SNP (Single Nucleotide Polymorphism) site for identifying resistance of corn southern leaf blight and application thereof

Abstract

The invention provides application of 14 SNP loci in resistance identification of corn southern leaf blight as well as a probe, a chip and a kit for detecting the 14 SNP loci. The 14 SNP loci can be used for identification of corn southern leaf blight resistance loci, genetic typing of corn inbred lines, authenticity identification of the corn inbred lines, diversity analysis of the corn inbred lines and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of crop molecular biology, and in particular relates to SNP sites for identifying resistance to corn leaf blight and applications thereof. Background Art

[0002] Corn leaf blight is an important leaf disease in corn production. In the early 1970s, due to the prevalence of the T subspecies of the pathogen, a major outbreak of corn leaf blight occurred in the United States, resulting in a corn yield reduction of more than 15%, a yield loss of more than 30 billion jin, and a direct result of the withdrawal of T-type cytoplasmic hybrids from corn production. In my country, due to the influence of varieties, climate, the large accumulation of pathogens and farming traditions, the occurrence of corn leaf blight has become more serious year by year. In 2021, the National Crop Variety Approval Committee placed special emphasis on resistance to corn leaf blight when revising the new corn variety approval standards. At present, due to the complexity of the pathogenic bacteria (subspecies) of corn leaf blight, the collection of disease-resistant resources for corn leaf blight and the cloning of disease-resistant genes have been slow, and the outbreak of the disease cannot be effectively prevented.

[0003] At present, molecular marker-assisted selection is mainly divided into three categories of markers: the first generation uses molecular hybridization as the core technology, and the commonly used ones are restriction endonuclease fragment length polymorphism markers (RFLP); the second generation uses PCR detection as the core technology, such as simple sequence repeats (SSR), amplified fragment length polymorphism (AFLP), and sequence tag sites (STS); the third generation combines restriction enzyme cutting with PCR technology, such as AFLP and CAPS. The fourth category is single nucleotide polymorphism site (SNP) markers. Compared with SNP markers, the first generation of marker detection is cumbersome to operate, has a long detection cycle, and is costly, and is not suitable for high-throughput sample detection; the second generation of marker detection is based on PCR amplification, has poor repeatability, and is not suitable for high-throughput molecular breeding detection; the third generation of marker detection combines the advantages of the first and second generations, but is relatively expensive and cannot be applied to molecular marker detection of the whole genome. Liquid chips made of large-scale dense oligonucleotide probe arrays can detect a large number of SNP sites at the same time, usually covering thousands of SNPs, and have obvious advantages in large-scale genotyping and association analysis. Using probes to enrich target fragments can significantly improve the sensitivity and specificity of detection. Compared with traditional solid-state chips, they have lower prices and higher throughput, and have obvious advantages in targeting, flexibility and cost-effectiveness.

[0004] Disease resistance chips, also known as SNP chips, use silicon, filter membranes, etc. as carrier substrates, and use micro-processing technologies such as printing and inkjet to fix dense oligonucleotide probe arrays. The principle of nucleic acid hybridization is used to make it react with the target genome to base pair, and the genotype of each SNP site is determined according to the intensity of the hybridization signal. The chips currently developed mainly include solid-phase chips and liquid-phase chips. Compared with solid-phase chips, liquid-phase chips use the principle of base complementary pairing to design specific probes for the target region gene sequence to achieve targeted capture of target genes or sites, and use sequencing platforms to perform high-throughput second-generation sequencing on the captured fragments, thereby achieving accurate identification of the genotype of the target region or site. Liquid-phase chips have shown significant advantages in terms of throughput, sensitivity, ease of operation, degree of automation, sample usage, specificity and accuracy. The SNP chips currently developed are mainly used for drought resistance, herbicide resistance, hybrid vigor and transgenic detection, and there is still a lack of corn leaf spot resistance detection chips. The developed chips are mainly used in molecular breeding, whole-genome association analysis of genotypes and phenotypes, genetic map construction, crop resource identification, etc.

[0005] Therefore, there is an urgent need in the art for a SNP liquid phase chip for identifying resistance to corn leaf blight. Summary of the invention

[0006] The purpose of the present invention is to provide SNP sites for identifying resistance to corn leaf blight and their application, and to provide identification tools for screening corn leaf blight-resistant resources, genetic improvement of susceptible inbred lines, identification of inbred line disease resistance genes, and genome-wide genetic analysis of corn leaf blight. Thus, the present invention is completed.

[0007] In a first aspect, the present invention provides the application of 14 SNP sites in the identification of resistance to corn leaf blight, wherein the SNP sites include:

[0008] (1) SNP site 155842030 on chromosome 9 with polymorphism of G / A;

[0009] (2) SNP site 16877754 on chromosome 3 with polymorphism A / G;

[0010] (3) SNP site 16905944 on chromosome 3 with polymorphism of T / C;

[0011] (4) SNP site 16678723 on chromosome 3 with polymorphism A / G;

[0012] (5) SNP site 154229449 on chromosome 9 with polymorphism of C / T;

[0013] (6) SNP site 158233558 on chromosome 9 with polymorphism of G / A;

[0014] (7) SNP site 157181668 on chromosome 9 with polymorphism C / A;

[0015] (8) SNP site at position 155511186 on chromosome 9, with polymorphism of A / G;

[0016] (9) SNP site 153517876 on chromosome 9, with polymorphism A / C;

[0017] (10) SNP site 153901636 on chromosome 9, with polymorphism of C / T;

[0018] (11) SNP site 18063115 on chromosome 9 with polymorphism of T / C;

[0019] (12) SNP site 16877094 on chromosome 3, with polymorphism of A / T;

[0020] (13) SNP site 33281840 on chromosome 3, with polymorphism of C / T;

[0021] (14) SNP site at position 33539944 on chromosome 3, with polymorphism of G / A.

[0022] In a second aspect, the present invention provides a probe for identifying resistance to corn leaf blight, the probe comprising one or more of the probes shown in SEQ ID NOs: 1-14, and SEQ ID NOs: 1-14 are used to detect the 14 SNP sites described in the first aspect.

[0023] In a third aspect, the present invention provides a chip for identifying resistance to corn leaf blight, wherein the chip comprises the probe described in the second aspect.

[0024] In a fourth aspect, the present invention provides a kit for identifying resistance to corn leaf blight, the kit comprising the probe described in the second aspect or the chip described in the third aspect.

[0025] In a fifth aspect, the present invention provides a method for identifying resistance to corn leaf blight, wherein the method uses the probe described in the second aspect, or the chip described in the third aspect, or the kit described in the fourth aspect to detect the 14 SNP sites described in the first aspect.

[0026] The beneficial effects of the present invention are as follows: the 14 SNP sites of the present invention can be used for the identification of corn leaf blight resistance sites, corn inbred line genotyping, corn inbred line authenticity identification, corn inbred line diversity analysis, etc.; the chip of the present invention has high sensitivity and specificity, low price cost and high throughput. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the specific implementation manner of the present invention, the drawings in the specific implementation manner are briefly introduced below.

[0028] Figure 1 The correlation analysis of the southern leaf blight phenotypes of 505 maize inbred lines under different environments is shown.

[0029] Figure 2 Shown is the analysis of resistance loci to corn leaf blight under different environments.

[0030] Figure 3 The graph shows the results of linkage analysis of the small leaf spot resistance locus using a RIL population composed of CML454 (resistant) × GEMS41 (susceptible) (chromosome 3).

[0031] Figure 4 The results of analyzing the resistance loci for small leaf spot disease in the F2 population of the CML496 (resistant) × GEMS41 (susceptible) combination using extreme pooling analysis technology are shown.

[0032] Figure 5 The distribution of 6600 SNPs on the genome is shown.

[0033] Figure 6 The process of liquid phase probe capture using a chip is shown. DETAILED DESCRIPTION

[0034] Hereinafter, the present invention will be described in detail. It should be understood that the following description is only used to illustrate the present invention by way of example, and is not intended to limit the scope of the present invention. The scope of protection of the present invention shall be subject to the attached claims. In addition, those skilled in the art will understand that the technical solution of the present invention may be modified without departing from the spirit and purpose of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter described herein belongs. Before describing the present invention in detail, the following definitions are provided for a better understanding of the present invention.

[0036] As used herein, the terms "single nucleotide polymorphism", "SNP (single nucleotide polymorphism)", "SNP marker", "SNP site" refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level. The variation may occur in the coding region of a gene, in a noncoding region (e.g., a promoter region or its vicinity, or an intron), or in an intergenic region.

[0037] As used herein, the term "probe" refers to a molecule that can bind to a specific sequence or subsequence or other portion of another molecule. Unless otherwise indicated, the term "probe" generally refers to a polynucleotide probe that can bind to another polynucleotide (often referred to as a "target polynucleotide") through complementary base pairing. Depending on the stringency of the hybridization conditions, the probe can bind to a target polynucleotide that lacks complete sequence complementarity with the probe. The probe can be labeled directly or indirectly, including primers. Hybridization methods include, but are not limited to: solution phase, solid phase, mixed phase or in situ hybridization assays.

[0038] In this article, the term "corn leaf spot" is also called corn spot disease and corn southern leaf blight. It is a disease of corn caused by Helminthosporium. It mainly harms leaves, but leaf sheaths, bracts and ears can also be affected. It can occur throughout the growth period of corn, but the disease is most serious during the tasseling and grain filling stages.

[0039] As mentioned above, the present invention aims to provide SNP sites for identifying resistance to corn leaf blight and applications thereof.

[0040] Therefore, in the first aspect, the present invention provides the application of 14 SNP sites in the identification of resistance to corn leaf blight, wherein the SNP sites include:

[0041] (1) SNP site 155842030 on chromosome 9 with polymorphism of G / A;

[0042] (2) SNP site 16877754 on chromosome 3 with polymorphism A / G;

[0043] (3) SNP site 16905944 on chromosome 3 with polymorphism of T / C;

[0044] (4) SNP site 16678723 on chromosome 3 with polymorphism A / G;

[0045] (5) SNP site 154229449 on chromosome 9 with polymorphism of C / T;

[0046] (6) SNP site 158233558 on chromosome 9 with polymorphism of G / A;

[0047] (7) SNP site 157181668 on chromosome 9 with polymorphism C / A;

[0048] (8) SNP site at position 155511186 on chromosome 9, with polymorphism of A / G;

[0049] (9) SNP site 153517876 on chromosome 9, with polymorphism A / C;

[0050] (10) SNP site 153901636 on chromosome 9, with polymorphism of C / T;

[0051] (11) SNP site 18063115 on chromosome 9 with polymorphism of T / C;

[0052] (12) SNP site 16877094 on chromosome 3, with polymorphism of A / T;

[0053] (13) SNP site 33281840 on chromosome 3, with polymorphism of C / T;

[0054] (14) SNP site at position 33539944 on chromosome 3, with polymorphism of G / A.

[0055] With respect to the first aspect, those skilled in the art may use 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 of the above 14 SNP sites to identify resistance to corn leaf blight in practical applications.

[0056] In a second aspect, the present invention provides a probe for identifying resistance to corn leaf blight, the probe comprising one or more of the probes shown in SEQ ID NOs: 1-14, and SEQ ID NOs: 1-14 are used to detect the 14 SNP sites described in the first aspect.

[0057] Wherein, SEQ ID NO:1-14 are respectively:

[0058] (1)TCTGCTCGTCTTGTCTCCCTCGATCAACCTGTTCTTGCTTGCT CTGTACTTCACAGATCAAAGGATTAAAGTGGTGCACTGTCTTGGT TTTTAGGTACTTGTTTGTTTAGGTCTCGGGTT (SEQ ID NO: 1);

[0059] (2)GACTTACTGTGGGCATGCATATACTATGCAATAAGCCAAAAgg gggggggggggggggTGCTGAGTGAGAACGGAGAACAGGGAGGAGCG CATGCAGGATGGAGTTGTGGACTTTGCTGT(SEQ ID NO:2);

[0060] (3)TCGCGGCTCCAATTTATGGGTAGGTCAGCTAGTACCGACCCG TAGCTGGTCAACCAGGCGGCACACCAGTCCGTGCCGAGCCTTGC GGCGGAGAAGAGGAAAAGTGGAGGTAATGGGTCC(SEQ ID NO:3);

[0061] (4)ACCTGATCTTTACATCCATATCCATATCCACTCCAGGACACCG CTGTGTGCCTCTTGTGAGTGAAGCCTACTAGCTAGTAGATGTAGAT CTGGGGAGGCTACGCCGGATCAGAACGACAG(SEQ ID NO:4);

[0062] (5)GTTAACATATATAATAACTATACGTGTTGGAGCTATCGATCCTT TATAAATCTTGATTTTAATGCATTTTGTTCTGTCTGAGATCACCGAT ATTGGAACAGGGTTATGATCTGCCCTAGC(SEQ ID NO:5);

[0063] (6)CTGTAAATTTGTCCAGAACATGTTTTCCCTAATAGCCCATCAT ATCCCGCTCTTTTTCTTGTTGATATGACCAAGGCTGGCAGCATCGC TGCTCAAGATAATGTTTGGGGCGCATGATTT(SEQ ID NO:6);

[0064] (7)TTAGAACACACAAGCCAATCTGGAACCATGAAATTAGAAAA GATTTCCCGAAGTACCCAATCCCACAGATGGGAATCACAGAACTA CCAATACCTAACCCCTGGAATCTACAGCTAATAG(SEQ ID NO:7);(8)GAGAAGGAAGACGAGATTATGGTCTCAAAGTATCTCGAGAT GACTTCAGACTCTGAAACCCCTATAAAAGTTGAGAACGTCATGTC ACTGCATTCTGCAAATGATGATGATGTTCCTTCT(SEQ ID NO:8);(9)GTCACTCTCCGTCTGGTCATCACGGGCAGGCACGCACCAGAT GCGGGTAGATAGAGAGAGATGCTGAATTGGAAGGTCAGTGCTGG ACTGACCAGCTCACCTGGCCAAGATTGCCGattc(SEQ ID NO:9);(10)TTTGCCTCGGAGTTCTCATCATTTGCTCTCATCTTGCCTGGT TCTTTTGACTTCCTTACACTTGAGGTGAGGCCTGCCAAGGCATGC GAGTCCTTATTCGTACTTCTAAGACCAAAGTAG(SEQ ID NO:10);(11)GGTACAACAGTAACAGGCAAGACGATTAACCACCCAGTCA CGCAACTCGCGCGTGACATGGCGAGTGGGTCGTATCATGTCCCAT CAGAGTTGCCCATGCCAAGAGGGATCATGATGGCT(SEQ ID NO:11);

[0065] (12) GGTGGAGAGCTGTTCCTAACACCACCCCTCCAGACTTCAAG AAAGTCACCTGCCAGCCATCATAAGCATAAGCACGCCATTAACAG GAGGACCCAATCTATATCTACTTTAGCAGACTAC (SEQ ID NO: 12); (13) TTCAGATATGAACATGCAATTTTAAATGGCTCACGCCCACAA ACATGACATATCAATACGCCATTCTAGTGTATTCTCTGGTAAACAA AGAAACAAGAAGCAAATTTGGTATTCATGTGC (SEQ ID NO: 13); (14) ATGGAATAAGGATTAAGGTGTGGTACCGTGTGTCAAGCGTT TGAACGTACTAAACACATACCAAGAAATATGGTAAATCGGTAAGCCTAGTACCTGAGTGAACCTGCCCGCAGACTTTAC (SEQ ID NO: 14).

[0066] SEQ ID NO: 1-14 are respectively used to detect the 14 SNP sites described in the first aspect, for example, SEQ ID NO: 1 is used to detect the SNP site of the first aspect (1), SEQ ID NO: 2 is used to detect the SNP site of the first aspect (2), SEQ ID NO: 3 is used to detect the SNP site of the first aspect (3), etc. Similar to the first aspect, those skilled in the art can use 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 of the above 14 probes to identify resistance to corn leaf blight in actual applications.

[0067] In a third aspect, the present invention provides a chip for identifying resistance to corn leaf blight, wherein the chip comprises the probe described in the second aspect.

[0068] In one embodiment, the chip further comprises probes for identifying corn varieties, such as detection probes for SNP sites for identifying corn varieties disclosed in other patents or articles, such as probes in CN106544425B (A DNA chip and its application in corn variety identification and breeding). In a further embodiment, the chip is a liquid phase chip.

[0069] In a fourth aspect, the present invention provides a kit for identifying resistance to corn leaf blight, the kit comprising the probe described in the second aspect or the chip described in the third aspect.

[0070] In one embodiment, the kit further comprises dNTPs, DNA polymerase, MgCl2, and PCR reaction buffer. It will be appreciated by those skilled in the art that the kit may also include other necessary reagents. In a further embodiment, the kit further comprises template DNA as a positive control to increase the accuracy of the SNP site detection.

[0071] In a fifth aspect, the present invention provides a method for identifying resistance to corn leaf blight, wherein the method uses the probe described in the second aspect, or the chip described in the third aspect, or the kit described in the fourth aspect to detect the 14 SNP sites described in the first aspect.

[0072] In an exemplary embodiment, the probe of SEQ ID NO: 1 is used to detect the SNP site of the first aspect (1) to identify resistance to corn leaf blight. If the SNP site is G, the sample does not have resistance to corn leaf blight. If the SNP site is A, the sample has resistance to corn leaf blight.

[0073] Example

[0074] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

[0075] Example 1 Identification of SNP resistance loci significantly associated with small spot disease

[0076] This example shows the process of screening 14 SNP loci for identification of resistance to corn leaf blight.

[0077] The inventors of the present application used 505 maize inbred lines that have been published (http: / / www.maizego.org / Resources.html) to conduct artificial inoculation and identification of P. microptera in Junxian, Henan, Changge, Henan, and Baoding, Hebei (spore concentration was 1×10 5 / mL), using 1-9 resistance standards. The results of identification under multi-year and multi-point environmental conditions showed that the inbred lines of the associated population showed a wide variation in resistance to leaf spot disease, and most of the disease-resistant materials came from inbred lines with tropical / subtropical bloodlines; the correlation analysis of the leaf spot disease phenotype of maize inbred lines using the Corrplot function showed that at the p < 0.01 level, the population phenotypes under different environments were significantly correlated, with a correlation coefficient of 0.54-0.87 ( Figure 1 ).

[0078] Subsequently, the inventors used the publicly published second-generation sequencing data of 505 maize inbred lines for variation detection analysis, with the reference genome version B73_v5, and used GATK software to analyze the genome variation information of each type of sample (2011 Changge Xiaoban A, 2012 Changge Xiaoban A, 2012 Changge Xiaoban B, 2012 Baoding Xiaoban A, 2012 Baoding Xiaoban B, 2012 Junxian Xiaoban). The filtering parameters were site missing rate MISS < 0.1, population heterozygosity rate HET < 0.05, and MAF ≥ 0.05 sites were retained; 30 < 120bp sequence GC content upstream and downstream of the SNP < 65, sequence complexity > 0.9, and repeat ratio ≤ 25%; finally, candidate sites containing 611,8276 SNP sites were obtained. A genome-wide association analysis of small leaf spot disease was performed using a mixed linear model using Tassel software, and SNP loci associated with small leaf spot disease resistance were identified on chromosomes 1, 3, 4, 5, 6, 8, and 9 ( Figure 2 ).

[0079] Based on the identification of resistance to leaf spot disease in inbred lines of associated populations, a RIL (Recombinant Inbred Lines) population containing 160 families of CML454 (resistant) × GEMS41 (susceptible) and an F2 population of CML496 (resistant) × GEMS41 (susceptible) were used to inoculate and identify resistance to leaf spot disease in Xuchang, Henan and Xinxiang, Henan for two consecutive years (2016 and 2017). Genetic linkage maps were constructed, and two QTL (Quantitative Trait Locus) sites significantly associated with leaf spot disease resistance were detected on chromosomes 3 (10-50Mb) and 9 (120-160Mb), respectively. Figure 3 and Figure 4 ), combined with the above genome-wide association analysis, 14 new SNP loci that were extremely significantly associated with corn leaf blight were screened out in these two disease resistance intervals (Table 1).

[0080] Table 1: 14 new SNP loci significantly associated with resistance to corn leaf blight

[0081]

[0082] Example 2 Chip Preparation

[0083] Using the data and data filtering steps of Example 1, the best quality SNPs were selected according to the window. The specific rule was that the difference in gene frequency between two consecutive windows was greater than 0.1, and the 800Kb window ensured at least one SNP marker, with 99% coverage in the whole genome. Finally, 6600 SNP sites evenly distributed on the genome were selected ( Figure 5 ), these 6600 SNP sites include the 14 SNP sites mentioned above.

[0084] This example is based on the above 6600 SNP sites and uses Beijing Baiyu Biotechnology Co., Ltd. The hybrid capture system is used to prepare chips to achieve targeted capture of target genes or sites; the captured fragments are subjected to high-throughput second-generation sequencing using a sequencing platform, thereby achieving accurate genotype identification of the target region or site. Figure 6 The chip of this embodiment comprises probes as shown in SEQ ID NO: 1-14 to detect the 14 SNP sites mentioned above.

[0085] Preparation of 6K liquid phase gene chip of corn

[0086] The preparation steps include template synthesis and probe preparation. The synthesized DNA template (Oligo Pool) undergoes quality control and in vitro amplification experiments, and is finally prepared into a finished probe. Corn 6K Liquid Phase Gene Chip Capture Kit ( Maize 6K liquid phase gene chip).

[0087] Example 3 Verification Experiment

[0088] 1. Sample and Data Acquisition

[0089] 1. Identification of corn resistance phenotypes and determination of test samples

[0090] During the implementation of the inventor's field corn research project, 112 corn inbred lines were selected. At the corn trumpet stage, the corn plants were artificially inoculated by spraying a spore suspension of the leaf blight fungus. The resistance to the leaf blight was investigated 4-5 weeks after inoculation, and the corn resistance phenotypic data (including 32 disease-resistant corn inbred lines, 23 disease-resistant corn inbred lines and 57 intermediate types) were obtained. The ear leaves of all corn inbred lines were collected for subsequent analysis.

[0091] 2. DNA library construction and capture

[0092] The genotypes of 112 corn samples were tested using the prepared chip: corn leaves were collected, leaf DNA was extracted using the SDS method, and DNA quality was tested using a spectrophotometer. The corn DNA samples that passed the quality control were subjected to ultrasonic or enzyme digestion, end repair and 3' end addition of "A", adapter ligation and purification, and Pre-PCR library amplification to obtain the library required for hybridization capture. The capture method was as follows The hybridization capture system is carried out according to the guidelines, and after library and probe hybridization, probe and magnetic bead binding, non-specifically bound library rinsing, post-capture PCR amplification, library quantification and quality inspection, sequencing is performed on the machine.

[0093] 3. Library quality control and quantification

[0094] The library concentration was tested using Qubit 4.0 Fluorometer, and the library concentration before capture was >25 ng / μL, which was considered a qualified library. The main peak of the library should be around 200-500 bp, with no impurities before and after the main peak, using ABI Qsep 100.

[0095] 4. Sequencing

[0096] The BGI DNBSEQ T7 second-generation sequencing platform was used for 2*150bp paired-end sequencing.

[0097] 2. Data Analysis

[0098] 1. Raw sequencing data

[0099] The raw image data obtained by high-throughput sequencing (DNBSEQ platform, Nova platform, etc.) is identified by a specific program and converted into raw sequencing data in Fastq format (called Raw data). The file format provided is generally: Project No. / Flowcell No. / Sample Name_Lane No._I+index No..R1 or R2.clean.fastq.gz.

[0100] 2. Data filtering quality control

[0101] By setting certain filtering criteria, the adapter information, low-quality bases, unmeasured bases (represented by N), etc. that may interfere with subsequent information analysis are removed. The data finally obtained is called clean data or cleanreads. The data filtering criteria in this embodiment are:

[0102] 1) Filter out reads containing adapter sequences;

[0103] 2) When the N content in a single-end sequencing read exceeds 3% of the read length, remove the paired reads;

[0104] 3) When the number of low-quality (less than 3) bases contained in a single-end sequencing read exceeds 50% of the length of the read, the paired reads are removed.

[0105] 3. Data Analysis Process

[0106] The samtools / bcftools (https: / / github.com / samtools / samtools) process was used for variation analysis. The filtered sequencing sequences were compared with the reference genome. The main process is as follows:

[0107] (1) Map to reference (BWA parameters: default parameters);

[0108] (2)Remove Duplicates(samtools);

[0109] (3) Call Variants (bcftools (MQ ≥ 30, other parameters are default));

[0110] (4)VCF Quality filter (bcftools standard);

[0111] (5)Annotating variants(snpEff / Python Script);

[0112] (6) A genome-wide association analysis was performed using the general linear model in Tassel software, and a total of 94 SNP loci were identified to be extremely significantly associated with resistance to corn leaf blight. The specific results are shown in Table 2. The inventors further found that all 14 new SNP loci of the present invention were included in the results of this identification, confirming the universality of the new SNP loci of the present invention.

[0113] Table 2: 94 SNPs significantly associated with resistance to corn leaf blight

[0114]

[0115]

[0116]

[0117] Note: The bold sites are the 14 SNP sites of the present invention.

[0118] 3. Chip Performance

[0119] This example tests the target site capture efficiency of the corn 6K liquid phase gene chip, and the corn varieties used include HN2238-HN2255. According to the site evaluation, design, and capture conditions, it is found that the average capture rate of the target site is above 95%. The specific data is shown in Table 3.

[0120] Table 3: Capture efficiency of target sites of maize 6K liquid phase gene chip

[0121]

[0122] The capture efficiency and number of sites of the test samples can be well detected. It meets the delivery standards of the corn 6K liquid phase gene chip. It can be applied on a large scale.

[0123] In addition, this example also analyzes the consistency of the test results of the corn 6K liquid phase gene chip. Four corn DNAs were selected from the above test samples, divided into two, and tested by the corn 6K liquid phase gene chip respectively. For the same plant sample, the consistency of the two DNA test results exceeded 99.7%. This shows that the test results of the corn 6K liquid phase gene chip have good reliability and stability. The specific results are shown in Table 4.

[0124] Table 4: Detection consistency of corn 6K liquid phase gene chip

[0125]

[0126] The chip provided in Application Example 2 can accurately and efficiently identify SNP information, and can be used for the identification of corn leaf blight resistance loci, corn inbred line genotyping, corn inbred line authenticity identification, corn inbred line diversity analysis, etc., providing strong support for molecular breeding of corn leaf blight resistance and variety authenticity identification.

[0127] The SNP sites for identifying resistance to corn leaf blight provided by the present invention and their applications are introduced in detail above. The principles and implementation methods of the present invention are explained in this article using specific examples. The description of the above examples is only used to help understand the method of the present invention and its core idea. At the same time, for those skilled in the art, according to the ideas of the present invention, there will be changes in the specific implementation methods and application scopes. In summary, the content of this specification should not be understood as limiting the present invention.

Claims

1. Application of 14 SNP loci in identification of resistance to corn leaf blight, the SNP loci include: (1) SNP site 155842030 on chromosome 9 with polymorphism of G / A; (2) SNP site 16877754 on chromosome 3, with polymorphism A / G; (3) SNP site 16905944 on chromosome 3, with polymorphism T / C; (4) SNP site 16678723 on chromosome 3, with polymorphism A / G; (5) SNP site 154229449 on chromosome 9, with polymorphism C / T; (6) SNP site 158233558 on chromosome 9, with polymorphism G / A; (7) SNP site 157181668 on chromosome 9, with polymorphism C / A; (8) SNP site 155511186 on chromosome 9 , SNP site with polymorphism of A / G; (9) SNP site 153517876 on chromosome 9, SNP site with polymorphism of A / C; (10) SNP site 153901636 on chromosome 9, SNP site with polymorphism of C / T; (11) SNP site 18063115 on chromosome 9, SNP site with polymorphism of T / C; (12) SNP site 16877094 on chromosome 3, SNP site with polymorphism of A / T; (13) SNP site 33281840 on chromosome 3, SNP site with polymorphism of C / T; (14) SNP site 33539944 on chromosome 3, SNP site with polymorphism of G / A.

2. A probe for identifying resistance to corn leaf blight, characterized in that: The probes include one or more of the probes shown in SEQ ID NOs: 1-14, and SEQ ID NOs: 1-14 are used to detect the 14 SNP sites described in claim 1.

3. A chip for identifying resistance to corn leaf blight, characterized in that: The chip comprises the probe according to claim 2.

4. The chip according to claim 3, characterized in that: The chip also contains probes for identifying corn varieties.

5. A kit for identifying resistance to corn leaf blight, characterized in that: The kit comprises the probe according to claim 2 or the chip according to claim 3 or 4.

6. The kit according to claim 5, characterized in that The kit also contains dNTPs, DNA polymerase, MgCl2 and PCR reaction buffer.

7. The kit according to claim 5 or 6, characterized in that The kit also contains template DNA.

8. A method for identifying resistance to corn leaf blight, characterized in that: The method uses the probe described in claim 2, or the chip described in claim 3 or 4, or the kit described in any one of claims 5-7 to detect the 14 SNP sites described in claim 1.

Images