SNP molecular marker linked with white gourd pulp thickness major QTL and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker linked with a white gourd pulp thickness major QTL (Quantitative Trait Loci) and application thereof, and belongs to the technical field of plant molecular genetic breeding. The SNP molecular marker is located at the position of No.12 chromosome 1821713bp of white gourd, and the polymorphism of the SNP molecular marker is G / A. The SNP molecular marker provided by the invention can be used for identification in wax gourd seeds or in the early stage of the seedling stage. In addition, the marking technology can directly detect the phenotypic characteristics of the pulp thickness of the fruits in the commodity period without cutting the fruits open. The SNP typing and detection provided by the invention have the advantages of high accuracy, low cost and short time. The technology can be widely applied to molecular marker-assisted selective breeding of wax gourd pulp thickness and wax gourd quality, and the product yield of wax gourds in the processing and fresh eating processes is effectively improved.

Description

Technical Field

[0001] The invention relates to the technical field of plant molecular genetic breeding, and in particular to a SNP molecular marker linked to a major effect QTL of wax gourd flesh thickness and an application thereof. Background Art

[0002] SLAF-Seq (site-specific amplified fragment sequencing) is a simplified genome sequencing technology based on second-generation high-throughput sequencing. It performs double-end sequencing on fragments produced by specific enzyme cutting to obtain genetic polymorphism markers, accurately identify and type single nucleotide polymorphism (SNP) sites. SLAF-Seq combines simplified library construction, fragment amplification and high-throughput sequencing to efficiently develop polymorphic markers, avoid interference from repetitive sequences, and simplify complex genome analysis. Therefore, SLAF-Seq has a wide range of applications in polymorphic marker discovery, genetic linkage map construction, QTL positioning, genetic diversity analysis and whole genome sequencing, providing strong technical support.

[0003] Single nucleotide polymorphisms (SNPs) are a new generation of genetic markers. KASP technology (competitive allele-specific PCR) is one of the main SNP typing methods currently available, which can accurately identify SNPs and InDels (insertions and deletions) at specific sites. This technology performs typing through specific matching at the ends of primers and is widely used in large-scale SNP genotyping, shortening verification time and reducing costs. KASP technology uses universal fluorescent primers for amplification, reducing reagent costs while ensuring high accuracy. It is widely used in plant molecular marker positioning and large population scanning, and has good application prospects in medicine and agronomy.

[0004] As an important economic crop suitable for transportation from the south to the north and suitable for processing, the thickness of wax gourd has a significant impact on processing and fresh consumption. The thickness of the flesh directly determines the fruit shape and yield. The thicker the flesh, the higher the utilization rate, and it affects the transportation and storage costs. The flesh thickness of wax gourd is an important agronomic trait after the fruit is fully mature, and it is significantly affected by environmental factors, becoming one of the difficulties in trait improvement. Traditional breeding methods usually need to wait until the fruit is mature before evaluating the flesh thickness. This process is time-consuming, laborious, and costly. Therefore, it is of great practical significance to use modern molecular biotechnology to improve germplasm and select thick-fleshed varieties. At present, the research on genes regulating wax gourd flesh thickness is still in its initial stage, and there is little research on the development of molecular markers, which to a certain extent restricts the innovation and cultivation of thick-fleshed wax gourd varieties. Therefore, it is urgent to deeply explore the molecular markers closely related to wax gourd flesh thickness and use molecular marker technology to carry out high-throughput screening at the seedling stage. This will not only improve breeding efficiency and reduce costs, but also accelerate the pace of winter melon molecular breeding, thereby providing more powerful technical support for the sustainable development of the winter melon industry. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker linked to the major effect QTL of wax gourd flesh thickness and its application to solve the problems existing in the above-mentioned prior art. The SNP molecular marker provided by the present invention can quickly and easily identify wax gourd flesh thickness.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] Technical solution 1: A SNP molecular marker linked to the major QTL of wax gourd flesh thickness, wherein the SNP molecular marker is located at the position of 1821713bp on chromosome 12 of wax gourd, and its polymorphism is G / A.

[0008] Preferably, thick flesh is G and thin flesh is A.

[0009] Furthermore, the SNP molecular marker is located at the 25th base from the 5' end of the sequence shown in SEQ ID NO.1.

[0010] The present invention adopts SLAF-Seq technology, which can efficiently and quickly screen out molecular markers related to traits, thereby providing support for the construction of a molecular marker-assisted breeding system and can be quickly and large-scale applied in breeding practice.

[0011] Technical solution 2: A kit for detecting the SNP molecular markers described in typing.

[0012] Furthermore, the kit includes a KASP primer pair.

[0013] Furthermore, the KASP primer pair includes two forward primers and one reverse primer, the nucleotide sequences of the forward primers are shown in SEQ ID NO.2 and SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.4.

[0014] The forward primers include forward primer 1 and forward primer 2;

[0015] The nucleotide sequence of forward primer 1 is:

[0016] 5'-GAAGGTGACCAAGTTCATGCTCTACTTTTCAACTTCACTGTCTCCG-3';

[0017] The nucleotide sequence of forward primer 2 is:

[0018] 5'-GAAGGTCGGAGTCAACGGATTCTACTTTTCAACTTCACTGTCTCCA-3';

[0019] The nucleotide sequence of the reverse primer is:

[0020] 5'-GTTATGAAAGAGGTTGAAATGAAGG-3'.

[0021] Technical solution three: Application of the SNP molecular marker or the kit in identification of wax gourd flesh thickness and / or preparation of products for identification of wax gourd flesh thickness.

[0022] The 5' ends of the two forward primers are connected with different fluorescent label sequences of FAM and HEX groups (i.e., the 1st to 21st bases of the forward primers are detection adapter sequences), and the 3' terminal bases are differential SNP sites. The fluorescent groups can be replaced with fluorescent groups commonly used in the art, and the present invention does not make special restrictions.

[0023] Technical solution four: Application of the SNP molecular marker or the kit in wax gourd molecular marker-assisted breeding and / or preparation of wax gourd molecular marker-assisted breeding products.

[0024] Technical Solution 5: Application of the SNP molecular marker or the kit in improving wax gourd germplasm resources and / or preparing products of improved wax gourd germplasm resources.

[0025] Technical Solution 6: A method for identifying wax gourd flesh thickness, comprising the following steps: extracting a wax gourd nucleic acid sample to be tested, using the kit for testing, and determining the wax gourd flesh thickness based on the genotype of the SNP molecular marker.

[0026] Furthermore, if the genotype of the SNP molecular marker of the winter melon to be tested is GG, it is judged to be a winter melon with extremely thick flesh; if the genotype of the SNP molecular marker of the winter melon to be tested is AA, it is judged to be a winter melon with extremely thin flesh; if the genotype of the SNP molecular marker of the winter melon to be tested is GA, it is judged to be a winter melon with medium thickness.

[0027] In some embodiments of the present invention, the reaction procedure of the detection includes: 94°C hot start activation for 15 minutes; 94°C (20sec), 65-57°C (60sec), 0.8°C drop in each cycle, 10 cycles; 94°C (20sec), 57°C (60sec), 32 cycles. After the reaction is completed, the fluorescence signal is read by TECAN infinite M1000 microplate reader, and then the snpdecoder (http: / / www.snpway.com / snpdecoder / ) software is used to analyze and convert the fluorescence signal to present it in the form of a chart. According to the different colors, the genotype results are output to determine the flesh thickness of the wax gourd.

[0028] The present invention discloses the following technical effects:

[0029] The present invention has discovered a SNP molecular marker linked to the major effect QTL of wax gourd flesh thickness, and the SNP molecular marker is located at the position of 1821713bp on chromosome 12 of wax gourd, and its polymorphism is G / A. The wax gourd flesh thickness trait is a quality trait that can only be clearly determined based on cross-section measurement during the commercial maturity period of the fruit. The molecular marker of the present invention can be identified in the early stages of wax gourd seeds or seedlings. In addition, the marker technology can directly detect the phenotypic characteristics of the flesh thickness of commercial fruits without cutting the fruit. The present invention adopts KASP technology to achieve SNP typing and detection through specific matching of primer terminal bases, which has the advantages of high accuracy, low cost and short time. The technology provided by the present invention can be widely used in molecular marker-assisted selection breeding of wax gourd quality, effectively improving the yield of wax gourd products during processing and fresh eating. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0031] Figure 1 The test results of wax gourd flesh thickness; A is the cross-section of the parent wax gourd, and the position marked by the red line frame is the position of the cross-section where the wax gourd flesh thickness is measured; B is the F2 population frequency distribution diagram of wax gourd flesh thickness;

[0032] Figure 2 It is a QTL positioning map for flesh thickness based on SLAF-seq sequencing data and phenotypic data; A is the lod value distribution curve; B is the additive effect and dominant effect curve corresponding to position A;

[0033] Figure 3 The results of the validation of the markers FT_SNP1 and KASP in the F2 population; A is the validation result of the marker FT_SNP1 in the F2 population. As shown in the figure, individuals with extremely thick flesh are clustered near the X-axis (homozygous GG, blue dots), individuals with extremely thin flesh are clustered near the Y-axis (homozygous AA, green dots), and individuals with medium flesh are clustered near the diagonal (heterozygous GA, red dots); B is the frequency distribution of the KASP marker genotype in the F2 population;

[0034] Figure 4 To verify the linked marker SNP_1821713; A is the typing diagram of marker FT_SNP1 in the natural population of wax gourd; B is the box plot of flesh thickness corresponding to the differential marker. DETAILED DESCRIPTION

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0037] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0038] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0039] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0040] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0041] Example 1 Obtaining SNP molecular markers linked to the major QTL for wax gourd flesh thickness

[0042] 1. Construction of genetic population and genetic analysis

[0043] 1.1 Materials and reagents

[0044] The winter melon recombinant inbred line BNH367 (thick flesh) was used as the female parent and B606 (thin flesh) as the male parent. The F1 generation was obtained by hybridization, and then 198 F2 strains were obtained by self-pollination. This population was planted in the experimental field of the Vegetable Research Institute of Guangdong Academy of Agricultural Sciences in the spring of 2021.

[0045] The primers were synthesized by Shanghai Bio-Technology Co., Ltd. and were all PAGE-grade purified.

[0046] 1.2 Analysis of the genetic law of wax gourd flesh thickness

[0047] The thickness of wax gourd flesh is measured with a steel ruler. Measurement location: Cut the middle of the wax gourd fruit horizontally, and measure the length from the cross-section peel to the outer periphery of the ventricle. Repeat the reading three times for each single fruit and calculate the average value. Figure 1 The phenotypic analysis of the fruit flesh thickness of F2 plants revealed that the trait frequency distribution is as follows: Figure 2 As shown, it presents a unimodal normal distribution, which is a typical quantitative trait. It is preliminarily judged that there is a major effect gene.

[0048] 2. QTL positioning of wax gourd flesh thickness trait

[0049] 2.1 Extraction of gene DNA

[0050] The genomic DNA of wax gourd parents and F2 generation was extracted by cetyl trimethylammonium bromide (CTAB) method. The quality and concentration of DNA were detected by 2% agarose gel electrophoresis and diluted to 50-100 ng / μL for later use.

[0051] 2.2 SLAF sequencing and map construction

[0052] High-density molecular tags were developed for the winter melon F2 genetic segregation population (2 parents and 198 offspring) using HighMap software to construct a genetic map. Through the prediction of the winter melon genome, the HaeIII and Hpy166II restriction enzyme combination was selected, and the SLAF tag length was 364-414bp, resulting in 130,480 tags with uniform distribution. Sequencing was performed using the Illumina HiSeq 2500 platform to obtain 621.69Mbp data, with a Q30 of 94.55% and a GC content of 40.26%, with a normal distribution. A total of 617,440 SLAF tags were obtained, of which 79,535 were polymorphic tags, 20,493 of which could be used to construct a genetic map, and the effective polymorphism of the parents was 3.32%. 12 linkage groups were constructed, 4,096 markers, total map distance 1,944.26 cM, average map distance 0.48 cM, marker completeness 99.66%, double exchange ratio 0.01. The sequencing depth of the parents was 22.115x, and that of the offspring was 11.65x.

[0053] 2.3 Preliminary QTL positioning

[0054] QTL association analysis of wax gourd flesh thickness trait was performed to obtain molecular tags closely associated with the trait. Using QTLIciMapping software, the trait was located by composite interval mapping (CIM), and the flesh thickness phenotypic data and genetic map information of the population were analyzed and calculated to obtain the relevant QTL. The number of permutation tests was set to 1000, and the QTL judgment standard was: the LOD value corresponding to the p value less than 0.01 was used as the screening threshold, which is indicated by a dotted line in the figure. The LOD threshold corresponding to the confidence level of 0.99 is 3. Exceeding the threshold is indicated as the linkage positioning interval of the target gene.

[0055] FleshThickness detected a major QTL (FT12.1), located on linkage group LG12, with the starting and ending positions on the genetic map being (5.32-5.59cM), the size of the positioning interval being 0.27cM, and the number of tags in the positioning interval being 3, located between markers Marker5348242 and Marker5235751, with a contribution rate PVE of 8.85% and a LOD value of 4.38. However, on linkage group LG5, there is also a marker site Marker2876633 at 18.095cM on the genetic map, with a corresponding LOD value of 8.05 and a contribution rate of 14.98%, but it has no other linked markers on the flanks. Therefore, the project developed polymorphic SNPs near this marker site Marker2876633 based on the deep resequencing data of the parents, but none of them are closely linked to the trait, so linkage group LG12 is the focus of the next study.

[0056] The major effect QTL (FT12.1) interval on linkage group LG12 was screened for polymorphic markers on this segment based on the deep resequencing data of the parents. Finally, the polymorphic site SNP_1821713 marker located in the gene coding region was screened and linked to the trait. The SNP molecular marker was named FT_SNP1. The SNP molecular marker is located at the position of 1821713bp on chromosome 12 of winter melon. Its polymorphism is G / C. The genome website is http: / / cucurbitgenomics.org / v2 / ftp / genome / WaxGourd / . The nucleotide sequence fragment where the site is located is shown in SEQ ID NO.1. The polymorphism of the 25th base T in the sequence is G / A; thick flesh is G, and thin flesh is A.

[0057] CTACTTTTCAACTTCACTGTCTCCTACCTGTTTGACGAAAATTTCTTAACCTTCATTT CAACCTCTTTCATAACTATTTAGTTTTTATTTTT (SEQ ID NO. 1).

[0058] Example 2 KASP technology is used for genotyping of wax gourd flesh thickness

[0059] Preparation: PrimerMix consisting of two allele forward primers with different terminal bases and one reverse primer, the 5' ends of the two forward primers are respectively connected with different fluorescent label sequences of FAM and HEX groups (that is, the 1st to 21st bases of the forward primer are the detection adapter sequence); 2×PARMS Master mix; DNA template, H2O.

[0060] The specific KASP reaction system is: DNA (10-100 ng), 2×PARMS Master mix (5 μL), primer mix (0.7 μL) [forward primer 1 (0.15 μL), forward primer 2 (0.15 μL), reverse primer (0.4 μL)], H2O (N / A), and the total reaction volume is 10 μL.

[0061] KASP reaction program: hot start activation at 94°C for 15 min; 94°C (20 sec), 65-57°C (60 sec), decrease 0.8°C in each cycle, 10 cycles; 94°C (20 sec), 57°C (60 sec), 32 cycles.

[0062] PCR reaction I: the denatured template binds and anneals with the matching primers in the Primer Mix, and the detection adapter sequence is added to the extended sequence;

[0063] PCR reaction II: synthesis of complementary strands of allele-specific terminal sequences;

[0064] PCR reaction III: signal generation - the detection sequence corresponding to the specific sequence grows exponentially with the PCR reaction, and the corresponding signal is detected.

[0065] The present invention relates to a SNP molecular marker KSAP primer pair linked to a major effect QTL of wax gourd flesh thickness. The KSAP primer pair comprises two forward primers 1 and 2 and a reverse primer. The nucleotide sequences of the KSAP primer pair are as follows:

[0066] Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTCTACTTTTCAACTTCACTGTCTCCG-3' (SEQ ID NO. 2), wherein the 1st to 21st bases are the detection linker sequence (fluorescent label sequence of the FAM group);

[0067] Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTCTACTTTTCAACTTCACTGTCTCCA-3' (SEQ ID NO. 3), wherein the 1st to 21st bases are the detection linker sequence (fluorescent tag sequence of the HEX group);

[0068] Reverse primer: 5'-GTTATGAAAGAGGTTGAAATGAAGG-3' (SEQ ID NO. 4).

[0069] After PCR, the fluorescence signal was read using a TECAN infinite M1000 microplate reader, and then the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was used to analyze and convert the fluorescence signal to obtain a clear and intuitive typing diagram, and the genotype results were output according to different colors. The chart is divided into X and Y axes, and each data point represents an independent DNA sample. Samples with the same genotype are clustered together and show the same color. Those close to the X and Y axes are homozygous genotypes (blue dots FAM, green dots HEX), and those close to the diagonal position are heterozygous genotypes (red dots FAMHEX). The genotype of thick flesh (female parent) is G, which is close to the X axis (blue dots FAM), and the genotype of thin flesh (male parent) is A, which is close to the Y axis (green dots HEX). The group typing results show that individuals with extremely thick flesh are clustered near the X axis (homozygous GG, blue dots), and individuals with extremely thin flesh are clustered near the Y axis (homozygous AA, green dots). Most of the flesh thickness indices at the intermediate level were clustered near the diagonal line (heterozygous GA, red dots), proving that this marker was linked to the trait.

[0070] The results of the F2 generation population verification are as follows Figure 3 As shown, Figure 3 A in the figure is the validation result of marker FT_SNP1 in the F2 generation population. Individuals with extremely thick flesh are clustered near the X-axis (homozygous GG, blue dots), individuals with extremely thin flesh are clustered near the Y-axis (homozygous AA, green dots), and individuals with medium thickness are clustered near the diagonal (heterozygous GA, red dots). Figure 3 B is the frequency distribution of differential genotypes of KASP marker in F2 population.

[0071] Example 3 Validation of linked SNP markers in a natural population of wax gourd

[0072] 43 high-generation inbred lines of wax gourd with rich field flesh thickness polymorphism and distant genetic background were selected, and the flesh thickness was measured with a steel ruler. The measurement position was the length from the cross-section of the pericarp to the periphery of the ventricle, and there were three biological replicates. The flesh thickness ranged from 3.47 cm to 6.48 cm, and the coefficient of variation was 0.15. The accuracy of the SNP markers in Example 1 for molecular marker-assisted selection was determined by population validation. The linkage marker SNP_1821713 was validated, and the natural population typing results are shown in Figure 4 A in , and the correlation between markers and phenotypes can be found in Figure 4 B, box plot results show that the flesh thickness of FAM marker type (GG, homozygous, blue dots) is higher than that of HEX marker type (AA, homozygous, green dots), and the flesh thickness of FAMHEX marker type (GA, heterozygous, red dots) is in the middle, which proves that the SNP markers provided in the example are closely linked to the wax gourd flesh thickness trait.

[0073] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A SNP molecular marker linked to the major QTL of wax gourd flesh thickness, characterized in that: The SNP molecular marker is located at the position of 1821713bp on chromosome 12 of wax gourd, and its polymorphism is G / A.

2. The SNP molecular marker according to claim 1, characterized in that: The SNP molecular marker is located at the 25th base from the 5' end of the sequence shown in SEQ ID NO.

1.

3. A kit, characterized in that: The kit is used for detecting the SNP molecular markers described in claim 1 or 2.

4. The kit according to claim 3, characterized in that The kit includes a KASP primer pair.

5. The kit according to claim 4, characterized in that The KASP primer pair includes two forward primers and one reverse primer. The nucleotide sequences of the forward primers are shown in SEQ ID NO.2 and SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

4.

6. Use of the SNP molecular marker described in claim 1 or 2 or the kit described in any one of claims 3 to 5 in identifying wax gourd flesh thickness and / or preparing a product for identifying wax gourd flesh thickness.

7. Use of the SNP molecular marker according to claim 1 or 2 or the kit according to any one of claims 3 to 5 in wax gourd molecular marker-assisted breeding and / or preparation of wax gourd molecular marker-assisted breeding products.

8. Use of the SNP molecular marker according to claim 1 or 2 or the kit according to any one of claims 3 to 5 in improving wax gourd germplasm resources and / or preparing products of improved wax gourd germplasm resources.

9. A method for identifying the thickness of wax gourd pulp, characterized in that: The following steps are involved: Extract the wax gourd nucleic acid sample to be tested, use the kit described in any one of claims 3 to 5 for testing, and judge the wax gourd flesh thickness according to the genotype of the SNP molecular marker.

10. The method according to claim 9, characterized in that If the genotype of the SNP molecular marker of the winter melon to be tested is GG, it is judged to be a winter melon with extremely thick flesh; if the genotype of the SNP molecular marker of the winter melon to be tested is AA, it is judged to be a winter melon with extremely thin flesh; if the genotype of the SNP molecular marker of the winter melon to be tested is GA, it is judged to be a winter melon with medium thickness.

Images