A method for identifying the original and counterfeit products of Chinese medicinal material Bamboo Ru based on DNA barcode

Abstract

The present invention belongs to the technical field of identification of origin species of traditional Chinese medicine, and specifically relates to a method for identifying the origin of traditional Chinese medicine bamboo shavings and its counterfeits based on DNA barcodes. The method provided by the present invention for identifying the origin of traditional Chinese medicine bamboo shavings and its counterfeits based on DNA barcodes, the traditional Chinese medicine bamboo shavings origin and its counterfeits include: light bamboo, big head bamboo, green skin bamboo and moso bamboo; the method includes the following steps: S1, extracting the sample DNA to be tested; S2, screening of universal and specific DNA barcode genes; S3, amplification of universal and DNA barcode gene fragments; S4, sequencing the amplified product; S5, obtaining the amplified DNA barcode sequence after sequence correction and splicing, and comparing it with the NCBI database online BLAST to determine the origin of the sample to be tested. The method provided by the present invention ensures that the source of bamboo shavings is accurate and reliable, avoids confusion with counterfeits, and improves the safety and effectiveness of the use of bamboo shavings medicinal materials and their products.

Description

Technical Field

[0001] The invention belongs to the technical field of identification of traditional Chinese medicine origin species, and particularly relates to a method for identifying the origin of traditional Chinese medicine bamboo rutaecarpa and its counterfeits based on DNA barcodes. Background Art

[0002] Bamboo shavings are derived from the middle layer of the dried stems of plants in the Poaceae family, including green bamboo (Bambusa tuldoidesMunro), big-headed bamboo (Sinocalamus beecheyanus (Munro) McClure var. Pubescens PFLi) or pale bamboo (Phyllostachys nigra (Lodd.) Munro var. henonis (Mitf.) Stapf ex Rendle). In the medical practice of the past dynasties, pale bamboos were regarded as the best materials for making bamboo shavings and bamboo juice. As a country rich in bamboo resources, China's morphological identification of plants in the subfamily Bambusoideae is quite challenging and easy to confuse. Market surveys reveal that bamboo shavings sold on the market are often mixed with varieties that do not meet the regulations, among which the widely distributed moso bamboo is the most common counterfeit, and its medicinal efficacy and safety have not yet been clarified. In addition, bamboo and bamboo are also used as necessities in some areas, and related plants such as pink bamboo, small-leaved dragon bamboo, and laminaria are often confused with the authentic original plants of bamboo shavings.

[0003] Accurate identification of Chinese herbal medicines is the premise and guarantee for studying their quality, ensuring safe use of medicines and clinical efficacy. DNA detection technology has gradually become the preferred technology for species identification. Among the existing DNA detection technologies, the DNA barcoding technology proposed by Hebert et al. is one of the most widely used methods. DNA barcodes refer to relatively short DNA fragments in organisms that can represent the species, are standard, have sufficient variation, are easy to amplify, and are relatively short. Although DNA barcoding technology provides an auxiliary means for bamboo identification, due to the widespread existence of gene introgression, incomplete lineage sorting, and adaptive radiation in the process of plant evolution, not all DNA barcodes can accurately identify Chinese herbal medicines with similar genetic relationships. Common universal primers such as ITS, matK, and rbcL cannot accurately identify the authentic origin of bamboo shavings. Therefore, finding a more specific, sensitive, and applicable DNA barcode primer for a wide range of Chinese herbal medicines is of great significance for improving the accuracy and efficiency of bamboo shavings identification.

[0004] The chloroplast genome sequence is relatively conservative, with a stable genome structure, gene content and order, and a low mutation rate. However, the mutation of the chloroplast genome is not random, but concentrated in the "hotspot" area, forming a hypervariable region-polymorphic region. Therefore, the development of specific DNA barcodes based on the hypervariable regions of the chloroplast genome to achieve a single and accurate identification of bamboo shavings and their confused products is of great significance for ensuring the accuracy and reliability of the source of bamboo shavings, avoiding confusion with counterfeits, and improving the safety and effectiveness of the use of bamboo shavings and their products. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention aims to provide a method for identifying the origin of the Chinese medicinal material bamboo and its counterfeits based on DNA barcodes. By collecting bamboo samples with accurate origins and designing DNA barcodes, a molecular identification method is established that can distinguish the authentic origins of pale bamboo, large-headed bamboo, and the common counterfeits of moso bamboo and green-skinned bamboo.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] The first object of the present invention is to provide a method for identifying the original Chinese medicinal material bamboo and its counterfeit products based on DNA barcodes, characterized in that the original Chinese medicinal material bamboo and its counterfeit products include: Phyllostachys nigravar.henonis, Bambusa beecheyana var.Pubescens, Bambusa textilis and Phyllostachys edulis;

[0008] The method comprises the following steps:

[0009] S1, extracting the sample DNA to be tested;

[0010] S2. Screening of universal and specific DNA barcode genes: Through preliminary experimental screening, ITS2, Pnh, Bbp-Bt, Bbp1, Bbp2, Bbp3, Bbp4, Bbp5, Bbp6, Bbp7, Bbp8, Bt1, Bt2, Bt3, Bt4, Bt5 and Bt6 were finally determined as target barcode genes;

[0011] S3. Amplification of universal and specific DNA barcode gene fragments: using primers to perform PCR amplification on the DNA extracted in step S1 to obtain amplified products; wherein:

[0012] The primer pairs based on the ITS2 gene are: the sequence information of ITS2-F is shown in SEQ ID NO.1; the sequence information of ITS2-R is shown in SEQ ID NO.2;

[0013] The primer pairs based on the Pnh gene are: the sequence information of Pnh-F is shown in SEQ ID NO.3; the sequence information of Pnh-R is shown in SEQ ID NO.4;

[0014] The primer pairs based on the Bbp-Bt gene are: the sequence information of Bbp-Bt-F is shown in SEQ ID NO.5; the sequence information of Bbp-Bt-R is shown in SEQ ID NO.6;

[0015] The primer pairs based on the Bbp1 gene are: the sequence information of Bbp1-F is shown in SEQ ID NO.7; the sequence information of Bbp1-R is shown in SEQ ID NO.8;

[0016] The primer pairs based on the Bbp2 gene are: the sequence information of Bbp2-F is shown in SEQ ID NO.9; the sequence information of Bbp2-R is shown in SEQ ID NO.10;

[0017] The primer pairs based on the Bbp3 gene are: the sequence information of Bbp3-F is shown in SEQ ID NO.11; the sequence information of Bbp3-R is shown in SEQ ID NO.12;

[0018] The primer pairs based on the Bbp4 gene are: the sequence information of Bbp4-F is shown in SEQ ID NO.13; the sequence information of Bbp4-R is shown in SEQ ID NO.14;

[0019] The primer pairs based on the Bbp5 gene are: the sequence information of Bbp5-F is shown in SEQ ID NO.15; the sequence information of Bbp5-R is shown in SEQ ID NO.16;

[0020] The primer pairs based on the Bbp6 gene are: the sequence information of Bbp6-F is shown in SEQ ID NO.17; the sequence information of Bbp6-R is shown in SEQ ID NO.18;

[0021] The primer pairs based on the Bbp7 gene are: the sequence information of Bbp7-F is shown in SEQ ID NO.19; the sequence information of Bbp7-R is shown in SEQ ID NO.20;

[0022] The primer pairs based on the Bbp8 gene are: the sequence information of Bbp8-F is shown in SEQ ID NO.21; the sequence information of Bbp8-R is shown in SEQ ID NO.22;

[0023] The primer pairs based on the Bt1 gene are: the sequence information of Bt1-F is shown in SEQ ID NO.23; the sequence information of Bt1-R is shown in SEQ ID NO.24;

[0024] The primer pairs based on the Bt2 gene are: the sequence information of Bt2-F is shown in SEQ ID NO.25; the sequence information of Bt2-R is shown in SEQ ID NO.26;

[0025] The primer pairs based on the Bt3 gene are: the sequence information of Bt3-F is shown in SEQ ID NO.27; the sequence information of Bt3-R is shown in SEQ ID NO.28;

[0026] The primer pairs based on the Bt4 gene are: the sequence information of Bt4-F is shown in SEQ ID NO.29; the sequence information of Bt4-R is shown in SEQ ID NO.30;

[0027] The primer pairs based on the Bt5 gene are: the sequence information of Bt5-F is shown in SEQ ID NO.31; the sequence information of Bt5-R is shown in SEQ ID NO.32;

[0028] The primer pairs based on the Bt6 gene are: the sequence information of Bt6-F is shown in SEQ ID NO.33; the sequence information of Bt6-R is shown in SEQ ID NO.34;

[0029] S4, sequencing the amplified product;

[0030] S5. After sequence correction and splicing, the amplified DNA barcode sequence is obtained, and the amplified DNA barcode sequence is compared with the NCBI database online BLAST to determine the origin of the sample to be detected; wherein the specific DNA barcode amplified sequence information is:

[0031] A DNA barcode for detecting Phyllostachys nigra var.henonis, the nucleotide sequence of which is shown in SEQ ID NO.35;

[0032] A DNA barcode for detecting Bambusa beecheyana var. Pubescens, the nucleotide sequence of which is shown in SEQ ID NO.36 and SEQ ID NO.38-45;

[0033] The DNA barcode used for detecting Bambusa textilis has a nucleotide sequence as shown in SEQ ID NO.37 and SEQ ID NO.46-51.

[0034] Preferably, the amplification of the DNA barcode gene fragment in step S3 has a reaction system of 30 μL, including 15 μL of 2×Phanta Flaash Master Mix (Dye Plus), 2 μL of primers (F, R), 60-150 ng of DNA template content, and ddH2O supplemented to 30 μL.

[0035] Preferably, the amplification procedure of the DNA barcode gene fragment in step S3 is: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 s, annealing at 50°C for 5 s, extension at 72°C for 5 s, 33 cycles; extension at 72°C for 1 min.

[0036] Preferably, the sequence alignment in step S5 includes performing sequence alignment by Geneious series software or BLAST analysis.

[0037] Preferably, the correction in step S5 includes correction by error prevention through BLAST analysis.

[0038] Preferably, the method further comprises verifying the accuracy and adaptability of each rhizome-specific DNA barcode.

[0039] The second object of the present invention is to provide the application of the above-mentioned method for identifying the original Chinese medicinal material Bamboo Rhizome and its counterfeits based on DNA barcode in the identification of Chinese medicinal materials.

[0040] Compared with the prior art, the present invention has the following beneficial effects:

[0041] Firstly, the present invention develops a method for identifying the origin of the Chinese medicinal material bamboo rudder and its counterfeits based on DNA barcodes at the molecular level. Compared with traditional morphological identification, this technology is fast and has higher accuracy. Secondly, 17 different target barcode genes are identified: ITS2, Pnh, Bbp-Bt, Bbp1, Bbp2, Bbp3, Bbp4, Bbp5, Bbp6, Bbp7, Bbp8, Bt1, Bt2, Bt3, Bt4, Bt5, Bt6. The combination of these 17 is much better than the conventional DNA barcode method in terms of the number of barcodes, reliability and accuracy. Thirdly, the standard classification barcode sequence is determined, which can quickly, effectively and in large quantities identify the origin of the Chinese medicinal material bamboo rudder and its counterfeits, which is conducive to the rapid and accurate classification, storage and preservation of the Chinese medicinal material bamboo rudder resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 It is a representative diagram for screening specific fragments or sites of each base; among them, the box base C is the specific site amplified by the Bbp1 primer;

[0043] Figure 2 Electrophoresis of samples amplified by ITS2 primers

[0044] Figure 3 NCBI online Blast comparison results of the original samples of Paeonia lactiflora;

[0045] Figure 4 This is the NCBI online Blast comparison result of the original sample of the Bamboo shoots;

[0046] Figure 5 This is the NCBI online Blast comparison result of the original samples of green bamboo base;

[0047] Figure 6 This is the NCBI online Blast comparison result of the original bamboo samples. DETAILED DESCRIPTION

[0048] The experimental methods in the following examples of the present invention, where no specific conditions are specified, are usually carried out under conventional conditions or under conditions recommended by the manufacturers. The various commonly used chemical reagents used in the examples are all commercially available products.

[0049] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0050] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that these descriptions are exemplary only and are not intended to limit the scope of the present invention. In addition, in the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concept of the present invention.

[0051] The present invention is further described in the following examples, but the examples are not intended to limit the scope of protection of the present invention.

[0052] 1. Instrument

[0053] T100 TMThermal Cyclers PCR instrument (Bio-Rad, USA); H1650-W desktop centrifuge (Hunan Xiangyi Laboratory Instrument Development Co., Ltd.); QL-901 vortex oscillator (Haimen Qilin Bell Instrument Manufacturing Co., Ltd.); SW-CJ-2FD clean bench (Suzhou Antai Air Technology Co., Ltd.); Thermo Nano Drop 2000C ultra-micro volume UV spectrophotometer (Thermo Fisher Scientific, USA); DYY-6C electrophoresis power supply (Beijing Liuyi Biotechnology Co., Ltd.); 80230ES01HET high-throughput horizontal electrophoresis tank (Shanghai Yisheng Biotechnology Co., Ltd.); GelDoc-Go gel imager (Bio-Rad, USA); DK-8D electric constant temperature water bath (Shanghai Yiheng Technology Co., Ltd.).

[0054] 2. Reagents

[0055] DN14 plant genomic DNA rapid extraction kit (Beijing Aidelai Biotechnology Co., Ltd.); 50×TAE buffer (Beijing Solebold Technology Co., Ltd.); MD101-02DL 2000Plus Marker (Nanjing Novozymes Biotechnology Co., Ltd.); GR501-01 nucleic acid dye (Nanjing Novozymes Biotechnology Co., Ltd.); agarose (Biowest Agarose); enzyme-free water; anhydrous ethanol (Guangzhou Guanghua Technology Co., Ltd.); isopropanol (Guangzhou Chemical Reagent Factory); β-mercaptoethanol (Shanghai MacLean Biochemical Technology Co., Ltd.); chloroform (Guangzhou Chemical Reagent Factory); P520-012×PhantaFlash Master Mix (Dye Plus) (Nanjing Novozymes Biotechnology Co., Ltd.).

[0056] 3. Design principle of the present invention:

[0057] The traditional Chinese medicine bamboo shavings are made by scraping the middle layer of the stem from a specific variety of bamboo and drying it. There are many varieties of bamboo in China, but the Chinese Pharmacopoeia stipulates that the authentic bamboo shavings come from three origins - Bambusa tuldoides Munro, Sinocalamus beecheyanus (Munro) McClure var. Pubescens PFLi or Phyllostachys nigra (Lodd.) Munro var. henonis (Mitf.) Stapf ex Rendle. The appearance of bamboo shavings of each variety is similar, and there is no legal method for identifying the origin. Through origin surveys and experimental studies, it was found that the use of illegal origin bamboos to process bamboo shavings is quite common, and its safety and effectiveness cannot be guaranteed.

[0058] DNA barcode molecular identification is a molecular biology technique that uses a relatively short, recognized DNA sequence in the genome to identify species. It is an effective supplement to traditional morphological identification methods. Since the DNA sequences of different species are composed of four bases, adenine (A), guanine (G), cytosine (C), and thymine (T), arranged in different orders, different species can be distinguished by analyzing a specific DNA fragment sequence.

[0059] The present invention intends to establish a molecular identification method for authentic bamboo shavings and their common counterfeits through molecular identification technology. By collecting bamboo samples with accurate origins and designing DNA barcodes, a molecular identification method is established that can distinguish between the authentic origins of large-headed classical bamboo and light bamboo and the common counterfeits of moso bamboo and green-skinned bamboo, so as to accurately identify the origins of commercially available bamboo shavings samples. The use of this method can ensure the accuracy and reliability of the source of bamboo shavings, avoid confusion with counterfeits, and improve the safety and effectiveness of the use of bamboo shavings medicinal materials and their products.

[0060] Example 1 Method for identifying the origin of Chinese medicinal material Bamboo Rhizome and its counterfeit products based on DNA barcodes

[0061] The method of the present invention for identifying the original Chinese medicinal material bamboo rutaecarpa and its counterfeits based on DNA barcodes comprises the following steps:

[0062] 1. Sample collection

[0063] By consulting literature and collection specimen information, the present invention went to Ji'an, Jiangxi, Foshan, Huizhou, Zhaoqing, Guangdong and South China National Botanical Garden to collect fresh samples of different bamboo plants with accurate origins, involving a total of 12 samples from 5 regions. The sample information is shown in Table 1 below.

[0064] Table 1 Sample collection information

[0065] Serial number Sample No. Plant-based Plant Latin name 1 Z1 Light bamboo Phyllostachys nigra var.henonis 2 Z2 Light bamboo P. nigra var. henonis 3 Z3 Light bamboo P. nigra var. henonis 4 Z4 Light bamboo P. nigra var. henonis 5 Z5 Light bamboo P. nigra var. henonis 6 Z6 bamboo P.edulis 7 Z7 bamboo P.edulis 8 Z8 Bamboo Bambusa beecheyana var.Pubescens 9 Z9 Bamboo B. beecheyana var. Pubescens 10 Z10 Bamboo B. beecheyana var. Pubescens 11 Z11 Green bamboo B.textilis 12 Z12 Green bamboo B.textilis

[0066] 2. Extract DNA from each sample according to the following method

[0067] The CTAB plant genomic DNA rapid extraction kit was used to extract the DNA of the test materials, and the extracted DNA samples were stored at -20°C. The specific steps are as follows:

[0068] (1) Take about 100 mg of fresh plant tissue or about 30 mg of dry weight tissue, add 4-6 small steel balls, and grind with an automatic sample grinder.

[0069] (2) Quickly transfer the ground powder into a centrifuge tube pre-filled with 600 μl of 65°C preheated lysis solution PL (before the experiment, add mercaptoethanol to the preheated PL to make the final concentration 2%), quickly invert and mix, and place the centrifuge tube in a 65°C water bath for 20-30 min. Invert the centrifuge tube several times to mix the sample during the water bath.

[0070] (3) Add 700 μl of chloroform, mix thoroughly, and centrifuge at 13,000 rpm for 5 min.

[0071] (4) Carefully pipette the supernatant (about 600 μl) into a new 1.5 mL centrifuge tube (be careful not to aspirate the interface material), add 1.5 times the volume of binding solution PQ (please check whether anhydrous ethanol has been added before use!), and immediately vortex to mix thoroughly.

[0072] (5) Transfer the mixed liquid into the adsorption column AC, centrifuge at 13000rpm for 30sec, and discard the waste liquid. (The volume of the adsorption column is about 700μl, and it can be added to the centrifuge in batches.)

[0073] (6) Add 500 μl of inhibitor removal solution IR, centrifuge at 13,000 rpm for 30 seconds, and discard the waste liquid.

[0074] (7) Add 600 μl of WB (please check whether anhydrous ethanol has been added before use!), centrifuge at 13000 rpm for 30 seconds, and discard the waste liquid.

[0075] (8) Repeat step 7.

[0076] (9) Place the adsorption column AC back into the empty collection tube and centrifuge at 13,000 rpm for 2 min to remove as much of the rinse solution as possible to prevent residual ethanol in the rinse solution from inhibiting downstream reactions.

[0077] (10) Take out the adsorption column AC and place it in a clean centrifuge tube. Add 50-100 μl of elution buffer EB to the middle part of the adsorption membrane, leave it at room temperature for 3-5 min, and centrifuge it at 13,000 rpm for 1 min. Add the resulting solution back to the centrifugal adsorption column, leave it at room temperature for 2 min, and centrifuge it at 13,000 rpm for 1 min.

[0078] 3. Screening of DNA barcode genes

[0079] (1) Screening of universal DNA barcode genes

[0080] In order to improve the efficiency and accuracy of identification, the present invention identifies bamboo shavings and its counterfeits by screening universal primers, so as to effectively distinguish bamboo shavings from confused varieties or counterfeits, and realize rapid and accurate identification of the authenticity of Chinese herbal medicines. The present invention selects a variety of universal primers such as ITS, ITS2, psbA-trnH, matK and rbcL to identify bamboo shavings and its counterfeits.

[0081] After the samples were amplified and sequenced with universal primers, the NCBI online BLAST comparative analysis showed that the ITS2 sequence was highly accurate in identifying Phyllostachys edulis and was able to make preliminary identifications of other related species at the genus level. In contrast, the other primers tested performed poorly in accurately identifying Phyllostachys edulis and its fakes.

[0082] The sequence information of the ITS2 primer pair is shown in the following SEQ ID NO.1-2.

[0083] Table 2 Sequence information of ITS2 primer pairs

[0084]

[0085] (2) Screening of specific DNA barcode genes

[0086] With the development of high-throughput sequencing technology, chloroplast genome sequence data has become an important tool for plant species identification and phylogenetic research. Chloroplast genome, due to its maternal inheritance characteristics, high mutation rate and rich genetic information, provides a powerful molecular marker for the fine distinction of species. Compared with traditional methods, the amount of information that can be used for species differentiation is significantly increased, thereby improving the accuracy and reliability of species identification. In the present invention, the length of each base chloroplast genome sequence is about 140000bp. The sequence of each base (A, T, C, G) is analyzed by multiple sequence alignment, and the variation region or site is searched one by one, and many species-specific variation regions or sites are identified. These variation regions or sites show a high degree of resolution in the distinction between species bases; at the same time, the sequence containing the variation region or site is verified by online BLAST on NCBI, and it is confirmed again whether it can 100% single identification of the corresponding base species. For these variation regions or sites, according to the primer design principle, the best amplification primer is designed and screened. The present invention preliminarily screened out many variable regions or sites. Some variable region sequences were too long and difficult to identify. The forward and reverse primer sequence lengths and Tm values ​​differed greatly, resulting in unsatisfactory primer design or the inability to identify the corresponding species after sequencing, etc., and thus could not be used for species origin identification. Finally, 17 variable regions or sites were screened out, which can be used for the identification of various origins of Bamboo Ru. The details are as follows:

[0087] The present invention downloaded the sequences of Phyllostachys nigra var.henonis, Bambusa beecheyana var.Pubescens, Bambusa tuldoides and Bambusa textilis, which have completed chloroplast genome sequencing, from NCBI (see website: https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) as reference sequences, used the Clustal W function of Bioedit software to perform multiple sequence alignment on the above sequences, manually searched, analyzed the differences in gene sequences of the three legal original species of Bamboo Russ and the illegal original species of Bambusa textilis, and searched for their specific regions or sites, such as Figure 1 As shown, primers were designed for the specific fragments or sites using Primer Premier 5 software, and the expected amplified sequences of the primers were amplified by online BLAST at NCBI to screen out the target sequences that could single-handedly and accurately identify (100% similarity) each bamboo root.

[0088] The results showed that there were no specific sites in the whole genome of chloroplasts of green bamboo. Finally, 17 specific fragments or sites were screened out, including 1 in pale bamboo, 9 in large-headed bamboo, and 7 in green bamboo. Corresponding primers were designed, among which Bbp-Bt primers can simultaneously identify large-headed bamboo and green bamboo. The specific experimental results are shown in Table 3 below.

[0089] Table 3 Sequence information of specific DNA barcode genes

[0090]

[0091]

[0092] 4. PCR amplification and sequencing

[0093] The PCR reaction system is 30 μL, including:

[0094] Table 4

[0095]

[0096]

[0097] The amplification program was as follows: 98°C pre-denaturation for 2 min; 98°C denaturation for 10 s, 50°C annealing for 5 s, 72°C extension for 5 s, 33 cycles; 72°C extension for 1 min. The PCR product was detected by 1% agarose gel electrophoresis and sent to Beijing Liuhe BGI Technology Co., Ltd. Guangzhou Branch for sequencing, bidirectional sequencing. Representative gel electrophoresis images of the samples are shown in Figure 2 .

[0098] 5. Sequencing results

[0099] After sequence correction and splicing, the amplified DNA barcode sequence was obtained. The above PCR products were sent to the Guangzhou Branch of Beijing Liuhe BGI Gene Technology Co., Ltd. for sequencing. The sequencing peak graph was proofread and sequence splicing was performed using Geneious 9.0.2. After removing the low-quality sequence regions at both ends, splicing was performed to obtain the amplified sequence. The amplified sequence was compared with the online BLAST in the NCBI database, and the species corresponding to the reference sequence with a similarity of 100% was used as the identification result.

[0100] 6. DNA barcode verification

[0101] The ITS2 universal primer and the Pnh and Bbp-Bt primers in Table 3 were used to perform molecular identification on the bamboo samples with accurate origins. The sequencing results showed that all 12 batches of samples were consistent with the origins that had passed the trait identification. The experimental results are shown in Table 5 below.

[0102] Table 5 Molecular identification results of collected bamboo samples

[0103]

[0104]

[0105] Among them, the DNA barcode amplification sequence information is as follows:

[0106] (1) DNA barcode 1, identification origin: bamboo, primer: Pnh

[0107] TTCGATCTTTCTAAAGAACAGATTTAATATATAGAACATAGATAGAATACAAAATACAAATCAATTCATTTGATTTCAGGTAGATATTATTTCATATGTATAGAGGGTATTCATATACTATATATGAATCAAATAATAATATGAATCAAATAATATATGGACCAAAGAAAGACTACTTCTTCTGGATCCAAAATTAATAAAATAAAGAAATCCATTTTTTTTTTTCAAATTTTAAAATAAAGAATAAATCATGTATACATCTAAACAACCTTTTCATAAATCTAAGCAAACTTTTCATAAATCTAAGCAAACTTTTCATAAATCCAAGCAAACTTTTCGTAAATCCAAGCAAACTTTTCGTAAATCCAAACAACCTTTTCGTAGGCGTCCTCGGATTGGCCCGGGGGATCGAATTGATTATAGAAACATGAGTTTAATTAATCGATTTATTAGTGAACAAGGAAAAATATTATCGAGACGAATAAATAGATTAACCTTGAAACAACAACGATTAATTACTCTTGCTATAAAACAGGCTCGCATTTTATCTTTCTTACCATTTCGTAACTATGAGAATGAGAAGCAATTTCAAGCCCAGTCAATTTCAATAATTACTGGTCCTAGACCCAGAAAGAATAGACATAT(SEQ ID NO.35)

[0108] (2) DNA barcode 2, identification of origin: Sinocalamus beecheyanus var. pubescens, primer: Bbp - Bt

[0109] TTGGTAAATCAACTTTGATTCTCTATAGACCAATAATGTGAGACCATTAACACGGTTAAAGCTAAACTGCTTGAAGTCCAGGCAAAAAAAGGGGTACTCTTTCTACAACTATATTAGTATTAGTACCGAAATGCTTTAAACGGGAAATAGCTAATGTAGAATTTATCTGATATAGAACACTCATATCGATAAAATGGTTTAAACTATTTACTAGAAGGGCACCCTGCCCTTTTTTATCCAATGCCGAATCGACGACCTATGTATAAAATAAAAAAAAAAGAGAAATTTTTTGGATTTGAAGAAAAAAGAAAAAAAAAAAAGGAATTCTATCAATTTTCATTTTCCATTTATTTAGTTAGTTTTTCTTAATGAAATTGAAATTATTAACTAAAGGGCAAATACAAATAAAGAAACAACTTTGCTGACCATGATAGATTTTTATCTAGGCGGAAGAGTCCTCTTAATATTTATCTAGTCTTATATTCTTATATGGGTTTCGGTATATTGAAATATAAACAGAAAAGAGAAGATAGAGGATAGGCTCATTACATAAAAAAAAAGATATGGAAATAGCCATAGCAAAAAAAGAAAAAAAGGAGCGTGAGAGCCAAATGAATCGAAAGATTCATGTTTGGTTCGGGAAGAGATCATAAAAGTTGTAAACTTAATAGCAAGATAATCTACTTTCATTAAAAGATTT(SEQ ID NO.36)

[0110] (3) DNA barcode 3, identification of origin: Bambusa textilis McClure, primer: Bbp-Bt

[0111] CGACTCATTGGTAAATCAACTTTGATTCTCTATAGACCAATAATGTGAGACCATTAACACGGTTAAAGCTAAACTGCTTGAAGTCCAGGCAAAAAAAGGGGTACTCTTTCTACAACTATATTAGTATTAGTACCGAAATGCTTTAAACGGGAAATAGCTAATGTAGAATTTATCTGATATAGAACACTCATATCGATAAAATGGTTTAAACTATTTACTAGAAGGGCACCCTGCCCTTTTTTATCCAATGCCGAATCGACGACCTATGTATAAAATAAAAAAAAAGAGAAATTTTTTGGATTTGAAGAAAAAATAAAAAAAAAGGAATTCTATCAATTTTCATTTTCCATTTATTTAGTTAGTTTTTCTTAATGAAATTGAAATTATTAACTAAAGGGCAAATACAAATAAAGAAACAACTTTGCTGACCATGATAGATTTTTATCTAGGCGGAAGAGTCCTCTTAATATTTATCTAGTCTTATATTCTTATATGGGTTTCGGTATATTGAAATATAAACAGAAAAGAGAAGATAGAGGATAGGCTCATTACATAAAAAAAAAGATATGGAAATAGCCATAGCAAAAAAAGAAAAAAAGGAGCGTGAGAGCCAAATGAATCGAAAGATTCATGTTTGGTTCGGGAAGAGATCATAAAAGTTGTAAACTTAATAGCAAGATAATC(SEQ ID NO.37)

[0112] (4) DNA barcode 4, identifying the original plant: Sinocalamus beecheyanus var. pubescens, primer: Bbp1

[0113] TTTGTGTATTTGGCGGAATTTGGCATATCTTAACCAAACCCTTCGCATGGGCTCGCCGTGCATTTGTATGGTCTGGAGAAGCTTACTTGTCTTATAGTTTAGGCGCTTTATCTGTCTTTGGTTTTATCGCTTGTTGTTTTGTCTGGTTCAATAATACGGCTTATCCGAGTGAGTTTTATGGACCCACCGGGCCAGAAGCTTCTCAAGCTCAAGCATTTACTTTTCTAGTTAGAGACCAGCGTCTTGGAGCTAATGTGGGATCCGCCCAAGGACCCACAGGTTTGGGTAAATATCTAATGCGTTCCCCAACGGGAGAGGTTATTTTTGGAGGGGAAACTATGCGTTTTTGGGACCTTCGTGCTCCATGGTTAGAACCTCTAAGGGGCCCCAACGGTTTGGACTTGAGTAGGTTGAAAAAAGACATACAACCTTGGCAAGAACGACGTTCGGCAGAATATATGACCCATGCTCCTTTAGGCTCTTTAAATTCCGTGGGTGGCGTAGCTACCGAGATCA(SEQ IDNO.38)

[0114] (5) DNA barcode 5, identification of origin: Sinocalamus beecheyanus var. pubescens, primer: Bbp2

[0115] AAAAGTCAATAGCCTAAAGATAAAAAAGAAAAAGTCTACCATTTTTTTGACAGCAGCTCTTATTGCCCCTTTGGCCTTTTCTCTTATATTATTCAACAATTGAATCATATTTGTTTCCCTCCTCTAAACAATAGAATATAATATAACTTTCGTGCTTTGGTTTAGTGAGTCGTACGAGATCGTGTTTACATACCTATGAACTTACCCTCTTCAAATATATTGGATACTACTATACTCATAATTTTTTAGTGTGTCAACCCTCTCTTCACGTATTTTATTATACGTATTTTTTTATATAATAAAATAAAAAAAAAACCTCTACTTTGTGCAAGTGATAAGAGAGAATATGAAAGATTTTCTTATTTTTCTTGATTTTCTCAAGATTTTGAACCTTGCCATGAATAAACTTCTATATCTCGATCTCGATATATACATATATAATCTCTACATATATCTCTATATGTACATATATTATGTACATTATGCAGTAGACCCATAATGGGAAATCAAAGTGGCTAATTTTGGAATTGAATAAAAAGCCCTTTTAACTCAGTGGTAGAGTAATGCCATGGTAAGGCATAAGTCATCGGTTCAAATCCGATAAAGGGCTTTTTAATTTGGTGGTAGAGTAATGCCATGGTAAGACGTAAGTCATCGGTTCGAATCCGATAAAGTACTTTTCTACTAAATTTATTATTTATTCACCTTTTT(SEQ ID NO.39)

[0116] (6) DNA barcode 6, identification of origin: Bambusa beecheyana Munro var. pubescens, primer: Bbp3

[0117] CCTCGTAGTTTTAAATTCTCGAATCGAATCAATTAAGAATCAATTCAAATTAATAAAAGAATAAGTAAACGCTACCTCATCCCTATTGGTAGCCGATTGGGCCACTACCGACAAAACAAACCCTAATAGAACTATGGATTCTCAAAATCCAGTATCGCCAGGCCTAGTTATTCTCTTGCTCCAGCTTATGCGGGGTACGAATTTGTCGAGTTCGATCAGTACTATAAGCCTAAGTATTTTATTGATCAGGAAGCCTAAGTATTTTATTGATCAGGCGGCACCCAGATTTGAACTGGGGATAAAGGATTTGCAGTCCCCTGCCTTACCGCTTGGCCATGCCGCCAAAAAATCCGATCTAAAATCGAGAAAAGAGCAAGTATTCATCCACGTTTTCTTACTAAAACCCCCTTTCTTTTATCTTGAATCTAATTCTACTTACTTTTTTCCAATATTTTTCCAAAAATCTATTCCTGCTTTTTTTGGATCCAGTTTCGATTATTCTCCTCCATGGATTCTATCTTAAAACACACATTGCTAACACTAGAAAACTTCCCTTTTCTTTCTATTGAGATGAAAAAGGAGAAAAAGTGGATTTCCAGTCACAGGCTGCAAAATTCAGAACAAATTGGAACCATTAACTAGAATTCTCCTTTTTTTTGAATTGCAGTAGTGAACGACTCTTAAATCAGTATTCTCTCCCCCCCTTCCTTTTAA(SEQ ID NO.40)

[0118] (7) DNA barcode 7, identification of origin: Sinocalamus beecheyanus var. pubescens, primer: Bbp4

[0119] ACCTGTTGGTACCGGATTCCAAAAATTTGTGCATCGTTCCCCACAAGACAAGAACCTTTATTTCGAAATTCAAAAAAAAAATCTATTCGCGTCGGAAATGAGAGATATTTTGTTTCTCCATACAGAATTAGTTTCTTCTGATTCTGACGTAACAAACAATTTCTATGAGACATCAGAACCCCCATTTACCCCCAATTATACGATTTAAGGATACATAAAGCAGATTTTTTGACTTTAAACTAGACTTTTGACCTTAGAACACTAACAGGTCAGATTTTGGATTTTTATTTTAATAAGTAAAAGAAGTCAGTTAATTCATTAAGGTTACGTTTATACCATGTATCAATGGCCAATTCTCAGTGGAAGGTTACATCGGAACAATTATTATTTATTTCAAGCTATTTCGGCTCTTTCTTAATCTTCAAAAAGAAATAAATTCCGTAATTGAATGGTAGGATGAAAAAAAAAGAAAAAATCAAAAGGAAGTGTGGAAAAAATGACAAGAAGATATTGGAACATCAATTTGAAAGAGATGATAGAAGCGGGAGTTCATTTTGGTCATGGTATTAAGAAATGGA(SEQ ID NO.41)

[0120] (8)DNA barcode 8, identification origin: Sinocalamus beecheyanus var. pubescens, primer: Bbp5

[0121] TAACTTATCAACTCCCCGAACAGTACTATAGGAATCCGTACTGAACATTCCCCCTGTAATAGTACAGGCTCCCATAGCAATGACATATTTTGGTTCAGGCATTTGCTCGTATAATCTCACTAAAGAGGGAGCCATTTTCATTGTTACCGTACCGGCTGTTAAAATTAGGTCTGCTTGCCTAGGACTTGATCTTGGTACCAATCCATAACGATCAAAGTCGAATCGCGAGCCTATTAATGAAGCAAATTCAATGAAACAACAACTGGTACCATATAGAAGGGGCCATAAACTGGAGAGTCTTGACCAATTCGAAAGATCATTTGGTGTAGTTGAAATAACGGAATTGGAACTTGTTTGGTCAAGTAAGGGAAACTCAATCAAACTCATAACTGTCTCAATGGAATCTTTTCCTTCTTTTTTTTTTTTGTCTGAATATTCAGTTAAGACCATTCCAAGGCTCCTTTTCGCCATGCATAAACTGAACCAACAACTGGGATAAGCACGAAAATGAAAGCTTCAATAAAAACAGATACACCCAATACGTCGAAACTCATTGCCCAAGGGTAGAGAAAGACTGTT(SEQ ID NO.42)

[0122] (9) DNA barcode 9, identification origin: Sinocalamus beecheyanus var. pubescens, primer: Bbp6

[0123] CCTGACGCGCATCTTGCGTTTGTAGGGGTCCGAGAGTGGTTGAAGAAGTATTGCATGTGGAAGTAGGTAGACGAAACTTATTTAGGATTCGAAATGGGCGCATTCGACTAAAAGTCGTACTGAGACCTTTTTTAAAGGGTATTCTGAAAGAGGTATTTCATTTTCACAATCGCTTTCTTTTGAATCCAATTTCAAGTTCGATTAGAAGGATAGAAAGGCCGTGAGGACGGGAAAAGAAAAATCAAATCTTTTGAATTTTTATTTGAATTTTTAATTAGTTCTCTTTTTTTGCAATTTTCTTATTATCCATTCCATTCATTTTTTTTATAGAATACTTTAGTATTCTATAAAAAATCTTTATTTTGCAAACTAAAAAATACAATAGTCAATATTCCTTATAATAGATATACTTAATTATATTATAAGAATCTTAAGATATTTTTCGAATAGATAGAAATAGTAAA(SEQ ID NO.43)

[0124] (10) DNA barcode 10, identification origin: Sinocalamus beecheyanus var. pubescens, primer: Bbp7

[0125] AATTTCTATCAGAAAACTACTAGAATTTTTGCTTTATTTATTTACTAGTAAAACAAAACAAGAGTAAATCCGCATTACGCAAAAAAAAAAAAGAAATCCAAAATAGGGAAGAGAAAAGTCAAGAGGCCTCTAATGACCAACATAAGGCAAAGAAAGGAAGACAGATGAGCCAACTTGAGATTTTTTGGCATTATCATCATAAAGAATAAATTCTGGATTTTTCTTATTTCATATCTTCAAGGCAAATCGACCCAATCCAGTGGCTGATGAAGTTTTGAACCCTTTTTTTTCTAATATCCGTTGAAAATTTGTGTATTTCTGCTTGAGCCGTACGAGATGAAATTTTCATATACGGTTCTCGGAGGGGGACTCGGGTTAGTTACCTATCTCAATAAAGTATATGATTGGTTTGAGGAACGTCTTGAGATTCAGGCAATTGCGGATGATATAACTAGTAAATATGTTCCTCCTCATGTCAACATATTTTATTGTTTAGGGGGAATT(SEQ ID NO.44)

[0126] (11) DNA barcode 11, identification origin: Bambusa beecheyana Munro var. pubescens P. F. Li, primer: Bbp8

[0127] ATTCGAAATTTCCAATTTTGTAATGGGACCTTCTCCTTATGCTATTTGCAACTTTAGAACATATACTAACTCATATCTCTTTCTCAACTATTTCAATTGTGATTGCGATTCATTTGATAACCTTATTAGTTCGTGAACTTGGGGGATTACATGATTCGTCAGAAAAAGGAATGATAGCAACTTTTTTATCTATAACAGGATTCTTAGTTTCTCGTTGGGCTTCTTCGGGACATTTTCCATTAAGTAATTTATATGAGTCATTGATCTTCCTTTCATGGGCTCTGTATATTCTTCATACGATTCCTAAGATACAGAACTCTAAAAATGATTTAAGCACAATAACTACGCCAAGTACTATTTTAACGCAAGGCTTTGCCACGTCGGGTCTTTTAACTGAAATGCATCAATCCACAATACTAGTACCTGCTCTACAATCTCAGTGGTTAATGATGCATGTCAGTATGATGTTACTAAGCTATGCAACTCTTTTGTGCGGATCCTTATTATCCGCCGCTCTTCTAATCATTAAATTTCGAAAGAATTTCGATTTCTTTTCTAAAAAGAAAAAAAATGTTTTACTTAAAACATTTTTCTTTAGTGAGTTTAGTGAGATTGAATATTTCTATGCAAAAAGAAGTGCTTTAAAAAACACCTCTTTTCCTTCATTTTCAAATTATT(SEQ ID NO.45)

[0128] (12) DNA barcode 12, identification of origin: Bambusa textilis McClure, primer: Bt1

[0129] ATTTCTGACATCTTAGCCTCGTAGTTTAATTCTCGAATCGAATCAATTAAATTCAAATTAAAAAGAATAAGTAAACGCTACCTCATCTCTATTGGTAGCCGATT GGGCCACTACCGACAAAACAAACCCTAATAGAACTATGGATTCTCAAAATCCAGTATCGCCAGGCCTAGTTATTCTTGCTCCAGCTTATGCGGGGTACGAATTTGTCG(SEQ ID NO.46)

[0130] (13) DNA strand 13, strain: strain, strain: Bt2

[0131] TTGCTCTGATATAGAGTATGACCTGACCATCTTGGCCCACCCAAGTGAATTACGATAAAAGCAGGGATATGTGGAGAGGTGGATAACTAGATTGGCATGTACTTAAAAAGGACTTACTTTTTTAGGATTCTACAATGAAATCCTATATTCTAGCAATTCTACTACTAACAAACAAACAAGA ACTCTCAAAATTCTTTTTTGAATTAAACTAAGCGTGCTATTCTAAATCGAACTAAAGTCAAACTTTCTAGTGCTTATAATTATTATATTATGGCTTTATCCCATTCATAGAAAGGAGATAAAATGAGAAATCTTTGCCATCCAATCTGATTAGAATATCATTAAGTGGCAGAATTTTTTTCTA(SEQ ID NO.47)

[0132] (14)DNA 14,Bt3:Bt3:Bt3

[0133] TAGAGAGTCCATTTTATGAAATATCTGAGAAAGCAAAAGAAAAAAAAGAGAAACAGGTGGTTTATTTATCACCAAATAGAGATGAATATTATATGATAGCAGCAGGAAATTCTTTGTCTTTGAATCAGGGTATTCAGGAAGAACAGGTTGTTCCAGCTAGATACCGTCAAGAATTCCTGACTATTGCATGGGAACAGATTCATGTTAGAAGTATTTTTCCTTTCCAATATTTTTCTATTGGAGGTTCTCTCATTCCTTTTATTGAGCATAATGATGCGAATCGGGCTTTAATGAGTTCTAATATGCAGCGCCAAGCAGTTCCGCTTTCTCGGTCCGAGAAGTGCATTGTTGGAACTGGATTGGAACGCCAAACAGCTCTAGATTCGAGGGTTTCCGTTATAGCCGAACGCGAGGGAAAGATCATTTCTACTGATAGTCACAAGATCCTTTTATCAAGCAGTGGGAAGACTATAAGTATTCCTTTAGTTACCCATCGGCGCTCTAACAAAAATACTTGTATGCACCAAAAACCTCGGGTTCCATGGGGTAAATCCATTAAAAAAGGACAAATTTTAGCAGAGGGAGCTGCTACAGTTGGTGGGGAACTTGCTTTAGGAAAAAACGTATTAGTAGCTTATATGCCATGGGAAGGTTACAATTTTGAAGACGCAGTACTAATTAGCGAACGTTTGGTATA(SEQ ID NO.48)

[0134] (15) DNA barcode 15, identification of origin: Bambusa textilis McClure, primer: Bt4

[0135] CATCTAGAAGAACATTTACTCCGCAATTTGGACAGAAATGGAGTTGTTAGGTTGGGATCCTGGGTAGAAACTGGCGATATTTTAGTAGGTAAATTAACGCCTCAGATAGCGAGCGAATCGTCGTATATCGCGGAAGCTGGATTATTACGGGCCATATTTGGTCTTGAGGTATCCACTTCAAAAGAAACTTCTCTCAAACTACCTATAGGTGGAAGAGGGCGCGCTATCGATGTGAAATGGATCCAGAGAGACCCCCTAGACATAATGGTTCGTGTATATATTTTACAGAAACGTGAAATCAAAGTTGGGGATAAAGTAGCCGGAAGACACGGGAATAAGGGGATCATTTCCAAAATTTTGCCTAGGCAAGATATGCCCTATTTGCAAGATGGAACACCTGTTGATATGGTCTTCAATCCCTTAGGAGTACCCTCACGAATGAATGTGGGACAAATATTTGAAAGCTCGCTCGGATTAGCAGGGGATCTGCTAAAGAAACATTATAGAATAGCACCCTTTGATGAGAGATATGAGCAAGAGGCTTCAAGAAAACTTGTGTTTTCAGAATTATATGAAGCCAGTAAACAAACAAAAAATCCATGGGTATTTGAACCCGAGTACCCGGGAAAAAGTAGAATATTTGATGGAAGAACAGGAGACCCCTTCGAACAACCTGTTCTAATAGGGAAGTCCT(SEQ ID NO.49)

[0136] (16) DNA barcode 16, identification origin: Bambusa textilis McClure, primer: Bt5

[0137] ATAGTATAGGAAATCTGTAAAATGTCAGATCTTAATTATTAATCTTAGCTATTAACTAGTTCGAAATTTAAAGTTCTACTTAGAAAAAAATACTAGAACTTCATAAAAATCAAGTTAGCTTGATATGCTTAACTAGAGGATATCCTTAAATAGGATTATAGAATTTATTGAACTTTCTTTTTATTTCTCTAATTCGCAAATTGATTTTTCTAATAGAATAAAATCTATTCCAATTTCTATATTGAATTTGATTTCAGATATTTTCAATTTGATATGGCTCGGACAAGTAATCTAATACATAGAAAAGAATAATATATATGAAAGATATAATAAAGAGAAAATGTGAATTTCTTGGCATTTTCATTCGATCATTATAGACATTTTTTGAGATATTTTGTTTTTTTTTGTTATTTCTTAATAATTTAATGATTAATATTTCACTAAGGAGAACATAGAATCATAGCAAATTAAATTGCTAATTCTGATTAGAAAAAAAAAATGAATATCAAGCGTTAGAGTATGATTTTGAATACTCTAAAAAAGAAGGGTGGGGGAGAGAAAAACTTTGGGATATATTGATTCGGATTGAATTGCAAATACATCAACGATAGAATCAATTCAATTCTGAATTGCAACAAGCAGGGTCTCTCAAATAGAGACGAACTGCTAGACTACGTCGAGTAATGAATTCAACGATTCCAAAAAAAAAACTAAGAGATGGATGAAATTACACAAGGAATCTAGGTCTCAATCAAAGAAAAGGAAAA(SEQ ID NO.50)

[0138] (17) DNA barcode 17, identification origin: Bambusa textilis McClure, primer: Bt6

[0139] GAATTCCGCACTTGTAGCTTCAATAGGATTTCTTATAATTTGGATCTGCTATTTTGGTATCAATCTATTAGGAATAGGTTTACATAGTTATGGTTCATTTACATTACCATCTAAATGATTACATAACATAAAACCTTCATGAAATGAAAGTTTTTCCATTTTTGTTTGATTTGAGAACCCCTTGAACGCCTTCTCAAAGGGTTCTCAAAAATTCGAGATATATCTAATTAGACTTAGACTTTTTTACTTTTTTCTGAATTATTTGGTTTTTCCACTATGGAATATAGAGTATAGAGCGGACTAGTTAAAAAAAAAATCCTATTTAGGATAATAATTGGATAAGAGAGCCTCTACCTTGTCAACGGATAGCGAGAGAACAAAATCTGGATAAATACCAATTCCTATTACTGGTAAAAAGATACAGATTAAAAGAAAGAGTTCTCGCGGTCCAGAATCCACAAAATTTGCGTTTGGAACATGAAATAGCTTGTATCCATAGAACATCTGGCGTAACATAGATAATAAATAAATAGGAGTTAATATCATTCCAATTGCCATTACAAAAGTAATTAGCATTTTTGGCATTAACAGAAATTTGGGACTAGTAATTAGTCCAAAAAATACTACTAATTCTGCAACAAAACCGCTCATTCCTGGTAAGGCAAG(SEQ IDNO.51)

[0140] (18) DNA barcode 18, identification of origin: Phyllostachys edulis, primer: ITS2

[0141] ACGCTCCCCACCCCCTCGGCGGGGCGGAGGACGCGGTGTCTGGCCCCCCGCGCCGCACGGCGCGGCGGGCCGAAGTTCGGGCTGCCGGCGCAGCGCGCCGGGCACAGCACAAGGTGGGCGATCTCGCACTCTC TTACGTGCAGCGCCCCGGCGCGCAGCCGGCGCAGCGGCCCAGGGACCCATCGACCGGAGCGCACGTCGCTCGGACCGCGACCCCAGGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGA(SEQ ID NO.52)

[0142] In order to verify the accuracy and adaptability of the above ITS2 and the designed DNA barcodes specific to each rhizome, we selected a batch of large-headed bamboo and green-skinned bamboo, and verified the other specific DNA barcodes designed. The results showed that each DNA barcode can accurately identify its corresponding rhizome. This shows that ITS2 and the designed DNA barcodes specific to each rhizome can accurately identify bamboo samples of the four rhizomes. The BLAST results of each rhizome are shown in Figures 3 to 6 .

[0143] Example 2 Identification of Bamboo Shavings Medicinal Material Samples

[0144] The present invention identified the origin of 30 batches of commercially available bamboo shavings purchased offline or online. The identification was performed using the method described in Example 1 above. It was found that only one batch was genuine (big head bamboo), and the rest were counterfeit. Specifically, 19 batches were identified as moso bamboo, 8 batches as green skin bamboo, 1 batch as ci bamboo, and 1 batch as pink single bamboo, as shown in the following table:

[0145] Table 6 Identification results of commercially available bamboo shavings medicinal materials samples

[0146]

[0147]

[0148] It can be seen that the method of the present invention has a good application effect, can effectively identify the authenticity of bamboo shavings, and provides an experimental basis for the rationality and safety of clinical medication. At the same time, the method also provides a valuable reference for the research and development and quality evaluation of bamboo shavings-containing drugs.

[0149] The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Anyone familiar with the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by a person of ordinary skill in the art without departing from the spirit and technical concept disclosed by the present invention shall still be covered by the claims of the present invention.

Claims

1. A method for identifying the origin of Chinese medicinal material Bamboo Rhizome and its counterfeits based on DNA barcode, characterized in that: The Chinese medicinal material bamboo ruji and its counterfeit products include: Phyllostachys nigra var.henonis, Bambusabeecheyana var.Pubescens, Bambusa textilis and Phyllostachys edulis; The method comprises the following steps: S1, extracting the sample DNA to be tested; S2. Screening of universal and specific DNA barcode genes: Through preliminary experimental screening, ITS2, Pnh, Bbp-Bt, Bbp1, Bbp2, Bbp3, Bbp4, Bbp5, Bbp6, Bbp7, Bbp8, Bt1, Bt2, Bt3, Bt4, Bt5 and Bt6 were finally determined as target barcode genes; S3. Amplification of universal and specific DNA barcode gene fragments: using primers to perform PCR amplification on the DNA extracted in step S1 to obtain amplified products; wherein: The primer pairs based on the ITS2 gene are: the sequence information of ITS2-F is shown in SEQ ID NO.1; the sequence information of ITS2-R is shown in SEQ ID NO.2; The primer pairs based on the Pnh gene are: the sequence information of Pnh-F is shown in SEQ ID NO.3; the sequence information of Pnh-R is shown in SEQ ID NO.4; The primer pairs based on the Bbp-Bt gene are: the sequence information of Bbp-Bt-F is shown in SEQ ID NO.5; the sequence information of Bbp-Bt-R is shown in SEQ ID NO.6; The primer pairs based on the Bbp1 gene are: the sequence information of Bbp1-F is shown in SEQ ID NO.7; the sequence information of Bbp1-R is shown in SEQ ID NO.8; The primer pairs based on the Bbp2 gene are: the sequence information of Bbp2-F is shown in SEQ ID NO.9; the sequence information of Bbp2-R is shown in SEQ ID NO.10; The primer pairs based on the Bbp3 gene are: the sequence information of Bbp3-F is shown in SEQ ID NO.11; the sequence information of Bbp3-R is shown in SEQ ID NO.12; The primer pairs based on the Bbp4 gene are: the sequence information of Bbp4-F is shown in SEQ ID NO.13; the sequence information of Bbp4-R is shown in SEQ ID NO.14; The primer pairs based on the Bbp5 gene are: the sequence information of Bbp5-F is shown in SEQ ID NO.15; the sequence information of Bbp5-R is shown in SEQ ID NO.16; The primer pairs based on the Bbp6 gene are: the sequence information of Bbp6-F is shown in SEQ ID NO.17; the sequence information of Bbp6-R is shown in SEQ ID NO.18; The primer pairs based on the Bbp7 gene are: the sequence information of Bbp7-F is shown in SEQ ID NO.19; the sequence information of Bbp7-R is shown in SEQ ID NO.20; The primer pairs based on the Bbp8 gene are: the sequence information of Bbp8-F is shown in SEQ ID NO.21; the sequence information of Bbp8-R is shown in SEQ ID NO.22; The primer pairs based on the Bt1 gene are: the sequence information of Bt1-F is shown in SEQ ID NO.23; the sequence information of Bt1-R is shown in SEQ ID NO.24; The primer pairs based on the Bt2 gene are: the sequence information of Bt2-F is shown in SEQ ID NO.25; the sequence information of Bt2-R is shown in SEQ ID NO.26; The primer pairs based on the Bt3 gene are: the sequence information of Bt3-F is shown in SEQ ID NO.27; the sequence information of Bt3-R is shown in SEQ ID NO.28; The primer pairs based on the Bt4 gene are: the sequence information of Bt4-F is shown in SEQ ID NO.29; the sequence information of Bt4-R is shown in SEQ ID NO.30; The primer pairs based on the Bt5 gene are: the sequence information of Bt5-F is shown in SEQ ID NO.31; the sequence information of Bt5-R is shown in SEQ ID NO.32; The primer pairs based on the Bt6 gene are: the sequence information of Bt6-F is shown in SEQ ID NO.33; the sequence information of Bt6-R is shown in SEQ ID NO.34; S4, sequencing the amplified product; S5. After sequence correction and splicing, the amplified DNA barcode sequence is obtained, and the amplified DNA barcode sequence is compared with the NCBI database online BLAST to determine the origin of the sample to be detected; wherein the specific DNA barcode amplified sequence information is: A DNA barcode for detecting Phyllostachys nigra var.henonis, the nucleotide sequence of which is shown in SEQ ID NO.35; A DNA barcode for detecting Bambusa beecheyana var. Pubescens, the nucleotide sequence of which is shown in SEQ ID NO.36 and SEQ ID NO.38-45; The DNA barcode used for detecting Bambusa textilis has a nucleotide sequence as shown in SEQ ID NO.37 and SEQ ID NO.46-51.

2. The method according to claim 1, characterized in that The amplification of the DNA barcode gene fragment in step S3 has a reaction system of 30 μL, including 15 μL of 2×Phanta Flaash Master Mix (Dye Plus), 2 μL of primers (F, R), 60-150 ng of DNA template content, and ddH2O supplemented to 30 μL.

3. The method according to claim 1, characterized in that: The amplification procedure of the DNA barcode gene fragment in step S3 is as follows: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 s, annealing at 50°C for 5 s, extension at 72°C for 5 s, 33 cycles; and extension at 72°C for 1 min.

4. The method according to claim 1, characterized in that: The sequence alignment in step S5 includes sequence alignment by Geneious series software and BLAST analysis.

5. The method according to claim 1, characterized in that The correction in step S5 includes correction by error prevention through BLAST analysis.

6. The method according to claim 1, characterized in that The method also includes verifying the accuracy and suitability of each rhizome-specific DNA barcode.

7. Use of the method for identifying the origin of the Chinese medicinal material Bamboo Rhizome and its counterfeits based on DNA barcodes as claimed in any one of claims 1 to 6 in the identification of Chinese medicinal materials.

Images