGAAATCAAATTCAAATAAAGAAAGAAAATGAA-------AATATTTTGATATTTTTTGAAAAAGTCAAGGCTTTCTTTTTTTTTTAGTGTCCGTCTATAATGACGGATAAATCAAGAACTTAAAATTGGAACTAAACGAATTCTTTCAATTTGTTTTTCTTACCGTCGGGAGA; if the sequence at the position of 199-205 bp is AATATTC, the sample to be tested is Chijin; the sequence is as shown in SED ID As shown in No.4, specifically: ATTCGTGATGCAACTGTTGTTACATTAGATCCCCCCAAGAGTTCTTTCCTTATGGAACTACAATACAAACAAAGATGGGATTCTTTAATATGGAAAGAATATAGAACCTAAAAGGGTATAAAAGGGTAATAGAAGTTGCTCTTCTTTGAATCGAGTTGGTCC GAAATCAAATTCAAATAAAGAAAGAAAATGAAAATATTCAATATTTTGATATTTTTTGAAAAAGTCAAGGCTTTCTTTTTTTTTGTGTCCGTCTATAATGACTGATAAATCAAGAACTTCAATGGAACTAAACGAATTCTTTCAATTTGTTTTTCTTACCGTCGTAGTGAGA.

[0027] In the present invention, the sample to be tested is preferably fresh tissue and / or a dry sample without NDA degradation.

[0028] In the present invention, the amplification reaction system is 20 μL, preferably including 2 μL of template DNA, 1 μL of upstream and downstream primers, 10 μL of 2 × Taq Plus PCR MasterMix, and 6 μL of ddH2O; the concentration of the template DNA is preferably 30-60 ng / μL.

[0029] The present invention has no special requirements on the sources of the reagents of the PCR amplification reaction system, and commercially available products known to those skilled in the art can be used. The 2×Taq Plus PCR MasterMix used in the present invention and the examples is purchased from Beijing Hongyue Innovation Technology Co., Ltd. under the product number DM1220.

[0030] In order to further illustrate the present invention, a primer pair for identifying Yunjin and Chijin provided by the present invention and its application are described in detail below in conjunction with examples. The following examples are provided for a better understanding of the present invention, and are not limited to the best implementation mode, and do not limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior arts is within the protection scope of the present invention. Example 1

[0031] A primer pair for identifying cloud gold and red gold, the primer pair comprises an upstream primer F and a downstream primer R; the nucleotide sequence of the upstream primer F is shown in SED ID No.1: GAGATCGTTGGAGCAATCCAT; the nucleotide sequence of the downstream primer R is shown in SED ID No.2: CTCAATCCAGATACGACGGT. Example 2

[0032] A method for specifically distinguishing Yunjin and Chijin seedlings, comprising the following steps: 1. Extraction of total DNA from samples to be identified (1) Weigh 2 g of fresh leaves of the sample (seedlings), rinse the leaves with sterile distilled water, and dry them with filter paper; (2) Liquid nitrogen was added to thoroughly grind the tissue, and other operations were performed according to the Polysaccharide and Polyphenol Plant Genomic DNA Extraction Kit (TIANGEN, Beijing, China).

[0033] (3) The DNA quality was checked by agarose gel electrophoresis and NanoDrop2000 / 2000C spectrophotometer. The final concentration was maintained at 15-30 ng / μL and stored at -20°C for future use.

[0034] 2. PCR Amplification The total DNA extracted in step 1 was used as a template, and a PCR reaction system was prepared using the primer pairs designed in Example 1 to perform PCR amplification; the amplification system was 20 μL: including 2 μL of template DNA, 1 μL of upstream and downstream primers, 10 μL of 2 × Taq Plus PCRMasterMix, and 6 μL of ddH2O; the concentration of the template DNA was preferably 30-60 μL; the reaction procedure of the PCR amplification was: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min, for a total of 30 cycles; and finally extension at 72°C for 5 min, with a termination temperature of 4°C.

[0035] 3. Determination of amplification products The PCR amplification product obtained in step 2 is subjected to gel electrophoresis. If the electrophoresis result shows obvious and clear DNA bands and the length of the amplification product is 200-250 bp, the PCR amplification product can be further sequenced and compared.

[0036] 4. Sequencing The PCR amplification product obtained in step 3 was subjected to Sanger bidirectional sequencing on an Applied BiosystemsTM 3730XL sequencer. After sequencing the PCR product, the software CodonCode Aligner (CodonCode Co., USA) was used for sequence splicing and proofreading. First, the primer regions at both ends of the sequence were removed using the software, and then the sequencing quality was assessed and preprocessed, that is, the low-quality parts at both ends of the sequencing results were removed, and the sequence of the target fragment was obtained, see SED ID No.3 and SED ID No.4. If the sequence of the amplified product of the sample to be tested is missing at the 199-205 bp position, it is Yunjin; if the sequence of the amplified product at the 199-205 bp position is AATATTC, the sample to be tested is Chijin.

[0037] Depend on Figure 1 It can be seen that the method provided by the present invention can effectively distinguish between cloud gold and red gold.

[0038] Comparative Example 1 In order to obtain specific primers with good discrimination, the present invention uses the mVISTA online tool to perform a global comparison of the full-length chloroplast genomes of Yunjin and Chijin. According to the differences between the two samples, candidate regions were manually selected and 5 pairs of primers were designed in a targeted manner. The specific information of the primers is shown in Table 1.

[0039]

[0040] Comparative Example 2 In order to screen the special specific primer pairs, the five pairs of primers in Comparative Example 1 were selected respectively, and the Yunjin and Chijin were amplified by a method similar to Example 2. The electrophoresis results are shown in FIG. Figure 1 Further sequencing analysis revealed that the Primer 1 primer pair (Primer 1-F and Primer 1-R, i.e. the primer pair designed in Example 1) could most intuitively and clearly distinguish between Cloud Gold and Red Gold.

[0041] In summary, the primer pair or kit provided by the present invention can specifically distinguish Dendrobium nobile (Yunjin and Chijin) from different origins.

[0042] Although the present invention has been disclosed as above in the preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. The present invention provides a primer pair for specifically distinguishing between Cloud Gold and Red Gold, characterized in that: The primer pair includes an upstream primer F and a downstream primer R; the nucleotide sequence of the upstream primer F is shown in SEQ ID No.1: GAGATCGTTGGAGCAATCCAT; the nucleotide sequence of the downstream primer R is shown in SEQ ID No.2: CTCAATCCAGATACGACGGT.

2. A kit for specifically distinguishing cloud gold from red gold, characterized in that: The kit contains the primer pair described in claim 1, and the kit can specifically distinguish between cloud gold and red gold.

3. Use of the primer pair as claimed in claim 1 or the kit as claimed in claim 2 in distinguishing cloud gold from red gold.

4. A method for specifically distinguishing cloud gold from red gold, comprising the following steps: The genomic DNA of the sample to be tested is used as a template, and the reaction system is prepared using the above primer pairs or kits for PCR amplification. After sequencing the PCR products, sequence alignment is performed to distinguish Yunjin and Chijin by the difference sites in the sequence. If the amplified product is missing at the 199-205 bp position, it is Yunjin; if the sequence of the amplified product at the 199-205 bp position is AATATTC, the sample to be tested is Chijin.

5. The method for specifically distinguishing cloud gold from red gold according to claim 4, characterized in that: The PCR amplification reaction procedure includes: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min, for a total of 30 cycles; and finally extension at 72°C for 5 min, with a termination temperature of 4°C.

6. A method for specifically distinguishing cloud gold from red gold according to claim 4 or 5, characterized in that: The PCR amplification reaction system is 20 μL, including 2 μL of template DNA, 1 μL of upstream and downstream primers, 10 μL of 2 × Taq PlusPCR MasterMix, and 6 μL of ddH2O.

7. The method according to claim 6, characterized in that The concentrations of the upstream primer and the downstream primer were both 10 μmol / L; the concentration of the template was 30-60 ng / μL.

8. The method according to claim 6, characterized in that The 2× Taq Plus PCR MasterMix was purchased from Beijing Hongyue Innovation Technology Co., Ltd. and the product number was DM1220.

9. The method according to claim 4, characterized in that The sample to be tested is fresh tissue and / or a dry sample without NDA degradation.

Images