Molecular markers associated with NCLB resistance on maize chromosome 1 and their application

Abstract

The present invention relates to the field of agricultural biotechnology, and in particular to molecular markers associated with resistance to corn chromosome 1 northern leaf spot (NCLB) and their applications. Specifically, the present invention discloses a SNP site molecular marker associated with corn NCLB resistance. The molecular marker sequence is shown in SEQ ID NO. 1. As shown in SEQ ID NO: 1, the base at the 201st bp position from the 5′ end of the sequence exhibits a T / C polymorphism. The present invention constructed a multi-parent population of corn with significant differences in NCLB resistance and, using GWAS analysis, located a site on chromosome 1, Chr1: SNP_305669223, that is significantly associated with NCLB resistance. The results of the present invention contribute to further research on the regulatory mechanism of corn NCLB resistance and also provide technical support for breeding NCLB-resistant corn varieties.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biotechnology, in particular to a SNP molecular marker site associated with NCLB resistance on maize chromosome 1, and a protein or gene associated with the site and applications thereof. Background Art

[0002] Corn is one of China's most important food crops, occupying more than one-third of the country's grain crop planting area for the past five years. However, corn production has long been threatened by several major diseases, among which Northern Leaf Blight (NCLB) is one of the most important corn leaf diseases caused by the disease Setosphaeria turcica. NCLB causes corn yield losses by reducing the photosynthetic area of corn leaves. The yield losses caused by NCLB are generally related to the severity of the disease and range from 30% to 62%. Corn is infected before silking, and large-scale spread during the grain filling period causes the most serious yield losses. In summary, improving corn resistance to NCLB is a key goal of plant breeding and biotechnology-assisted improvement. Therefore, the discovery of functional genes closely related to corn NCLB resistance can provide technical support for molecular marker-assisted selection of corn resistant to NCLB. Summary of the Invention

[0003] To address this issue, the present invention identified a locus on maize chromosome 1, Chr1: SNP_305669223, significantly associated with NCLB resistance. This discovery led to the identification of the functional gene Zm00001d034918, which regulates maize resistance to NCLB. The Zm00001d034918 gene, discovered in this study, is a functional gene that regulates maize resistance to Setosphaeria turcica. qRT-PCR results showed that the expression of this gene was significantly elevated in all four parental lines after artificial inoculation with the disease Setosphaeria turcica.

[0004] In order to achieve the above object, the present invention provides the following technical solutions:

[0005] The present invention provides a SNP site molecular marker associated with corn NCLB resistance. The SNP site is located in Chr1: SNP_305669223 of corn. The molecular marker sequence is shown in SEQ ID NO.1. As shown in SEQ ID NO:1, the base at the 201bp site from the 5' end of the sequence presents a T / C polymorphism.

[0006] Furthermore, the present invention provides the use of a product for detecting the SNP site molecular marker in identifying or assisting in the identification of corn NCLB resistance, wherein the use is to detect a corn variety with significant NCLB resistance when the genotype of the site 201 bp from the 5′ end of the sequence shown in SEQ ID NO: 1 is CC. In some specific embodiments, the product for detecting the SNP site molecular marker can be a detection product designed based on known single nucleotide polymorphism (SNP) detection methods such as Sanger sequencing, TaqMan probe method, ARMS-PCR method (Amplification Refractory Mutation System PCR), KASP (Kompetitive Allele-Specific PCR), etc., and is targeted at the site of the present invention.

[0007] Furthermore, the present invention provides a method for improving the resistance of corn to NCLB, using a gene editing tool to mutate the genotype of the 201bp site from the 5′ end of the sequence shown in SEQ ID NO: 1 to CC. In some specific embodiments, the gene editing tool can be a CRISPR / Cas9 system, a CRISPR / Cas12a system, a prime editor (PE), ZFN technology (Zinc Finger Nucleases), TALEN technology (Transcription Activator-Like Effector Nucleases) and other existing technical tools.

[0008] Furthermore, the present invention provides a maize NCLB resistance protein associated with the SNP site molecular marker, and the amino acid sequence of the protein is shown in SEQ ID NO.3.

[0009] Furthermore, the present invention provides a gene encoding the maize NCLB resistance protein, and the gene is shown as SEQ ID NO.2.

[0010] Furthermore, the present invention provides a kit comprising reagents for detecting the protein or the gene.

[0011] Furthermore, the kit contains primers for detecting the gene shown in SEQ ID NO.2.

[0012] Furthermore, in the kit, the primers are shown as SEQ ID NO.4 and / or SEQ ID NO.5.

[0013] Furthermore, the present invention provides use of any of the kits described above in identifying or assisting in identifying corn NCLB resistance, wherein the expression level of the protein or gene is positively correlated with the corn NCLB resistance.

[0014] Furthermore, the present invention provides the use of the SNP site molecular marker, or the protein, or the gene in molecular marker-assisted breeding of NCLB-resistant corn.

[0015] The beneficial effects achieved by the present invention are:

[0016] The present invention provides a molecular marker locus associated with NCLB resistance on maize chromosome 1, Chr1: SNP_305669223, as well as the protein or gene associated with this locus, Zm00001d034918, and their applications. This invention utilizes the moderately NCLB-resistant maize inbred line Ye107 as a common parent and crosses it with three temperate and subtropical maize inbred lines with varying NCLB resistance to construct a multi-parent maize population with significantly different NCLB resistance. GWAS analysis mapped Chr1: SNP_305669223, a locus on chromosome 1 significantly associated with NCLB resistance, and further identified the functional gene Zm00001d034918 regulating NCLB resistance in maize. qRT-PCR results indicate that the expression of this gene was significantly elevated in all four parental lines after artificial inoculation with Setosphaeria turcica. The results of this invention facilitate further research into the regulatory mechanisms of resistance to northern leaf blight in maize and provide technical support for breeding corn varieties resistant to northern leaf blight. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0018] Figure 1 Figure 2 is the correlation result of pop1, pop2 and pop3 with NCLB in three environments; a: Violin plot of the phenotypic distribution of RILs of pop1, pop2 and pop3 in three different environments (YS21, JH22, YS22) in response to NCLB; bd: Correlation analysis of NCLB in different environments of the same population of pop1, pop2 and pop3 respectively;

[0019] Figure 2 This is the evolutionary tree diagram of pop1, pop2 and pop3;

[0020] Figure 3 This is the principal component analysis result diagram of pop1, pop2 and pop3;

[0021] Figure 4This is a graph of resistance SNP mining using GWAS in the study population; in (a) to (c), the left graph is a Manhattan graph, the right graph is a QQ graph, (a) is the result of YS21S, (b) is the result of YS22S, and (c) is the result of BLUP;

[0022] Figure 5 This is the association map between SNP_305669223 site and functional gene Zm00001d034918;

[0023] Figure 6 This is the haplotype analysis diagram of NCLB resistance-related SNPs. The coordinates in the figure are BLUP values.

[0024] Figure 7 Relative expression levels of the Zm00001d034918 gene 0.5 to 48 h after inoculation with Setosphaeria turcica; the letters in the figure indicate the difference compared with the control group, A indicates p < 0.05, b indicates p < 0.05, C indicates p < 0.01, and d indicates p < 0.001. DETAILED DESCRIPTION

[0025] To further illustrate the present invention, the following detailed description of the NCLB resistance-related molecular marker site Chr1: SNP_305669223 on chromosome 1 of maize provided by the present invention, as well as the Zm00001d034918 protein or gene associated with the site and their applications is provided in conjunction with the accompanying drawings and examples. However, these should not be construed as limiting the scope of protection of the present invention.

[0026] On one hand, the present invention provides a SNP molecular marker site Chr1: SNP_305669223 associated with NCLB resistance on chromosome 1 of corn, which is referenced to genome B73 (RefGen_v4); in some specific embodiments, for the detection of this SNP site, the present invention provides a molecular marker sequence as shown in SEQ ID NO.1, and the base of the 201bp position from the 5′ end of the sequence as shown in SEQ ID NO:1 presents a T / C polymorphism. Those skilled in the art can design corresponding products for detection based on the sequence as shown in SEQ ID NO.1 provided by the present invention, using detection methods known in the art, and based on the test results, if the genotype of the site is detected to be CC, then the corn sample to be tested is judged to be a corn variety with significant NCLB resistance.

[0027] SEQ ID NO: 1:

[0028] 5'-ACTGTAAAAGAAAAAAATCAATGTTCTATAGTGGTTTTATTTCAAATCAAAAGGCCAACTAAAAGAGTGTTCACTATGGCTGTAAAAATAAATTCAGTGTTCTACATACCCATGGTACACTCACATCTCCTCCTTGTTGATAACACATTCTTCTGACTCATGAGCATGCAGATGACATCTTGGGCCTTGATGATGTTTGAG[T / C]TGTACAACCATTTAGTCCCACAAATCCCAGCAGTAGCAATGTGTTAAACGCAATCGCCAAATGACAGTAGCATTGTGTGACAATTAAGGTATCTTGTTACAACAAGCTTCAAAGGGTTAATATATATTAGTAATATTCCCAAAACATGGTAGAAAAATATGCAAATTAAAGCCACCAAACTGACAAACTAATTGTATATT-3'

[0029] In another aspect, the present invention uses GWAS analysis to locate Chr1: SNP_305669223 on chromosome 1, which is significantly associated with NCLB resistance. Furthermore, the functional gene Zm00001d034918 that regulates maize resistance to NCLB was discovered. The amino acid sequence of the Zm00001d034918 protein is shown in SEQ ID NO. 3, and the gene sequence encoding the protein is shown in SEQ ID NO. 2. qRT-PCR results show that the expression level of this gene was significantly increased in all four parents after artificial inoculation with the disease Setosphaeria turcica, indicating that the expression level of this gene or protein is positively correlated with resistance to corn leaf blight. In some specific embodiments, those skilled in the art can design corresponding detection products based on the sequences shown in SEQ ID NO. 2 or SEQ ID NO. 3 provided by the present invention, and screen maize varieties with significant NCLB resistance based on the expression level of Zm00001d034918.

[0030] Example 1

[0031] 1.1 Plant materials

[0032] The experiment was carried out in three different ecological environments in Yanshan County, Yunnan Province (denoted as YS, 1540 m above sea level, 104.5°E longitude, 23.6°N) in 2021 and Jinghong City (denoted as JH, 606.5 m above sea level, 100.58°E longitude, 21.54°N) in 2022. Three multi-parent populations were obtained using the single-seed descent method: pop1 (Ye107×Zheng58), pop2 (Ye107×AN20) and pop3 (Ye107×HuangC); information on the four parents (Ye107, Zheng58, AN20 and HuangC) is shown in Table 1. The common parent, Ye107, is a key elite inbred line bred from two lines from different heterotic groups in a Chinese breeding program and has been used as a parent in many commercial hybrids planted in a considerable production area in China [Zhen, S., Gao, G., Wang, X., Ning, H., and Duan, X. (2004). Appraisal of drought-enduring quality of several maize inbred lines. J Maize Sci. (in Chinese) 12, 18-19.].

[0033] The three polyparental populations included 196 recombinant inbred lines (RILs) from pop1, 148 from pop2, and 184 from pop3, ultimately resulting in a total of 528 RILs with rich genetic variation. Parental information is shown in Table 1.

[0034] Table 1 Parent information

[0035]

[0036]

[0037] 1.2 Experimental design

[0038] A randomized block design (RCBD) was used at three locations in Yanshan in 2021 (denoted as YS21S), Yanshan in 2022 (denoted as YS22S) and Jinghong in 2022 (denoted as JH22W), with three replicates at each location. Each experimental field had a row length of 4.0m, a row spacing of 0.7m, a plant spacing of 0.25m, 14 plants per row, and 10 plants were sampled from the middle of each row. The experimental corn was grown in accordance with local standard agronomic practices. The statistical method for northern leaf spot disease is referenced to [Li, C., Ling, F., Su, G. et al. Location and mapping of the NCLB resistance genes in maize by bulked segregant analysis (BSA) using whole genome re-sequencing. Mol Breeding 40, 92 (2020). https: / / doi.org / 10.1007 / s11032-020-01171-3].

[0039] 1.3 Heritability analysis

[0040] After preliminary processing of the phenotypic data collected at the three locations and times, correlation analysis was performed on the NCLB grades in different populations and environments using the Ime4 package in R software (V4.0.5). The mean, standard deviation, skewness, kurtosis, and coefficient of variation of NCLB were calculated, and a normal distribution test was performed. Broad-sense heritability was calculated using the methods of [Knapp SJ. Confidence intervals for heritability for two-factor mating design single environment linear models. Theor Appl Genet. 1986; 72(5): 587-591.] and [Moran, P.; Smith, C. The correlation between relatives on the supposition of mendelian inheritance. Trans. Royal Soc. Edinb. 1918, 52, 438-899.].

[0041] DNA extraction and genome sequencing

[0042] Genomic DNA from maize seedling leaves was first extracted using the cetyltrimethylammonium bromide (CTAB) method. Subsequently, the genomic DNA isolated from each F9RIL was digested with the restriction endonucleases PstI and MspI and ligated with barcoded adapters using T4 ligase (New England BioLabs). GBS DNA libraries were constructed and sequenced according to the GBS protocol.

[0043] All connected samples were combined and purified using the QIAquick PCR purification kit (QIAGEN, Valencia, California, USA). Polymerase chain reaction (PCR) amplification was performed using primers matching the adapter. Finally, the PCR products were purified and quantified using the Qubit dsDNA HS assay kit (Life Technologies, Grand Island, New York, USA). After selecting 200-300bp PCR products using the Egel system (Life Technologies), the library concentration was estimated using a Qubit 2.0 fluorometer and a Qubit dsDNA HS assay kit (Life Technologies). Subsequently, sequencing reads were generated using TASSEL v5.0 (Li C, Guan H, Jing X, et al. Genomic insights into historical improvement of heterotic groups during modern hybrid maize breeding. Nat Plants. 2022; 8 (7): 750-763.). Before TASSEL analysis, 80 poly (A) bases were attached to the 3' end of all sequencing reads. For comparative analysis, the B73 (RefGen_v4) reference genome sequence was used and analyzed using Sentieon software (parameter "bwamem-k 32-MR") (Pei S, Liu T, Ren X, Li W, Chen C, Xie Z. Benchmarking variant callers in next-generation and third-generation sequencing analysis. Brief Bioinform. 2021; 22(3): bbaa148). Samtools (using the parameter rmdup) was used to compare the results for sorting and deduplication. Finally, 549,531 high-quality SNPs were generated and annotated using the ANNOVAR (Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res. 2010; 38(16): e164.) software tool.

[0044] 1.5 Population structure, phylogenetic trees, and PCA

[0045] For population structure analysis, we used a model-based clustering algorithm in admix v1.3 [Mussmann, SM; Douglas, MR; Chafin, TK; Douglas, MEADMIXPIPE: Population analyses in ADMIXTURE for non-model organisms. BMC Bioinform. 2020, 21, 337.]. The initial analysis consisted of multiple runs with successive K values ranging from 1 to 12, each with five-fold cross-validation. The most likely K value was determined using the cross-validation values from admix. Inbred lines with membership probabilities greater than 0.5 were assigned to the corresponding clusters and visualized using TBtools software v1.098727 [Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant. 2020, 13, 1194–1202.]. Phylogenetic tree analysis was performed using Tassel v5.0 software, using 549,531 high-quality single-nucleotide polymorphisms (SNPs) to assess the genetic relationships among the 528 RILs. Principal component analysis (PCA) was performed using the R package 4.3.2, and the results were visualized using the scatterplot3d package.

[0046] 1.6 Genome-wide association analysis

[0047] GWAS was performed using the efficient mixed-model association (EMME) analysis method in the GEMMA (Genome-wide efficient mixed-model analysis for association studies) (Zhou X, Stephens M. Genome-wide efficient mixed-model analysis for association studies. Nat Genet. 2012; 44(7): 821-824. Published 2012 Jun 17.) software package.

[0048] The present invention uses PLINK (Purcell S, Neale B, Todd-Brown K, et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet. 2007; 81(3): 559-575.) to calculate independent markers with a parameter of -independent airwise 5050.2. The formula -log10(1 / number of SNPs) was used to calculate a significance threshold of -log10(p)>4.5 to identify significant SNPs associated with maize NCLB. SNPs that met or exceeded the threshold were extracted using bedtools v1.7 (Strable J, Wallace JG, Unger-Wallace E, et al. Maize YABBY Genes drooping leaf1 and drooping leaf2 RegulatePlantArchitecture. Plant Cell. 2017; 29(7): 1622-1641.), and candidate genes associated with maize NCLB were identified in the 100 kb regions upstream and downstream of the significantly associated SNPs based on the B73 (RefGen_v4) reference genome and annotation information. In the process of screening candidate genes, we referred to the screening distance of candidate genes in temperate maize by Zhang et al. (2016, 2022) [Zhang, X., et al., Characterizing the population structure and genetic diversity of maize breeding germplasmin Southwest China using genome-wide SNP markers. BMC Genomics, 2016. 17(1): p. 697.][Zhang, X., et al., Genetic architecture of maize yield traits dissected by QTL mapping and GWAS in maize. The Crop Journal, 2022. 10(2): p. 436-446.].

[0049] 1.7 Haplotype analysis

[0050] Haplotype analysis of SNPs associated with NCLB in the three environments was performed using Haploview v4.2 software. First, a high-density genome-wide SNP haplotype map was constructed. Haplotypes of SNPs significantly associated with resistance to northern leaf blight were identified based on their location and LD analysis. Finally, genes within the haplotypes were annotated to identify functionally relevant loci.

[0051] 1.8 qRT-PCR and gene expression

[0052] After RNA was extracted using the RNAprep Pure Plant Kit from TIANGEN, the first-strand cDNA was synthesized using the FastKingRT Kit (With gDNase). TM Quantitative PCR Detection System (qRT-PCR) was used to determine the relative expression of candidate genes in different parental lines. The reaction volume was 20 μL. Infected leaves were collected 0.5, 1, 3, 6, 9, 12, 24, and 48 hours after artificial inoculation. Uninoculated leaves from each parent were also collected as controls. The relative expression of candidate gene Zm00001d034918 was analyzed using two primer pairs: F-1-18'CTCCACGAGACCATCCTGACC' and R-1-18'CCTCTTCGCCTAGCACCAAA. GAPDH was used as an internal reference gene for qRT-PCR. The qRT-PCR reaction program was set using a three-step method: pre-denaturation stage at 95°C for 15 min; PCR reaction stage at 95°C for 10 s, annealing at 56°C for 20 s, and extension at 72°C for 30 s, during which signals were collected; melting curve stage at 95°C for 15 s, 60°C for 1 min, and 95°C for 1 s, during which fluorescence signals were collected every 0.5°C during the process of reaching 95°C, and 40 cycles were set.

[0053] 2. Results

[0054] 2.1 Phenotypic analysis of large spot disease

[0055] We planted three RIL populations, Pop1, Pop2, and Pop3, in three environments [Yanshan (2021 and 2022) and Jinghong (2022)] and identified the NCLB disease grade index. As shown in Table 2, based on the disease data of the three RILs populations investigated, we performed descriptive statistics. It can be seen that the absolute values of the kurtosis and skewness of Pop1, Pop2, and Pop3 are all less than 1, indicating that their phenotypic frequencies are approximately normally distributed. The heritability of the NCLB disease grade index of the three populations under the three environments was 0.972, 0.939, and 0.946, respectively. The higher heritability makes the candidate genes identified by GWAS more reliable. Figure 1 From a, we can see that Pop1's disease grade distribution is closer to the lower end than Pop2 and Pop3. This indicates that Pop1's disease severity is lower and it is more resistant to disease. Figure 1 b to Figure 1 The correlation coefficients among the three populations ranged from a low of 0.755 (Pop1YS21S and JH22W) to a high of 0.986 (Pop2YS21S and YS22S). Pop1, Pop2, and Pop3 exhibited high correlation coefficients across different environments, demonstrating their remarkable stability in responding to NCLB invasion, providing strong support for the reliability of the GWAS analysis.

[0056] Table 2 Statistical analysis results of NCLB phenotype

[0057]

[0058] Note: W stands for winter, S stands for summer. Env stands for environment. Range stands for the range of plant disease levels within the population. SD stands for standard deviation. CV stands for coefficient of variation. 2 Represents heritability.

[0059] 2.2 Group structure of RIL groups

[0060] The present invention uses Admixture software to analyze the population structure of 528 materials. The analysis results are as follows Figure 4 As shown, overall, the population structure, principal component analysis (PCA) and phylogenetic tree ( Figure 2 、 Figure 3 ) results were consistent with those of the previous study. RILs could be divided into three major clusters based on lineage or genetic background. At K = 3, the population structure of RILs became clear, with 196 RILs in pop1, 148 in pop2, and 184 in pop3. Phylogenetic tree analysis also revealed three genetic clusters, consistent with the population structure based on kinship.

[0061] 2.3 Genome-wide association analysis of NCLB

[0062] The present invention uses 528 samples, 549531 effective SNPs markers (minimum allele frequency MAF ≥ 5%, missing value r 2 GWAS analysis was performed with a threshold of -log10(P)>4.5, and multiple SNPs significantly associated with NCLB were identified. In the BLUP analysis, the locus Chr1: SNP_305669223 was identified as significantly associated with NCLB resistance.

[0063] 2.6 Identification and validation of candidate genes associated with NCLB

[0064] We screened candidate genes in the 100 kb upstream and downstream regions of the significant SNPs consistently identified in different environments. Finally, candidate genes that may be involved in regulating NCLB resistance were identified (Table 3). SNP_305669223 was identified in three environments: YS21S, YS22S, and BLUP, with phenotypic differences of 5.32%, 4.771%, and 4.82%, respectively. Screening the 100 kb region around this SNP revealed a candidate gene, Zm00001d034918 ( Figure 5 Functional annotations from the NCBI and MaizeGDB databases showed that Zm00001d034918 encodes ABC transporter G family member 3. This candidate gene is related to plant energy metabolism (Table 4).

[0065] Table 3 Candidate genes associated with NCLB

[0066]

[0067] Haplotype analysis was performed on SNPs that were significantly associated with NCLB resistance and consistently identified in multiple environments. To determine the relationship between different haplotypes and NCLB resistance, haplotype analysis was performed on SNPs. SNP_305669223 is located 76.059 kb downstream of Zm00001d034918 and has a T / C substitution ( Figure 5 This SNP is located within a terminal inverted repeat (TIR) element, which can be up to 1.517 kb long ( Figure 5 ). SNP_305669223 showed two haplotypes: Hap1 (TT) and Hap2 (CC) ( Figure 6). Haplotype Hap2(CC) was more resistant to NCLB than Hap1(TT), and the two haplotypes had significant differences in resistance to NCLB. Therefore, we speculated that Hap2 might be a superior haplotype that enhances NCLB resistance. 278 Hap1(TT) and 22 Hap2(CC) were detected among 528 RILs, and the Hap2 haplotype was only identified in pop1 (Table 4). Overall, haplotype analysis showed that the dominant haplotype of SNP_305669223 was mainly found in pop1. Therefore, pop1 was considered to exhibit better resistance to NCLB, confirming the disease score distribution of RILs in pop1, which showed lower disease severity compared with pop2 and pop3.

[0068] Table 4 Gene haplotype distribution

[0069]

[0070]

[0071] To determine the effect of the candidate gene Zm00001d034918 on NCLB resistance, we performed qRT-PCR analysis on this gene using four parents. We measured the relative expression of this gene in corn leaves at 0.5, 1, 3, 6, 9, 12, 24, and 48 hours after artificial inoculation, as well as untreated leaves from each parent as a control. The results are shown in Figure 2. Figure 7 The results showed that, compared to the uninoculated control group, the expression of the Zm00001d034918 gene increased significantly and steadily in all four parents after pathogen inoculation. In HuangC and Zhang58, Zm00001d034918 expression increased from 0.5 to 48 hours. In AN20, expression began to decrease after 6 hours, and in Ye107 after 0.5 hours.

[0072] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting SNP site molecular markers in identifying or assisting in identifying corn NCLB resistance, characterized in that: The SNP site is located in Chr1: SNP_305669223 of corn, and the molecular marker sequence is shown in SEQ ID NO.

1. The base of the 201bp site from the 5′ end of the sequence shown in SEQ ID NO:1 presents a T / C polymorphism. The application is to detect that when the genotype of the 201bp site from the 5′ end of the sequence shown in SEQ ID NO:1 is CC, a corn variety with significant NCLB resistance is obtained.

Images