InDel molecular marker for identifying seed-use Cucurbita moschata Defeng seed No.1 hybrid, application of primer of InDel molecular marker and method

Abstract

The invention relates to an InDel molecular marker for identifying a seed-use Cucurbita moschata Desfeng seed No.1 hybrid, application of a primer of the InDel molecular marker and a method, and belongs to the field of biotechnology-assisted breeding. The characteristic sequence of the InDel molecular marker 5482813 in the female parent of the hybrid variety of the pumpkin 'Defeng seed No.1' is more than the characteristic sequence of the InDel molecular marker 5482813 in the 94th-108th site by a segment of insertion sequence GAAGACGAAGAAGAA in the male parent of the hybrid variety of the pumpkin 'Defeng seed No.1'. The InDel molecular marker can quickly complete purity identification of the seed-use Cucurbita moschata 'Defeng seed No.1' hybrid seed in a short time, and has the advantages of high stability, simple and quick method and accurate result.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers and assisted breeding, and particularly relates to an InDel molecular marker for identifying a seed-use Indian pumpkin Defengzi No. 1 hybrid and the application and method of its primers. Background Art

[0002] Indian pumpkin (Cucurbita moschata D.) is a herbaceous plant of the Cucurbitaceae family, originating from the American continent. It is an important horticultural vegetable crop and is widely cultivated worldwide. At the same time, Indian pumpkin has multiple uses, such as seeds, meat, and anvils. During the hybrid seed production process of Indian pumpkin, due to incomplete or untimely removal of the male flowers of the female parent during pollination, pollen falls on the stigma of the female flower of the female parent to produce self-fertilized seeds, resulting in false hybrids, resulting in a decrease in seed genetic purity, causing huge economic losses to production. Therefore, the rapid and accurate identification of the purity of the first-generation hybrids has become one of the most urgent problems to be solved in the production of Indian pumpkin.

[0003] Common methods for seed purity identification mainly include field morphological identification, isozyme identification and molecular marker identification. Field morphological identification is costly and time-consuming, and the identification results are also affected by environmental factors; isozyme identification is highly accurate, but its application is often limited due to its tissue and organ specificity. Molecular marker technology can reveal tiny genetic differences between offspring and parents at the DNA level, is not affected by growing seasons, environmental conditions and cultivation measures, and can greatly shorten the identification time. InDel markers have the advantages of high polymorphism, large number, good stability, and easy detection, and are widely used in purity identification and molecular marker-assisted breeding.

[0004] In recent years, the seed-producing Indian pumpkin 'Defengzi No. 1' has been very popular among consumers because its seeds are rich in crude fat and unsaturated fatty acids, amino acids, mineral elements, vitamins, sugars and other nutrients. The promotion area is expanding day by day, and the demand for seeds is increasing accordingly. In order to prevent the phenomenon of false hybrids formed by self-pollination of the female parent during artificial seed production, it is urgent to determine the purity identification method of the hybrid seeds of Indian pumpkin 'Defengzi No. 1', and provide technical support for the purity identification of Indian pumpkin. Summary of the invention

[0005] Based on the blank in the above-mentioned field, the present invention aims to provide an InDel molecular marker for identifying the seed purity of the hybrid seed of Indian pumpkin 'Defeng Seed No. 1' for seed; provide a PCR detection kit for identifying the seed purity of the hybrid seed of Indian pumpkin 'Defeng Seed No. 1' for seed; apply the InDel marker to identify the authenticity or seed purity of the hybrid seed of Indian pumpkin 'Defeng Seed No. 1' for seed, so that there is no need to wait for the pumpkin plant to grow to the fruit maturity stage and then observe the morphological characteristics. DNA can be extracted in the seedling stage, and true and false hybrids can be distinguished according to the amplified fragments, so as to effectively identify the purity of the hybrid.

[0006] The above object of the present invention is achieved through the following technical solutions:

[0007] The InDel molecular marker 5482813 used for identifying the hybrid of Indian pumpkin 'Defengzi No. 1' for seed is characterized in that the characteristic sequence of the InDel molecular marker 5482813 in the female parent of the hybrid of Indian pumpkin 'Defengzi No. 1' has an additional insertion sequence GAAGACGAAGAAGAA at positions 94-108 than the characteristic sequence of the InDel molecular marker 5482813 in the male parent of the hybrid of Indian pumpkin 'Defengzi No. 1'.

[0008] The sequence of the upstream primer 5482813-F for detecting the InDel molecular marker 5482813 is shown in SEQ ID NO.3, and the sequence of the downstream primer 5482813-R is shown in SEQ ID NO.4.

[0009] The characteristic sequence of the InDel molecular marker in the genome of the female parent 'DF-M3' of the hybrid of seed-producing Indian pumpkin 'Defengzi No. 1' is as shown in SEQ ID NO.1;

[0010] Preferably, the characteristic sequence of the InDel molecular marker in the genome of the male parent 'DF-F2' of the hybrid of seed Indian pumpkin 'Defengzi No. 1' is as shown in SEQ ID NO.2;

[0011] Preferably, the characteristic sequences of the InDel molecular markers in the hybrid of Indian pumpkin 'Defengzi No. 1' for seeds are SEQ ID NO. 1 and SEQ ID NO. 2, respectively.

[0012] Use of the upstream primer 5482813-F with a sequence as shown in SEQ ID NO.3 and the downstream primer 5482813-R with a sequence as shown in SEQ ID NO.4 in detecting and identifying the hybrid of Indian pumpkin 'Defengzi No. 1' for seeds.

[0013] The characteristic sequences of the upstream primer 5482813-F with the sequence shown in SEQ ID NO.3 and the downstream primer 5482813-R with the sequence shown in SEQ ID NO.4 for detecting the hybrid of Indian pumpkin 'Defengzi No. 1' for seed use are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

[0014] The upstream primer 5482813-F with a sequence as shown in SEQ ID NO.3 and the downstream primer 5482813-R with a sequence as shown in SEQ ID NO.4 are used to detect the characteristic sequences of the female parent of the hybrid of Indian pumpkin 'Defengzi No. 1' for seeds, respectively.

[0015] The upstream primer 5482813-F with a sequence as shown in SEQ ID NO.3 and the downstream primer 5482813-R with a sequence as shown in SEQ ID NO.4 are used to detect the characteristic sequences of the male parent of the hybrid of Indian pumpkin 'Defengzi No. 1' for seed use, as shown in SEQ ID NO.2 respectively.

[0016] A method for molecular identification of a seed-bearing Indian pumpkin 'Defengzi No. 1' hybrid, characterized in that PCR is performed on candidate pumpkin materials using primers of the InDel molecular marker 5482813 for identifying a seed-bearing Indian pumpkin 'Defengzi No. 1' hybrid.

[0017] The primers of the InDel molecular marker 5482813 for identifying the hybrid of Indian pumpkin 'Defengzi No. 1' for seed use include: an upstream primer 5482813-F having a sequence as shown in SEQ ID NO.3 and a downstream primer 5482813-R having a sequence as shown in SEQ ID NO.4;

[0018] Preferably, the PCR system includes: 0.75 ng / μl DNA template, 5 ng / μl forward and reverse primers, 0.5 μL / μl 2×3G Taq Master Mix for PAGE (Red Dye);

[0019] Preferably, the PCR system is: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G TaqMaster Mix for PAGE (Red Dye), and double distilled water to 10 μL;

[0020] Preferably, the PCR procedure includes: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds as one cycle, for a total of 35 cycles; incubation at 72°C for 5 minutes;

[0021] Preferably, the DNA template refers to the DNA of a candidate pumpkin material.

[0022] Determine the identification result according to the electrophoresis result or sequencing result of the PCR product;

[0023] The candidate pumpkin material whose electrophoresis results show two characteristic bands or whose sequencing results simultaneously detect two sequences as shown in SEQ ID NO.1 and SEQ ID NO.2 is the hybrid of Indian pumpkin 'Defengzi No. 1' for seeds;

[0024] Preferably, the electrophoresis refers to separating the PCR products using 6% non-denaturing polyacrylamide gel;

[0025] Preferably, the electrophoresis condition is 150V constant power electrophoresis separation for 1h 30min, and silver staining is performed after electrophoresis.

[0026] The invention provides an InDel molecular marker 5482813 and a primer pair 5482813-F and 5482813-R thereof, which are mainly used in pumpkin hybrid seed purity identification and auxiliary identification, pumpkin hybrid seed purity screening and pumpkin molecular marker-assisted breeding.

[0027] Another aspect of the present invention is to provide a PCR detection kit for identifying the authenticity of the hybrid of the seed Indian pumpkin variety 'Defeng Seed No. 1' or the purity of the hybrid seeds of 'Defeng Seed No. 1'. The PCR detection kit comprises: dNTPs, Taq enzyme, a PCR primer pair consisting of a forward primer and a reverse primer, an amplification buffer and sterile water; wherein the PCR primer is the InDel molecular marker 5482813 described above.

[0028] Another aspect of the present invention is to provide a method for identifying the authenticity or seed purity of the Indian pumpkin variety 'Defeng Seed No. 1': using the InDel marker, PCR amplification, and 6% non-denaturing polyacrylamide gel electrophoresis detection can show the polymorphism between different individuals, thereby achieving the purpose of identification.

[0029] Specifically, the present invention provides a method for identifying the purity of seeds of the Indian pumpkin variety 'Defengzi No. 1' based on InDel markers, and the identification method comprises:

[0030] (1) extracting genomic DNA from a pumpkin seed sample to be tested;

[0031] (2) using the extracted sample genomic DNA as a template, performing PCR amplification reaction using the upstream and downstream primers 5482813-F and 5482813-R shown in SEQ ID No. 3 and SEQ ID No. 4 to obtain a PCR product;

[0032] (3) performing polyacrylamide gel electrophoresis on the PCR amplification product of step (2);

[0033] (4) Analyze the electrophoresis results of step (3). If the band pattern of each amplified product has the band pattern of the hybrid parent of "Defengzi No. 1", the pumpkin variety to be tested is the hybrid of "Defengzi No. 1"; if the band pattern of any amplified product does not have the band pattern of the hybrid parent of "Defengzi No. 1", the pumpkin variety to be tested is not the hybrid of "Defengzi No. 1";

[0034] (5) Calculate the ratio of the number of true 'Defengzi No. 1' hybrid seeds to the total number of tested seeds to obtain the seed purity of the 'Defengzi No. 1' hybrid seeds.

[0035] The PCR system includes: 0.75 ng / μl DNA template, 5 ng / μl forward and reverse primers, 0.5 μL / μl 2×3G Taq Master Mix for PAGE (Red Dye);

[0036] Preferably, the PCR system is: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G TaqMaster Mix for PAGE (Red Dye), and double distilled water to 10 μL;

[0037] The DNA templates are genomic DNA of individual seedlings of the maternal parent 'DF-M3', the paternal parent 'DF-F2' and 'Defengzi No. 1';

[0038] Preferably, the PCR program is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds as one cycle, for a total of 35 cycles; incubation at 72°C for 5 minutes;

[0039] Preferably, the detection further comprises: performing electrophoresis on the PCR product;

[0040] The electrophoresis refers to separating the PCR products using 6% non-denaturing polyacrylamide gel;

[0041] Preferably, the electrophoresis condition is 150V constant power electrophoresis separation for 1h30min, and silver staining after electrophoresis;

[0042] Preferably, if the band pattern of each amplified product has the band pattern of the hybrid parent of 'Defengzi No. 1' at the same time, the pumpkin variety to be tested is the hybrid of 'Defengzi No. 1'; if the band pattern of any amplified product does not have the band pattern of the hybrid parent of 'Defengzi No. 1' at the same time, the pumpkin variety to be tested is not the hybrid of 'Defengzi No. 1'.

[0043] Preferably, purity calculation refers to the percentage of hybrid seeds to the number of seeds in the test sample;

[0044] The female parent of the seed Indian pumpkin hybrid 'Defengzi No. 1' is 'DF-M3', the male parent of the pumpkin hybrid 'Defengzi No. 1' is 'DF-F2', and the hybrid F1 single plants all refer to the single plants of the 'Defengzi No. 1' hybrid.

[0045] Beneficial effects of the present invention:

[0046] 1. The present invention has developed a pair of molecular markers and primers that can be used to identify the purity of hybrid seeds of Indian pumpkin 'Defengzi No. 1'. The molecular markers can quickly distinguish true and false hybrids, have strong specificity, and are genetically stable. They can be quickly applied to molecular marker-assisted breeding screening for pumpkin purity.

[0047] 2. Through the primers and methods of the present invention, it is only necessary to extract the genomic DNA of pumpkin leaves at the seedling stage, and then perform PCR amplification and polyacrylamide gel electrophoresis to quickly and effectively identify the purity of 'Defengzi No. 1' hybrid seeds without field observation. It is fast, accurate, low-cost and has high commercial value.

[0048] 3. The method of the present invention has good specificity and high accuracy in identifying the purity of pumpkin hybrid seeds, which is consistent with the field seed survey results, and the identification accuracy rate is as high as 100%. Through the 5482813 molecular markers and primers provided by the present invention, the hybrid seeds of 'Defengzi No. 1' and their parent seeds can be quickly and accurately detected in the seedling stage according to the identification method provided by the present invention. The molecular markers developed by the present invention can be applied to the field production and seed production practice of Indian pumpkin 'Defengzi No. 1' hybrid seeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 The electrophoresis patterns of the samples of the parents and 'Defengzi No. 1' (Marker, 750bp; female parent 'DF-M3', male parent 'DF-F2'; the remaining bands are hybrid bands of 'Defengzi No. 1'; the band shown in the female parent is SEQ ID No. 1; the band shown in the male parent is SEQ ID No. 2). DETAILED DESCRIPTION

[0050] The present invention is further described in detail below in conjunction with specific embodiments, but the scope of the present invention is not limited thereto. Unless otherwise specified, the operations used in the following examples are all conventional methods, and the reagents used can all be commercially available.

[0051] Sources of biological materials

[0052] 1. Experimental materials used in Experimental Examples 1 and 2 of the present invention: the female parent 'DF-M3' and the male parent 'DF-F2' are pumpkin strains owned by the applicant's laboratory. The applicant promises to distribute seeds of the above pumpkin strains to the public within 20 years from the date of application for verifying the effects of the present invention;

[0053] 2. The hybrid variety 'Defengzi No. 1' used in Experimental Example 2 of the present invention is a well-known and commonly used pumpkin variety and can be purchased commercially.

[0054] Main reagents

[0055] PCR experiments used 2×3G Taq Master Mix for PAGE (Red Dye) from Vazyme, and gel electrophoresis used 40% non-denaturing polyacrylamide from Beijing Coolbo Technology Co., Ltd., which was diluted to 6%. Sequencing was performed at Beijing Bioengineering Co., Ltd.

[0056] The first group of examples, INDEL molecular markers of the present invention 5482813

[0057] This group of embodiments provides an InDel molecular marker 5482813 for identifying the hybrid of Indian pumpkin 'Defengzi No. 1' for seed use. All embodiments in this group have the following common characteristics: the characteristic sequence of the InDel molecular marker 5482813 in the female parent of the hybrid of Indian pumpkin 'Defengzi No. 1' has an additional insertion sequence GAAGACGAAGAAGAA at positions 94-108 compared with the characteristic sequence of the InDel molecular marker 5482813 in the male parent of the hybrid of Indian pumpkin 'Defengzi No. 1'.

[0058] In a further embodiment, the sequence of the upstream primer 5482813-F for detecting the InDel molecular marker 5482813 is shown as SEQ ID NO.3, and the sequence of the downstream primer 5482813-R is shown as SEQ ID NO.4.

[0059] In a specific embodiment, the characteristic sequence of the InDel molecular marker in the genome of the female parent 'DF-M3' of the hybrid of seed-producing Indian pumpkin 'Defengzi No. 1' is as shown in SEQ ID NO.1;

[0060] Preferably, the characteristic sequence of the InDel molecular marker in the genome of the male parent 'DF-F2' of the hybrid of seed Indian pumpkin 'Defengzi No. 1' is as shown in SEQ ID NO.2;

[0061] Preferably, the characteristic sequences of the InDel molecular markers in the hybrid of Indian pumpkin 'Defengzi No. 1' for seeds are SEQ ID NO. 1 and SEQ ID NO. 2, respectively.

[0062] The second group of embodiments, detection use of the primers of the present invention

[0063] This group of embodiments provides the use of an upstream primer 5482813-F with a sequence as shown in SEQ ID NO.3 and a downstream primer 5482813-R with a sequence as shown in SEQ ID NO.4 in detecting and identifying hybrids of the seed-producing Indian pumpkin 'Defengzi No. 1'.

[0064] In a specific embodiment, the upstream primer 5482813-F whose sequence is shown in SEQ ID NO.3 and the downstream primer 5482813-R whose sequence is shown in SEQ ID NO.4 are used to detect the characteristic sequences of the hybrid of Indian pumpkin 'Defengzi No. 1' for seeds as shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

[0065] In other embodiments, the upstream primer 5482813-F with a sequence as shown in SEQ ID NO.3 and the downstream primer 5482813-R with a sequence as shown in SEQ ID NO.4 for detecting the characteristic sequence of the female parent of the hybrid of Indian pumpkin 'Defengzi No. 1' for seed use are respectively as shown in SEQ ID NO.1.

[0066] In some embodiments, the upstream primer 5482813-F whose sequence is shown as SEQ ID NO.3 and the downstream primer 5482813-R whose sequence is shown as SEQ ID NO.4 for detecting the characteristic sequence of the male parent of the hybrid of Indian pumpkin 'Defengzi No. 1' for seed use are shown as SEQ ID NO.2 respectively.

[0067] The third group of embodiments, the molecular identification method of the present invention

[0068] This group of embodiments provides a method for molecular identification of hybrid seeds of Indian pumpkin 'Defengzi No. 1'. All embodiments in this group have the following common features: PCR is performed on candidate pumpkin materials using primers of InDel molecular marker 5482813 for identifying hybrid seeds of Indian pumpkin 'Defengzi No. 1' described in any one of the first group of embodiments.

[0069] In some embodiments, the primers for the InDel molecular marker 5482813 for identifying the hybrid of Indian pumpkin 'Defengzi No. 1' for seed use include: an upstream primer 5482813-F having a sequence as shown in SEQ ID NO.3 and a downstream primer 5482813-R having a sequence as shown in SEQ ID NO.4;

[0070] Preferably, the PCR system includes: 0.75 ng / μl DNA template, 5 ng / μl forward and reverse primers, 0.5 μL / μl 2×3G Taq Master Mix for PAGE (Red Dye);

[0071] Preferably, the PCR system is: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G TaqMaster Mix for PAGE (Red Dye), and double distilled water to 10 μL;

[0072] Preferably, the PCR procedure includes: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds as one cycle, for a total of 35 cycles; incubation at 72°C for 5 minutes;

[0073] Preferably, the DNA template refers to the DNA of a candidate pumpkin material.

[0074] In a further embodiment, the identification result is determined based on the electrophoresis result or sequencing result of the PCR product;

[0075] The candidate pumpkin material whose electrophoresis results show two characteristic bands or whose sequencing results simultaneously detect two sequences as shown in SEQ ID NO.1 and SEQ ID NO.2 is the hybrid of Indian pumpkin 'Defengzi No. 1' for seeds;

[0076] Preferably, the electrophoresis refers to separating the PCR products using 6% non-denaturing polyacrylamide gel;

[0077] Preferably, the electrophoresis condition is 150V constant power electrophoresis separation for 1h30min, and silver staining is performed after electrophoresis.

[0078] Experimental Example 1: Screening of specific molecular markers

[0079] Based on pumpkin InDel primers, the whole genome DNA of the maternal parent 'DF-M3' and the paternal parent 'DF-F2' was used as a template to screen for polymorphic primers between the parents, and finally a co-dominant difference marker between the parents was determined, named 5482813, and the sequence is as follows:

[0080] 5482813-F:CAACACGAACCCAGATGCAA(SEQ ID NO.3)

[0081] 5482813-R: CTCTCTCACACGGCGAAATG (SEQ ID NO. 4);

[0082] The marker has a clear band pattern and good reproducibility. Primer 5482813 can amplify a 218-nucleotide maternal 'DF-M3' specific amplified fragment and a 203-nucleotide paternal 'DF-F2' specific fragment (see Figure 1 ).

[0083] Experimental Example 2: Purity Identification of Indian Pumpkin Hybrid 'Defengzi No. 1'

[0084] 1. Identification method

[0085] 1.1 Extraction of leaf genomic DNA

[0086] The seeds of the parents (female parent 'DF-M3' and male parent 'DF-F2') and the sample seeds were sown in a 50-hole plug tray at the same time and watered regularly until two true leaves grew; the leaves of the male parent, female parent and 100 hybrid sample seeds were sampled individually. Genomic DNA was extracted according to the conventional CTAB method.

[0087] (1) Take about 0.2 g of fresh leaves and place them in a 2 ml centrifuge tube, put it in liquid nitrogen, and then quickly grind it into powder with a glass rod;

[0088] (2) Add 800 μl of 2% CTAB preheated buffer;

[0089] (3) 65°C water bath for 1.0 h (during which the centrifuge tube was slowly shaken up and down every 10 min to fully mix the dry powder sample and CTAB);

[0090] (4) After cooling to below 15°C, add an equal volume (800 μl) of 24:1 chloroform / isoamyl alcohol, mix up and down for 10 min to ensure that the sample and chloroform are fully mixed, and centrifuge for 10 min (13000 rpm / min);

[0091] (5) Pipette 600 μl of supernatant into a new 1.5 ml centrifuge tube and repeat step (4);

[0092] (6) Pipette 400 μl of the supernatant into another 1.5 ml centrifuge tube, add 800 μl of pre-cooled anhydrous ethanol, mix well, and place in a -20 °C refrigerator for 30 min;

[0093] (7) Centrifuge at 13000 rpm for 10 min, discard the supernatant, and collect the precipitate;

[0094] (8) Add 500 μl of 70% ethanol, wash twice, and leave at room temperature for 5 to 10 minutes;

[0095] (9) Centrifuge at 7500 rpm for 5 min, discard the supernatant, and place the opening in a clean bench to dry;

[0096] (10) Add 100 μl ddH2O to dissolve the DNA.

[0097] 1.2 PCR amplification and detection analysis

[0098] Using the genomic DNA described in 1.1 as a template and 5482813 as primers, PCR amplification was performed respectively;

[0099] The PCR reaction system was: 10 μL reaction system, 3 μL DNA (5.0 ng·μL-1), 1 μL each of forward and reverse primers (50 ng·μL-1), and 5 μL 2×3G Taq Master Mix for PAGE (Red Dye) (product of Vazyme).

[0100] The PCR amplification program was as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, extension at 72°C for 30 seconds, 35 cycles; incubation at 72°C for 5 minutes, and storage at 10°C.

[0101] The PCR products were separated by 6% non-denaturing polyacrylamide gel electrophoresis buffer of 0.5×TBE at 150V constant power for 1h30min. After electrophoresis, the products were silver stained and the band types were counted.

[0102] If the band pattern of each amplified product has both the band patterns of the parents of the 'Defengzi No. 1' hybrid, the pumpkin variety to be tested is the 'Defengzi No. 1' hybrid. Those that lack any characteristic band of the two parents or have non-parent-specific bands are all false hybrids.

[0103] 2. Results Analysis

[0104] The hybrid of 'Defengzi No. 1' was amplified by PCR and electrophoresed using InDel primer 5482813 to complete the purity identification. The results are shown in Figure 1 ,from Figure 1 It can be clearly seen that a specific band of 218bp was amplified in the female parent 'DF-M3', and a specific band of 203bp was amplified in the male parent 'DF-F2'. Among the tested seeds, 100 lanes of the spectrum were consistent with the hybrid spectrum of 'Defengzi No. 1'. The calculated purity of the pumpkin hybrid was 100.0%, which was consistent with the field seed purity survey results, with an accuracy rate of 100%. The sample electrophoresis spectrum of 100 seeds of 'Defengzi No. 1' is shown in Figure 1 shown.

[0105] The field seed purity survey refers to distinguishing the seed purity corresponding to a specific plant based on the field morphology of the pumpkin plant (mainly the trait of fruit shape). The seeds corresponding to the plant with an oblate fruit shape are "Defeng Seed No. 1" seeds, while the seeds corresponding to the plant with an oblong fruit shape are not "Defeng Seed No. 1" seeds. This field seed purity survey method is a common method for identifying the purity of "Defeng Seed No. 1" seeds in this field.

[0106] Although the present invention has been described in detail above through general description and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made on the basis of the present invention. Therefore, these modifications or improvements made on the basis of not departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

Claims

1. InDel molecular marker 5482813 for identifying the hybrid of Indian pumpkin Defengzi No. 1 for seeds, characterized in that: The characteristic sequence of the InDel molecular marker 5482813 in the female parent of the Indian pumpkin Defengzi No. 1 hybrid has an additional insertion sequence GAAGACGAAGAAGAA at positions 94-108 compared with the characteristic sequence of the InDel molecular marker 5482813 in the male parent of the Indian pumpkin Defengzi No. 1 hybrid.

2. The InDel molecular marker 5482813 for identifying the hybrid of Indian pumpkin Defengzi No. 1 for seeds according to claim 1, characterized in that: The sequence of the upstream primer 5482813-F for detecting the InDel molecular marker 5482813 is shown in SEQ ID NO.3, and the sequence of the downstream primer 5482813-R is shown in SEQ ID NO.

4.

3. The InDel molecular marker 5482813 for identifying the hybrid of Indian pumpkin Defengzi No. 1 for seeds according to claim 1, characterized in that: The characteristic sequence of the InDel molecular marker in the genome of the female parent 'DF-M3' of the seed-using Indian pumpkin Defengzi No. 1 hybrid is as shown in SEQ ID NO.1; And / or, the characteristic sequence of the InDel molecular marker in the genome of the male parent 'DF-F2' of the seed Indian pumpkin Defengzi No. 1 hybrid is as SEQ ID NO.2; And / or, the characteristic sequences of the InDel molecular marker in the seed-use Indian pumpkin Defengzi No. 1 hybrid are SEQ ID NO. 1 and SEQ ID NO. 2 respectively.

4. Use of the upstream primer 5482813-F with a sequence as shown in SEQ ID NO.3 and the downstream primer 5482813-R with a sequence as shown in SEQ ID NO.4 in detecting and identifying the hybrid variety of Indian pumpkin Defengzi No. 1 for seeds.

5. Use of the upstream primer 5482813-F with a sequence as shown in SEQ ID NO.3 and the downstream primer 5482813-R with a sequence as shown in SEQ ID NO.4 according to claim 4 in detecting and identifying the hybrid of Indian pumpkin Defengzi No. 1 for seeds, characterized in that: The characteristic sequences of the upstream primer 5482813-F with the sequence shown in SEQ ID NO.3 and the downstream primer 5482813-R with the sequence shown in SEQ ID NO.4 for detecting the seed-use Indian pumpkin Defengzi No. 1 hybrid are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively.

6. Use of the upstream primer 5482813-F with a sequence as shown in SEQ ID NO.3 and the downstream primer 5482813-R with a sequence as shown in SEQ ID NO.4 according to claim 4 in detecting and identifying the hybrid of Indian pumpkin Defengzi No. 1 for seeds, characterized in that: The upstream primer 5482813-F with a sequence as shown in SEQ ID NO.3 and the downstream primer 5482813-R with a sequence as shown in SEQ ID NO.4 are used to detect the characteristic sequences of the female parent of the Indian pumpkin Defengzi No. 1 hybrid for seeds, as shown in SEQ ID NO.1 respectively.

7. Use of the upstream primer 5482813-F with a sequence as shown in SEQ ID NO.3 and the downstream primer 5482813-R with a sequence as shown in SEQ ID NO.4 according to claim 4 in detecting and identifying the hybrid of Indian pumpkin Defengzi No. 1 for seeds, characterized in that: The upstream primer 5482813-F with a sequence as shown in SEQ ID NO.3 and the downstream primer 5482813-R with a sequence as shown in SEQ ID NO.4 for detecting the characteristic sequences of the male parent of the hybrid Indian pumpkin Defengzi No. 1 for seeds are respectively as shown in SEQ ID NO.

2.

8. A method for molecular identification of Indian pumpkin Defengzi No. 1 hybrid for seeds, characterized in that: PCR is performed on candidate pumpkin materials using the primers of InDel molecular marker 5482813 for identifying the seed-use Indian pumpkin Defengzi No. 1 hybrid described in any one of claims 1-3.

9. The method for molecular identification of Indian pumpkin Defengzi No. 1 hybrid according to claim 9, characterized in that: The primers of the InDel molecular marker 5482813 for identifying the hybrid of Indian pumpkin Defengzi No. 1 for seeds include: an upstream primer 5482813-F with a sequence as shown in SEQ ID NO.3 and a downstream primer 5482813-R with a sequence as shown in SEQ ID NO.4; And / or, the PCR system includes: 0.75 ng / μl DNA template, 5 ng / μl forward and reverse primers, 0.5 μL / μl 2×3G Taq Master Mix for PAGE (Red Dye); and / or, the PCR system is: 7.5 ng DNA template, 50 ng each of forward and reverse primers, 5 μL 2×3G TaqMaster Mix for PAGE (Red Dye), and double distilled water to 10 μL; And / or, the PCR program includes: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 30 seconds as one cycle, for a total of 35 cycles; incubation at 72°C for 5 minutes; And / or, the DNA template refers to the DNA of a candidate pumpkin material.

10. A method for molecular identification of Indian pumpkin Defengzi No. 1 hybrid for seed use according to claim 8 or 9, characterized in that: Determine the identification result according to the electrophoresis result or sequencing result of the PCR product; The candidate pumpkin material whose electrophoresis results show two characteristic bands or whose sequencing results simultaneously detect two sequences as shown in SEQ ID NO.1 and SEQ ID NO.2 is the seed-use Indian pumpkin Defengzi No. 1 hybrid; And / or, the electrophoresis refers to separating the PCR products using 6% non-denaturing polyacrylamide gel; And / or, the electrophoresis condition is 150V constant power electrophoresis separation for 1h30min, and silver staining is performed after electrophoresis.

Images