A method for constructing a bacterial sensor that senses iron and magnesium ions and its application.

By constructing a recombinant E. coli sensor and utilizing sfGFP and multiple protein expression systems, the problem of detecting iron ion concentration in organisms was solved, achieving high-sensitivity detection of iron ions and enhancing bacterial drug resistance.

CN119776251BActive Publication Date: 2025-10-28INST OF MICROBIOLOGY CHINESE ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510001510.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-02
Publication Date
2025-10-28
Estimated Expiration
2045-01-02

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively monitor the concentration of iron ions in organisms, leading to increased drug resistance and pathogenicity of bacteria in high-iron environments. Furthermore, there is a lack of biological methods for detecting iron ions.

Method used

Recombinant Escherichia coli was constructed as a bacterial sensor. By expressing superfolded green fluorescent protein sfGFP, a mutant of the sensing protein PmrB, a mutant of the response regulatory protein PmrA, the signal transduction protein PmrD, and the phosphoethanolamine transferase EptA, combined with the modification of T7 RNA polymerase and strong ribosome binding sites, the concentration of iron ions was detected.

Benefits of technology

It achieves sensitive detection of iron ions from 50 to 300 μM, enhances bacterial resistance to polymyxin B, and enhances the sensor's resistance through magnesium ion sensing, providing a solution for monitoring iron ions using a biological method.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention discloses a method for constructing a bacterial sensor that senses iron and magnesium ions and its application. This invention belongs to the field of microbiology, specifically relating to a method for constructing a bacterial sensor that senses iron and magnesium ions and its application. Recombinant *Escherichia coli* contains a gene encoding a superfolded green fluorescent protein (sfGFP), a mutant gene encoding a sensor protein (PmrB), a mutant gene encoding a response regulatory protein (PmrA), a gene encoding a signal transduction protein (PmrD), and a strong ribosome binding site (RBS). It also contains a T7 RNA polymerase gene driven by the promoter of the phosphorylase PmrG activated by the regulatory protein PmrA, and a T7 promoter-driven sfGFP gene, while simultaneously overexpressing the gene encoding the phosphorylethanolamine transferase (EptA). This invention constructs a bacterial sensor for detecting iron ion concentration, and the modification of the lipopolysaccharide in the bacterial sensor can be altered by the induction of iron and magnesium ions, thereby enhancing bacterial drug resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbiology, specifically relating to a method for constructing a bacterial sensor that senses iron and magnesium ions and its application. Background Technology

[0002] Iron is an essential nutrient for all living organisms, and key metabolic processes rely on it. However, excessive iron is extremely harmful because it reacts with oxygen to form hydroxyl radicals, which, when accumulated, damage macromolecules and ultimately lead to cell death. Many gut bacteria sense extracellular iron ions through a two-component system (TCS) on their cell membranes and regulate the transcriptional expression of a series of genes within the cell via signal transduction. This not only enables bacteria to resist oxidative stress and avoid iron poisoning in high-iron environments but also increases the positive charge modification of bacterial lipopolysaccharide (LPS), preventing polypeptide antibiotics from cleaving the cell membrane and thus enhancing gut bacteria's resistance to polymyxins. Simultaneously, it helps bacteria evade the host's immune system, alters inflammatory responses, reduces host clearance of bacteria, and further enhances bacterial pathogenicity. Moreover, imbalances in iron homeostasis cause changes in the gut microbiota, which are closely related to the development of metabolic diseases. Therefore, monitoring the concentration of iron ions in the body is crucial, as it predicts changes in bacterial drug resistance and pathogenicity.

[0003] LPS consists of three parts: lipid A, core oligosaccharide, and O-polysaccharide antigen. Figure 1 Lipid A inserts into the outer membrane, connecting to the core oligosaccharide, while the O-polysaccharide is located on the outermost side. Lipid A is the most important endotoxin in bacteria, composed of acetylated fatty acid chains linked to β-(1-6')-disglucosamine, with phosphate groups modified at positions 1 and 4'. Figure 1 (B) The structure of lipid A is relatively conserved, but it is sometimes modified by positively charged compounds. Figure 1 (B). Escherichia coli senses high concentrations of iron ions in the external environment through a two-component system PmrA-PmrB. Figure 2 The two-component system consists of a histidine kinase sensor protein (HK) located on the cell membrane and a response regulator protein (RR) located in the cytoplasm. The former senses one or more stimuli from the external environment; the kinase is activated, leading to phosphorylation of the response regulator protein. The phosphorylated response regulator protein binds to the promoters of a series of bacterial genes, promoting their expression. High concentrations of iron ions and low pH can induce activation of the sensor protein PmrB, leading to phosphorylation of the response regulator protein PmrA, which then binds to the pmm operon (containing…). eptA, pmrA, pmrB, pmrR (genes) and ARN operons (containing) arnT , arnB promoter regions of genes such as [genes] and other genes. eptC , pmrG , ugd At the promoters of these genes, the expression of these genes is activated to produce enzymes. EptA is a phosphoethanolamine (pEtN) transferase, and ArnT is a 4-amino-4-deoxy-L-arabinose (L-Ara4N) transferase. They link positively charged phosphoethanolamine or L-Ara4N to two glucosamine groups of lipid A, preventing the attachment of phosphate groups, thereby increasing the positive charge and decreasing the negative charge of LPS. Simultaneously, another two-component system, PhoQ-PhoP, can activate the sensor protein PhoQ under low magnesium ion concentrations and low pH conditions, leading to phosphorylation of another intracellular response regulatory protein, PhoP, and activation. pmrD Regarding gene expression, it has not yet been confirmed that the PmrD protein in *E. coli* promotes PmrA phosphorylation, but it has been shown that the PmrD protein in *Salmonella* promotes PmrA phosphorylation, linking these two two-component systems. Because LPS is located on the bacterial surface, the increased positive charge on the bacterial surface repels external cationic cyclic lipopeptide antibiotics (CAMPs) such as polymyxin B, preventing CAMP insertion and lysis of the cell membrane, thus enhancing bacterial resistance. Summary of the Invention

[0004] The main problem this invention aims to solve is how to detect iron ions in the environment using biological methods.

[0005] To address the aforementioned problems, this invention provides a recombinant Escherichia coli that can be used as a bacterial sensor for detecting iron ion concentration.

[0006] The recombinant Escherichia coli provided by this invention contains a superfolded green fluorescent protein sfGFP encoding gene, a sensor protein PmrB mutant encoding gene, a response regulatory protein PmrA mutant encoding gene, a signal transduction protein PmrD encoding gene, and a strong ribosome binding site RBS. It also contains a T7 RNA polymerase encoding gene regulated by the promoter of the PmrA-activated phosphorylase PmrG and a superfolded green fluorescent protein sfGFP encoding gene regulated by the T7 promoter, and simultaneously overexpresses the phosphorylethanolamine transferase EptA encoding gene.

[0007] In the above-mentioned recombinant Escherichia coli, the superfolded green fluorescent protein sfGFP can be any of the following proteins:

[0008] A1) The amino acid sequence is SEQ ID No:1;

[0009] A2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in A1), which has more than 80% identity with the protein shown in A1).

[0010] A3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2);

[0011] The PmrB mutant of the sensory protein can be any of the following proteins:

[0012] B1) The amino acid sequence is SEQ ID No:2;

[0013] B2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in B1), which has more than 80% identity with the protein shown in B1).

[0014] B3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of B1) or B2);

[0015] The PmrA mutant of the response regulatory protein can be any of the following proteins:

[0016] C1) The amino acid sequence is SEQ ID No:3;

[0017] C2) A protein obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence shown in C1), which has more than 80% identity with the protein shown in C1).

[0018] C3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of C1) or C2);

[0019] The signal transduction protein PmrD can be any of the following proteins:

[0020] D1) The amino acid sequence is SEQ ID No:4;

[0021] D2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in D1) that has more than 80% identity with the protein shown in D1).

[0022] D3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of D1) or D2);

[0023] The T7 RNA polymerase may be any of the following proteins:

[0024] E1) The amino acid sequence is SEQ ID No: 14;

[0025] E2) A protein with more than 80% identity to the protein shown in E1) obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in E1).

[0026] E3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of E1) or E2);

[0027] The phosphoethanolamine phosphotransferase EptA can be any of the following proteins:

[0028] F1) Its amino acid sequence is SEQ ID No:13;

[0029] F2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in F1) that has more than 80% identity with the protein shown in F1).

[0030] F3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of F1) or F2).

[0031] In the aforementioned recombinant Escherichia coli, the PmrD is derived from the PmrD of Salmonella, and its amino acid sequence may be SEQ ID No:4. pmrD The nucleotide sequence of *E. coli* has been codon-optimized, and its nucleotide sequence is SEQ ID No:9. The nucleotide sequence of *E. coli*... pmrD Replaced with Salmonella pmrD It enables E. coli to sense low concentrations of magnesium ions through the PhoP / PhoQ two-component system, enhancing... pmrA The expression.

[0032] The recombinant *E. coli* contains a T7 RNA polymerase expression cassette, which contains... pmrG promoter and pmrG The promoter-driven gene encoding the T7 RNA polymerase, the pmrG The nucleotide sequence of the promoter can be SEQ ID No:10, and the nucleotide sequence of the T7 RNA polymerase encoding gene can be the sequence located at positions 750421-753072 in the *Escherichia coli* BL21(DE3) genome (GenBank No. CP001509.3; updated February 6, 2017). The nucleotide sequence of the expression cassette of the T7 RNA polymerase gene and its PmrG promoter is SEQ ID No:11.

[0033] The recombinant *E. coli* contains a superfolded green fluorescent protein (sfGFP) expression cassette. The sfGFP expression cassette contains a T7 promoter and an sfGFP encoding gene driven by the T7 promoter. The aforementioned T7 RNA polymerase binds to the T7 promoter on the vector to initiate sfGFP expression. The nucleotide sequence of the T7 promoter is 5'-TAATACGACTCACTATAGG-3', and the sfGFP encoding gene sequence may be SEQ ID No:6. The nucleotide sequence of the sfGFP gene and its promoter expression cassette is SEQ ID No:12.

[0034] The recombinant Escherichia coli contains an eptA expression cassette, which contains an eptA coding gene sequence. The eptA coding gene sequence may be the sequence located at c4333947-4335590 in the genome of Escherichia coli MG1655 (GenBank: U00096.3; updated November 6, 2024).

[0035] The expression of the eptA-encoding gene is driven by the araBAD promoter on the vector.

[0036] Furthermore, in the above-mentioned recombinant Escherichia coli, the nucleotide sequence of the superfolded green fluorescent protein sfGFP encoding gene is SEQ ID No:6;

[0037] The nucleotide sequence of the gene encoding the PmrB mutant sensory protein is SEQ ID No:7;

[0038] The nucleotide sequence of the gene encoding the PmrA mutant response regulatory protein is SEQ ID No:8;

[0039] The nucleotide sequence of the gene encoding the signal transduction protein PmrD is SEQ ID No:9;

[0040] The nucleotide sequence of the promoter of the phosphorylase PmrG is SEQ ID No:10;

[0041] The nucleotide sequence of the T7 RNA polymerase encoding gene is the sequence located at 750421-753072 in the Escherichia coli BL21(DE3) genome (GenBank: CP001509.3; updated February 6, 2017);

[0042] The nucleotide sequence of the phosphoethanolamine phosphotransferase eptA encoding gene is the sequence located at c4333947-4335590 in the genome of Escherichia coli MG1655 (GenBank: U00096.3; updated November 6, 2024).

[0043] The recombinant Escherichia coli described above is constructed using the following method, which includes:

[0044] 1) The recipient E. coli as described above pmrA and pmrB Genes are mutated and modified;

[0045] 2) The superfolded green fluorescent protein (sfGFP) encoding gene described above was introduced into the recipient *E. coli*. pmrA and pmrB Between genes;

[0046] 3) The recipient E. coli mentioned above pmrD Replaced with Salmonella pmrD ;

[0047] 4) Replace the ribosome binding site of the pmr operon of the recipient E. coli mentioned above with a strong RBS site;

[0048] 5) The expression of T7 RNA polymerase in the aforementioned receptor *E. coli* is regulated using the response regulatory protein PmrA; specifically, the regulation may involve regulating the promoter of T7 RNA polymerase, which may be... pmrG The promoter;

[0049] 6) The expression of the sfGFP encoding gene is regulated by the T7 RNA polymerase described in 5), and the regulation may specifically be the regulation of the sfGFP promoter, wherein the sfGFP promoter is the T7 promoter;

[0050] 7) Overexpression of the receptor E. coli described above eptA Gene.

[0051] In this invention, the recipient Escherichia coli is Escherichia coli MG1655.

[0052] The present invention also provides for the application of the methods described above in any of the following ways:

[0053] 1) Preparation of a bacterial sensor that senses iron and magnesium ions;

[0054] 2) Prepare products for detecting the concentration of iron ions in the environment;

[0055] 3) Obtain E. coli lipopolysaccharide endotoxin with increased positive charge modification;

[0056] 4) Increase bacterial resistance to polymyxin B.

[0057] The present invention also provides the use of the aforementioned Escherichia coli in any of the following:

[0058] 1) Preparation of a bacterial sensor that senses iron and magnesium ions;

[0059] 2) Detect the concentration of iron ions in the environment.

[0060] The present invention also provides a method for preparing a bacterial sensor that senses iron and magnesium ions, comprising culturing the recombinant Escherichia coli described above and centrifuging the fermentation product to obtain the bacterial sensor.

[0061] The bacterial sensor can detect iron ions in the range of 50-300 μM. Within this range, the higher the iron ion concentration, the stronger the fluorescence of the bacteria.

[0062] The bacterial sensor can also detect magnesium ions up to 10 μM.

[0063] This invention utilizes CRISPR / Cas9 editing technology to genetically modify the two-component system PmrA-PmrB of Escherichia coli, constructing a fluorescent bacterial sensor. The circuit diagram is shown below. Figure 3 As shown. Using *E. coli* MG1655 as the chassis cell, the superfolded green fluorescent protein (sfGFP) gene was integrated into the pCas / pTargetF double plasmid. pmr manipulator pmrA and pmrB The strain MG1655::sfGFP was obtained through gene exchange. At 300... μ The strain only emitted weak fluorescence under the induction of M iron ions.

[0064] To improve the sensitivity of the sensor, pmrB and pmrA Point mutations were performed at multiple sites to enhance... PmrB The binding of iron ions and PmrA Signal transduction; simultaneously, the E. coli pmrD Replace with Salmonella pmrD This allows E. coli to sense low concentrations of magnesium ions through the PhoP / PhoQ two-component system, enhancing... pmrA The expression; and will pmr The ribosome-binding site (RBS) of the operon was replaced with a strong RBS site to obtain the genetically engineered strain MG-WY5. Finally, plasmids pBAD-EptA and pT7RNAP-sfGFP were constructed and transformed into strain MG-WY5 to increase the expression levels of EptA and sfGFP, obtaining the final biosensor MG-WY5(pBAD-EptA, pT7RNAP-sfGFP). This biosensor can detect 50-300... μFor iron ions in M, within this range, the higher the iron ion concentration, the stronger the bacterial fluorescence; further, it was found that at 300... μ M iron ions and 10 μ Under the induction of magnesium ions, the bacteria’s resistance to polymyxin B was significantly enhanced, almost 100 times that of MG1655::sfGFP; the chemical structure of lipid A of the bacterial sensor LPS was detected by MULTI-TOF-MS, and the results showed that the diglucosamine of lipid A was modified by phosphate ethanolamine (pEtN) and L-Ara4N.

[0065] This invention discloses a method for constructing a bacterial sensor for detecting iron ion concentration. By inducing iron ions and low magnesium ions, the lipopolysaccharide modification of the bacterial sensor can be altered, thereby enhancing the antibiotic resistance of bacteria. Attached Figure Description

[0066] Figure 1 The structure of LPS and the modification of lipid A are described. A. Lipopolysaccharide LPS consists of three parts: lipid A, core oligosaccharide, and O-antigen; B. The 1' and 4' positions of the diglucosamine of lipid A are modified with phosphate ethanolamine (pEtN) or 4-amino-4-deoxy-L-arabinose (L-Ara4N).

[0067] Figure 2 This demonstrates how E. coli senses signals from external sources, such as iron and magnesium ions, through a two-component system, PmrA-PmrB and PhoQ-PhoP.

[0068] Figure 3 A circuit diagram for constructing a bacterial sensor that senses iron and magnesium ions.

[0069] Figure 4 The plasmid maps for constructing bacterial sensors are shown. A represents the map of plasmid pBAD-EptA; B represents the map of plasmid pT7RNAP-sfGFP.

[0070] Figure 5To detect iron ion concentration using a bacterial sensor, the following steps were performed: A) Observing bacterial luminescence induced by different concentrations of iron ions using a fluorescence microscope; B) Detecting and analyzing the fluorescence intensity of bacteria induced by different concentrations of iron ions using flow cytometry, with an accurate detection range of 50-300 μM; C) Detecting the fluorescence intensity of the bacterial sensor induced by different concentrations of iron ions using an ELISA reader, with an accurate detection range of 50-300 μM; D) Inducing bacterial luminescence with ferric chloride at final concentrations of 0 μM, 1 μM, 10 μM, 25 μM, 50 μM, 100 μM, and 300 μM, obtaining fluorescence values, constructing a standard curve using GraphPad_Prism software, and fitting the data with a nonlinear regression curve to obtain the Hill equation formula. Here, Y represents the fluorescence signal, and X is the logarithmic value of the ferric chloride concentration. The iron ion concentration in the sample can be calculated based on the standard curve formula and the fluorescence intensity of the sample.

[0071] Figure 6 This study aims to analyze the resistance of bacterial sensors to polymyxin B before and after induction.

[0072] Figure 7 Chemical structure analysis of lipid A in a bacterial sensor. Detailed Implementation

[0073] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0074] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0075] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0076] The *E. coli* strain MG1655 described in the following examples is described in the literature “Cas9-Assisted Targeting of Chromosome segments CATCH enables one-step targeted cloning of large geneclusters. *Nature Communications*, 2015, DOI: 10.1038 / ncomms9101.”. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and should not be used for any other purpose.

[0077] The plasmids pCas and pTargetF used in the following examples are described in the literature "Yu Jiang, Biao Chen, Chunlan Duan, Bingbing Sun, Junjie Yang, Sheng Yang. Multigene Editing in the Escherichia coli The biological material is available to the public from the applicant and is intended solely for the purpose of replicating experiments of this invention and may not be used for any other purpose. (See: Genome via the CRISPR-Cas9 System. Applied and Environmental Microbiology, 2015, 81(7):2506-2514).

[0078] The plasmid pPAS used in the following examples is described in the literature "Xuejin Zhao, Weijia Wei, YeqingZong, Chaoxian Bai, Xian Guo, Hua Zhu, Chunbo Lou. Novel switchable ECF sigmafactor transcription system for improving thaxtomin A productionin Streptomyces The biological material is available to the public from the applicant and is intended solely for the purpose of replicating experiments of this invention and may not be used for any other purpose. (See Synthetic and Systems Biotechnology, 2022, 7: 972-981).

[0079] The *Escherichia coli* BL21(DE3) described in the following examples is described in the literature “Sinyeon Kim, Haeyoung Jeong, Eun-Youn Kim, Jihyun F. Kim, Sang Yup Lee and Sung Ho Yoon, Genomic and transcriptomic landscape of *Escherichia coli* BL21(DE3). Nucleic Acids Research, 2017, 45(9): 5285–5293”. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.

[0080] The basic culture medium formulations in the following examples are shown in Table 1. The pH was adjusted to 7.2 or 5.8 with HCl and filtered through a 0.22 μM aqueous filter membrane. When preparing solid culture media, 15 g of agar powder was added to each liter of liquid culture medium and then sterilized at 121°C for 20 min.

[0081] Table 1. Basic Culture Medium Formulation

[0082]

[0083] Preparation of ferric chloride solution in the following examples: FeCl3·6H2O was prepared into a 100mM stock solution with purified water, boiled until completely dissolved, cooled to room temperature, and then diluted to volume with 0.22... μM Use the filter membrane for filtration.

[0084] Preparation of magnesium chloride solution in the following examples: MgCl2·6H2O was dissolved in purified water to prepare a 10 mM stock solution, and after complete dissolution, the volume was adjusted to a final volume using 0.22... μM Use the filter membrane for filtration.

[0085] Example 1: Construction of a fluorescent bacterial sensor

[0086] The codon-optimized strong green fluorescent reporter gene sfGFP was inserted into the prmrA gene of the prmr operon in the genome using CRISPR / Cas9 technology to obtain the engineered strain MG1655::sfGFP. The specific procedure is as follows:

[0087] 1. Obtain strain MG1655 (pCas) containing plasmid pCas.

[0088] Electrocompetent cells of *E. coli* MG1655 were prepared using standard methods. The plasmid pCas was then transformed into the competent cells via electroporation. Transformants were screened using LB agar containing 50 μg / mL kanamycin. Colony PCR was performed using primer pairs pCas-check-F and pCas-check-R to verify whether the plasmid had been transformed into the bacteria. An MG1655 strain containing plasmid pCas was obtained and named MG1655(pCas). pCas-check-F: 5'-gagatggcgaaagtagatgatagtttct-3'; pCas-check-R: 5'-aagctgtaatttagcatcttctgcc-3'.

[0089] The strain was then cultured overnight at 30°C for approximately 12 hours in 3 mL LB liquid medium containing 50 μg / mL kanamycin. The bacterial suspension was then transferred 1:100 to fresh LB liquid medium and cultured until OD (Organic Discharge). 600nm Add L-arabinose to a final concentration of 10 mM, and continue culturing the bacteria until the OD value is 0.2-0.3. 600nm The concentration was 0.5-0.6 to induce the expression of Cas9 endonuclease (GenBank ID: WP_011285506.1) in the pCas plasmid. Then, electrocompetent cells of strain MG1655 (pCas) were prepared according to conventional methods.

[0090] 2. Obtaining engineered strain MG-WY1

[0091] The sfGFP gene, codon-optimized based on E. coli, was inserted into the MG1655 genome. pmrA and pmrB Between genes, strain MG-WY1 was obtained. The nucleotide sequence of sfGFP is SEQ ID No:1.

[0092] (1) Obtaining donor DNA fragments

[0093] In respectively sfGFP Primers were designed upstream and downstream of the gene insertion site. Using the genome of MG1655 as a template, the upstream fragment was amplified with primer pair pmrA1 / pmrA2, and the downstream fragment was amplified with primer pair pmrA5 / pmrA6. Both fragments were 500bp in size.

[0094] Simultaneously, using pPAS as a template, primer pairs were used to amplify pmrA3 / pmrA4. sfGFPThe gene fragment, 717 bp in size, was amplified using KOD FX high-fidelity DNA polymerase (TOYOBO Bio-Technology, CO., LTD, catalog number KFX-101), and the PCR product was purified using a kit. The three fragments were then used as templates for fusion PCR as donor DNA. Specific primer sequence information is as follows:

[0095] pmrA1: 5'-GAAGGCTACGCGTGCGATAG-3';

[0096] pmrA2: 5'-ACAGCTCTTCGCCTTTACGCATCAGATTCAATTAGTTTTCCTCAT-3';

[0097] pmrA3: 5'-ATGAGGAAAACTAATTGAATCTGATGCGTAAAGGCGAAGAGCTGT-3';

[0098] pmrA4: 5'-TTGGTCGGCGCAGAAAATGCATTCATTTGTACAGTTCATCCAT-3';

[0099] pmrA5: 5'-TATGGATGAACTGTACAAATGAATGCATTTTCTGCGCCGACCAAT-3';

[0100] pmrA6: 5'-AATAGCAGGGTTTGCTGTCGCT-3'.

[0101] (2) Constructing plasmid pTargetF-gfpN20

[0102] Using plasmid pTargetF as a template, circular PCR was performed with primer pair pmrA-N1 / pmrA-N2 to obtain the circular PCR product, which was then transformed into E. coli DH5α competent cells (Tiangen Biotech Co., Ltd., catalog number CB101). Transformants were screened using LB medium containing 100 μg / mL spectinomycin, and the plasmid was extracted using a kit (Tiangen Biotech Co., Ltd., catalog number DP103-03). The DNA sequence was identified by PCR using primer pair N20-Check-F / N20-Check-R and sequenced to obtain plasmid pTargetF-gfpN20.

[0103] The structure of the pTargetF-gfpN20 vector is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence 5'-ACGGCTGATATTGACCATCG-3' between the 5'-gtcctaggtataatactagt-3' and 5'-gttttagagctagaaatagc-3' fragments of the starting vector pTargetF, while keeping the other sequences of the vector pTargetF unchanged.

[0104] The N20 sequence of the sgRNA was designed into the primers and marked with an underline:

[0105] pmrA-N1:5'- ACGGCTGATATTGACCATCG GTTTTAGAGCTAGAAATAGCAAG-3';

[0106] pmrA-N2: 5'- CGATGGTCAATATCAGCCGT ACTAGTATTATACCTAGGACTGAGC-3';

[0107] N20-Check-F: 5'-TTATCCCCTGATTCTGTGGATAACCG-3';

[0108] N20-Check-R: 5'-CTGATGGAGCTGCACATGAAC-3'.

[0109] (3) Obtain strain MG-WY1

[0110] The pTargetF-gfpN20 obtained in step (2) and the donor DNA obtained in step (1) were mixed at a ratio of 1:4 and added to MG1655 (pCas) electroporation competent cells for electroporation. Immediately after electroporation, 1 mL of LB medium containing 50 μg / mL kanamycin was added, and the cells were cultured at 30°C for 1 h. Then, 100 μL of the bacterial culture was spread on LB plates containing 50 μg / mL kanamycin and 100 μg / mL spectinomycin and cultured overnight at 30°C. Single colonies were identified by colony PCR using the primer pair described below. sfGFP The gene insertion and two plasmids were confirmed by sequencing. sfGFP Genes are integrated and inserted into pmrA Downstream of the gene. This strain was named MG1655::sfGFP(pCas,pTargetF-gfpN20).

[0111] in sfGFPGene insertion was identified using pmrA--check-F / pmrA-heck-R, plasmid pTargetF-gfpN20 was identified using pTF-check-F / pTF-check-R, and plasmid pCas was identified using pCas-check-F / pCas-check-R. Specific primer sequences are as follows:

[0112] pmrA-check-F: 5'-GCTATATGCTGGTCGCGAATGAGGAAAAC-3';

[0113] PmrA-check-R: 5'-AGCGATATTGGTCGGCGCAGAAAA-3';

[0114] pTF-check-F: 5'-GGGGATGATAAGTTTATCACCACCGA-3';

[0115] pTF-check-R: 5'-GGCAACGCTATGTTCTCTTGC-3';

[0116] pCas-check-F: 5'-GAGATGGCGAAAGTAGATGATAGTTTCT-3';

[0117] pCas-check-R: 5'-AAGCTGTAATTTAGCATCTTCTGCC-3'.

[0118] (4) Plasmid pTargetF-gfpN20 is lost

[0119] The plasmid pTargetF-gfpN20 was lost according to the method described in the literature (Applied and Environmental Microbiology, 2015, 81(7): 2506-2514). The specific method is as follows: Bacteria were cultured at 30°C for 16 hours in LB liquid medium containing 50 µg / mL kanamycin and 1 mM IPTG to induce the loss of the plasmid. The bacteria were diluted and spread on LB solid medium containing 50 µg / mL kanamycin for further culture. Single colonies were picked and spotted at the corresponding positions on LB solid plates containing kanamycin and spectinomycin, and the bacteria were cultured at 30°C. Corresponding colonies that did not grow on streptomycin plates but grew on kanamycin plates were selected, and PCR was performed using primer pairs pTF-check-F and pTF-check-R to verify whether the plasmid pTargetF-gfpN20 was lost, resulting in a strain MG1655::sfGFP(pCas) containing only plasmid pCas, which was used for subsequent genetic modification of the genome.

[0120] Finally, the temperature-sensitive plasmid pCas was lost. The specific method is as follows: Bacteria MG1655::sfGFP (pCas) were cultured overnight at 37℃. Single colonies were spotted at corresponding positions on plates without antibiotics and plates containing 50 µg / mL kanamycin. The bacteria were cultured at 37℃ for a further period. Colonies that grew on plates without antibiotics but not on kanamycin plates were selected. Colony PCR was performed using primer pairs pCas-check-F and pCas-check-R to verify whether the plasmid pCas was lost. Finally, strain MG-WY1 was obtained.

[0121] Example 2: Optimization of Bacterial Sensors

[0122] 1. To pmrB Gene point mutation

[0123] (1) Obtaining point-mutated fusion DNA fragments

[0124] To mutate the 14th amino acid leucine (L) to arginine (R) in the PmrB protein, mutate the 93rd amino acid arginine (R) to proline (P), and mutate the 206th amino acid glycine (G) to aspartic acid (D), it is necessary to change CTG to CGG, CGC to CCC, and GGT to GAT in the pmrB gene sequence. The mutated nucleotide sequence of the PmrB protein is shown in SEQ ID No:7.

[0125] The specific method is as follows: [The above...] pmrB The mutation sites were designed into primers. Using genomic DNA of MG1655 as templates, PCR amplification was performed using primers PmrB-1 / PmrB-2 and PmrB-3 / PmrB-4 to obtain PCR products 1 and 2. After purifying PCR products 1 and 2, they were used as templates to obtain fusion PCR product A using primer pair PmrB-1 / PmrB-4.

[0126] Using MG1655 as a template, PCR amplification was performed using primer pairs PmrB-5 / PmrB-6 and PmrB-7 / PmrB-8 to obtain PCR products 3 and 4. The purified PCR products were then used as templates to obtain fusion PCR product B using primer pair PmrB-5 / PmrB-8. The specific primer sequences are as follows:

[0127] PmrB-1: 5'-TCTGCGCGACAAAGTGGGCAAA-3';

[0128] PmrB-2: 5'-TCTTTTTTGCAGCTCCGCCAGCGGGGGGGTGATGCGGCGTACCGCCTGATAGCAG-3';

[0129] PmrB-3: 5'-TCAGGCGGTACGCCGCATCACCCCCCCGCTGGCGGAGCTGCAAAAAGAGCT-3';

[0130] PmrB-4: 5'-CGCTGGTCGAGCATGGTACTGAG-3';

[0131] PmrB-5: 5'-CAGCCTGACGCTATTTATCTGCTATCAGG-3';

[0132] PmrB-6: 5'-CAGCAGTTTTTACATGTTGATAATTATCGGAAGAAAATGACTGTCCGGCACGCGCCAG-3';

[0133] PmrB-7: 5'-GCGTGCCGACAGTCATTTTCTTCCGATAATTATCAACATGTAAAACTGCTGGAAGAT-3';

[0134] PmrB-8: 5'-GTACCCAGGCCCGCGTGCCGGAAGTCT-3'.

[0135] (2) Constructing plasmid pTargetF-pmrN20

[0136] The N20 sequence (5'-CATCATGCGTGAGATCCGCG-3') was designed into primers PmrB-N1 and PmrB-N2 (underlined). Circular PCR was performed using plasmid pTargetF as a template. The circular PCR product was then transformed into *E. coli* DH5α competent cells, and transformants were screened using LB medium containing spectinomycin (100 µg / mL). Plasmid extraction and identification were performed as described in step 2 of Example 1. The plasmid was sequenced to verify its identity and named plasmid pTargetF-pmrN20.

[0137] The structure of plasmid pTargetF-pmrN20 is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence 5'-CATCATGCGTGAGATCCGCG-3' between the 5'-gtcctaggtataatactagt-3' and 5'-gttttagagctagaaatagc-3' fragments of the starting vector pTargetF, while keeping the other sequences of the vector pTargetF unchanged. The specific primer sequences are as follows, where the N20 sequence is underlined:

[0138] PmrB-N1: 5'- CATCATGCGTGAGATCCGCG GTTTTAGAGCTAGAAATAGCAAG-3';

[0139] PmrB-N2: 5'- CGCGGATCTCACGCATGATG ACTAGTATTATACCTAGGACTGAGC-3'.

[0140] (3) Obtain strain MG-WY2

[0141] First, the fusion PCR product A, fusion PCR product B, and plasmid pTargetF-pmrN20 obtained in step (1) above were co-transformed into the electrocompetent cells of MG1655::sfGFP (pCas) in Example 1. The electroporated bacterial culture was plated on LB solid medium containing 50 µg / mL kanamycin and 100 µg / mL spectinomycin, and cultured overnight at 30°C to screen for positive transformants. Single colonies were picked for colony PCR and sequencing detection. Nucleotide sequences were compared using NCBI blastn, and the results showed that... pmrB A point mutation occurred within the gene, and the mutation site was correct, resulting in the strain MG-WY2 containing the plasmid.

[0142] Subsequently, the plasmids pTargetF-pmrN20 and pCas were lost according to the method described in step 2 (4) of Example 1 to obtain the engineered strain MG-WY2.

[0143] 2. Regarding pmrA Gene point mutation

[0144] (1) Obtain pmrA Fusion DNA fragments with point mutations

[0145] To mutate the 190th amino acid leucine (L) of the PmrA protein to proline (P), pmrA The CTG in the gene sequence was changed to CCG, and the encoding nucleotide sequence of the PmrA mutant protein is shown in SEQ ID No:8.

[0146] The specific method is as follows: The mutation site of the PmrA protein was designed into the primers. Using genomic DNA of MG1655 as templates, PCR amplification was performed using primers PmrA-1 / PmrA-2 and PmrA-3 / PmrA-4 to obtain PCR products a and b. PCR products a and b were purified and used as templates for fusion PCR amplification using primer pairs PmrA-1 / PmrA-4 to obtain fusion PCR product c. The specific primer sequences are as follows:

[0147] pmrA-P1: 5'-TGAATCGTTAGGTGAAAATGGCATCTATCTGCACGG-3';

[0148] pmrA-P2: 5'-GGCGCGGATACGGGCATGTAACTCTTCCGGCGCAAAAGGCTTCACCAGATAG-3';

[0149] pmrA-P3: 5'-TATCTGGTGAAGCCTTTTGCGCCGGAAGAGTTACATGCCCGTATCCGCGCCC-3';

[0150] pmrA-P4: 5'-TGCTCGGTACTTTCATGCCATAGCCAGAAGA-3'.

[0151] (2) Strain MG-WY3 was obtained

[0152] The above-mentioned fusion PCR product c was transformed into MG-WY2 electrically competent cells containing plasmids pCas and pTargetF-pmrN20. Single colonies were screened according to the method described above, and PCR detection and sequencing verification were performed. Sequence alignment using NCBI blastn showed that... pmrA The correct point mutation site was obtained in the gene. Then, the plasmid pTargetF-pmrN20 and plasmid pCas were lost according to the method described in step 2 (4) of Example 1 to obtain the engineered strain MG-WY3.

[0153] 3. E. coli pmrD Gene replacement into Salmonella pmrD Gene

[0154] (1) Obtaining Salmonella-containing products pmrD Gene fusion DNA fragments

[0155] First, Salmonella... pmrD The gene was optimized using codons based on E. coli to obtain... pmrDThe nucleotide sequence is shown in SEQ ID No:9. The above was synthesized by Tianyi Huiyuan Biotechnology Co., Ltd. pmrD Gene.

[0156] Using primer pairs pmrD1 / pmrD2 and pmrD5 / pmrD6, PCR amplification was performed using the MG1655 genome as a template to obtain... pmrD The upstream fragment a and downstream fragment c of the gene were used with primer pair pmrD3 / pmrD4 to target Salmonella. pmrD PCR amplification was performed using the template to obtain fragment b. Finally, these three fragments were mixed (ligation order abc) and fused PCR amplification was performed using primers pmrD1 / pmrD6 to obtain fragments containing Salmonella. pmrD Gene fusion DNA fragment. Primer sequences are as follows:

[0157] pmrD1: 5'-GGCTGCCAGTATGGCAGAAGGTTAC-3';

[0158] pmrD2: 5'-CCATTCCATAGCGCCCCCGTTGCATTATCCTGTTTGCTAAGAGTTTTCACATC-3';

[0159] pmrD3: 5'-CTTAGCAAACAGGATAATGCAACGGGGGCGCTATGGAATG-3';

[0160] pmrD4: 5'-CCTGCCCACGACAAAACAACGTTAGCTCGGTTTACGGGTCAGACGC-3';

[0161] pmrD5: 5'-TGACCCGTAAACCGAGCTAACGTTGTTTTGTCGTGGGCAGGAAAATC-3';

[0162] pmrD6: 5'-TAATGGGCCTGATGTGGGGATTATTCAGC-3'.

[0163] (2) Constructing plasmid pTargetF-pmrDN20

[0164] The N20 sequence (5'-GGCTATAACTGCTTGCCGAG-3') was designed into primers PmrD-N1 and PmrD-N2. Circular PCR was performed using plasmid pTarget F as a template to obtain the circular PCR product. The circular PCR product was then transformed into *E. coli* DH5α competent cells, and transformants were screened using LB medium containing 100 µg / mL spectinomycin. Plasmid extraction and identification were performed as described above, and the plasmid was sequenced to verify its identity; it was named pTargetF-pmrDN20.

[0165] The structure of plasmid pTargetF-pmrDN20 is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence 5'-GGCTATAACTGCTTGCCGAG-3' between the 5'-gtcctaggtataatactagt-3' and 5'-gttttagagctagaaatagc-3' fragments of the starting vector pTargetF, while keeping the other sequences of the vector pTargetF unchanged. The specific primer sequences are as follows, where the N20 sequence is underlined:

[0166] PmrD-N1: 5'- GGCTATAACTGCTTGCCGAG GTTTTAGAGCTAGAAATAGCAAG-3';

[0167] PmrD-N2: 5'- CTCGGCAAGCAGTTATAGCC ACTAGTATTATACCTAGGACTGAGC-3'.

[0168] (3) Obtain strain MG-WY4

[0169] The Salmonella-containing sample obtained in step (1) above pmrD The fusion DNA fragment of the gene was transformed into MG-WY3 electrocompetent cells containing pCas and pTargetF-pmrDN20. Single colonies were screened according to the method described above, and PCR detection and sequencing verification were performed. Sequence alignment using NCBI blastn showed that the gene... pmrD The sequence has been successfully replaced with that of Salmonella. pmrD sequence.

[0170] Subsequently, following the method described in step 2 of Example 1, plasmids pTargetF-pmrDN20 and pCas were lost to obtain the engineered strain MG-WY4.

[0171] 4. Replacement of ribosome binding sites

[0172] To further improve the transcriptional expression level of the gene and enhance the sensor’s sensitivity to iron ions, the original ribosome binding site (RBS) nucleotide sequence 5'-TGTTCGATGGAAACCGTG-3' in the pmr operon was replaced with the strong RBS nucleotide sequence 5'-AGAAAGAGGAGAAAACCGTG-3' (SEQ ID No:5).

[0173] (1) Obtaining fused DNA fragments

[0174] Using genomic DNA from MG1655 as templates, PCR amplification was performed using primers Pmr-P1 / Pmr-P2 and Pmr-P3 / Pmr-P4, yielding PCR products D and E. After purification, PCR products D and E were used as templates for fusion PCR amplification using primer pair PmrA-P1 / PmrA-P4, yielding PCR product F. Strong RBS sequences were incorporated into the primers and are underlined. The primer sequences are as follows:

[0175] Pmr-P1: 5'-GGCGGGGCTGATTATCGTCGGTATTTTG-3';

[0176] Pmr-P2: 5'- CACGGTTTTCTCCTCTTTCT AAGTGCGCATATGCTCGCAAAATTATATT

[0177] AAGCCAACCTTAAGTTCTTAAGGTTGGCTTTTATGTT-3';

[0178] Pmr-P3: 5'- TTAATATAATTTTGCGAGCATATGCGCACTT AGAAAGAGGAGAAAACCGTG ATGTTGAAGCGCCTACTAAAAAGAC-3';

[0179] Pmr-P4: 5'-GCCGCTGAATCCCAGCGTTAATAACATTTG-3';

[0180] (2) Constructing plasmid pTargetF-RBSN20

[0181] The N20 sequence 5'-GTAATTCAGCGCATACATGG-3' of the sgRNA was designed into primers Pmr-N1 and Pmr-N2. Circular PCR was performed using plasmid pTarget F as a template to obtain the circular PCR product. The circular PCR product was then transformed into *E. coli* DH5α competent cells, and transformants were screened using LB medium containing 100 µg / mL spectinomycin. The plasmid was extracted, and primer identification was performed as described above. Sequencing confirmed that the plasmid was named pTargetF-RBSN20.

[0182] The structure of the pTargetF-RBSN20 vector is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence 5'-GTAATTCAGCGCATACATGG-3' between the 5'-gtcctaggtataatactagt-3' and 5'-gttttagagctagaaatagc-3' fragments of the starting vector pTargetF, while keeping the other sequences of the pTargetF vector unchanged. The specific primer sequences are as follows, with the N20 sequence marked by an underscore:

[0183] Pmr-N1: 5'- GTAATTCAGCGCATACATGG GTTTTAGAGCTAGAAATAGCAAG-3';

[0184] Pmr-N2: 5'- CCATGTATGCGCTGAATTAC ACTAGTATTATACCTAGGACTGAGC-3'.

[0185] (3) Obtain strain MG-WY5

[0186] The purified fusion PCR product C and plasmid pTargetF-RBSN20 were co-transformed into electrocompetent cells MG-WY4 containing pCas plasmid. Single colonies were screened and verified by PCR and sequencing as described above. The results showed that the original RBS sequence in the strain had been replaced by a strong RBS sequence.

[0187] Subsequently, the two plasmids were lost according to the method described in step 2 (4) of Example 1 to obtain the engineered strain MG-WY5.

[0188] 5. Construct overexpression plasmids pBAD-EptA and pT7RNAP-sfGFP

[0189] 1) Construction of overexpression plasmid pBAD-EptA

[0190] Using genomic DNA from MG1655 as a template, PCR amplification was performed using primers pBAD-eptA-P1 / pBAD-eptA-P2. KpnI and HindIII restriction sites and protective bases were added to the 5' end of the primers to obtain DNA fragment S.

[0191] pBAD-eptA-P1:5'-CGG GGTACC ATGTTGAAGCGCCTACTAAAAAGAC-3';

[0192] pBAD-eptA-P2:5'-CCC AAGCTT TCATTCACTCACTCTCCTGCAA-3' (where the underline is the restriction site).

[0193] The PCR products were purified using a kit and digested with KpnI and HindIII. Simultaneously, the expression vector pBAD43 (Newp Biotech Co., Ltd., catalog number V012781) was digested with KpnI and HindIII. The DNA fragment S and the linear vector pBAD43 were ligated using T4 DNA ligase. The ligation product was transformed into *E. coli* DH5α competent cells and treated with 100... µ Transformants were screened using g / mL spectinomycin, plasmids were extracted using a kit, identified by enzyme digestion, and successfully obtained by sequencing using plasmid pBAD--EptA. The plasmid map is shown below. Figure 4 As shown in Figure A.

[0194] The structure of the pBAD-EptA vector is described as follows: it is inserted between the KpnI and HindIII restriction sites of the starting vector pBAD43. eptA The gene was used to obtain a recombinant vector that kept other sequences of the pBAD43 vector unchanged. eptA The nucleotide sequence of the gene is located at c4333947-4335590 in the genome of Escherichia coli MG1655 (GenBank No. U00096.3; updated November 6, 2024). The pBAD-EptA vector can express the EptA protein, whose amino acid sequence is SEQ ID No:13.

[0195] 2) Construction of overexpression plasmid pT7RNAP-sfGFP

[0196] Using pPAS vector as a template, PCR amplification was performed on pmrG-1 / pmrG-2 primers to obtain the product containing the T7 promoter. sfGFP The gene was then ligated into the vector pGEM-T Easy (Promega, catalog number A1360), transformed into DH5α competent cells, and 100 µTransformants were screened with g / mL ampicillin, single colonies were picked, plasmids were extracted and identified by PCR, and plasmid pGEM-T-sfGFP was obtained.

[0197] The structure of plasmid pGEM-T-sfGFP is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:1 between the 5'-GCCGCGGGAATTCGAT-3' and 5'-ATCCGGATATAGTTC-3' fragments downstream of the T7 promoter of the starting vector pGEM-T Easy, while keeping the other sequences of the starting vector pGEM-T Easy unchanged.

[0198] Using the MG1655 genome as a template, PCR amplification was performed using primer pair pmrG-3 / pmrG-4 to obtain... pmrG The promoter fragment upstream of the gene (the nucleotide sequence of the promoter is SEQ ID No: 10); using the genome of *E. coli* BL21(DE3) as a template, PCR amplification was performed using primers pmrG-5 / pmrG-6 to obtain the T7 RNA polymerase gene; then, using these two fragments as templates, fusion PCR was performed using primers pmrG-3 / pmrG-6 to obtain... pmrG The promoter and T7 RNAP fusion DNA fragment Q.

[0199] The primer sequences are as follows (underlined bases are PciI restriction sites):

[0200] pmrG-1: 5'-ATGCGTAAAGGCGAAGAGCTG-3';

[0201] pmrG-2: 5'-TCATTTGTACAGTTCATCCATACCATG-3';

[0202] pmrG-3:5'-GCG ACATGT TGAATACCTGTCCACTTATATTTGC-3';

[0203] pmrG-4: 5'-CGTTCTTAGCGATGTTAATCGTGTTCATGTAAACTCCACCTATAGACAAGC-3';

[0204] pmrG-5: 5'-GCTTGTCTATAGGTGGAGTTTACATGAACACGATTAACATCGCTAAGAACG-3';

[0205] pmrG-6:5'-GCG ACATGTGAGTCGTATTGATTTGGCGTTACGCGAA-3'.

[0206] The fusion DNA fragment Q was digested with PciI, dephosphorylated, and ligated into the PciI-digested plasmid pGEM-T-sfGFP. The ligation product was transformed into DH5α competent cells, and transformants were screened with 100 µg / mL ampicillin. The plasmid was extracted and identified by PciI digestion. Sequencing successfully yielded the 6822 bp plasmid pT7RNAP-sfGFP. Figure 4 (B)

[0207] The structure of the pT7RNAP-sfGFP vector is described as follows: It consists of an expression cassette of T7 RNA polymerase inserted between the PciI restriction sites of the starting vector pGEM-T-sfGFP. PmrG The recombinant vector was obtained by keeping the promoter sequence SEQ ID No:10 and the associated DNA fragment of the T7 RNA polymerase encoding gene unchanged, while maintaining the other sequences of the vector pGEM-T-sfGFP. The nucleotide sequence of the T7 RNA polymerase encoding gene is the sequence located at 750421-753072 in the *E. coli* BL21(DE3) genome (GenBank: CP001509.3; updated February 6, 2017).

[0208] 6. Obtain optimized bacterial sensors

[0209] Competent cells of MG-WY5 strain were prepared using conventional methods. Then, the plasmids pBAD-EptA and pT7RNAP-sfGFP obtained in step 5 were transformed into the competent cells of MG-WY5 strain. The cells were then treated with a solution containing 100... µ g / mL ampicillin and 100 µ Transformants were screened on LB solid medium containing g / mL spectinomycin. The plasmid was identified by PCR using the primers from step 5 above, and the engineered strain MG-WY5 (pBAD-EptA, pT7RNAP-sfGFP) was finally obtained, which is the bacterial sensor described below.

[0210] Example 3: Detection of iron ions using a bacterial sensor

[0211] 1. Bacterial sensor culture

[0212] The engineered strain MG-WY5 (pBAD-EptA,pT7RNAP-sfGFP) obtained in Example 2 was inoculated into 3 mL of LB medium containing 50 μg / mL ampicillin and 100 μg / mL spectinomycin. The MG1655 strain was inoculated into LB medium as a control. The bacteria were cultured overnight in a shaker at 37°C.

[0213] The following day, the bacterial suspension was transferred to 3 mL of basal culture medium at a 1:100 ratio. 10 μM magnesium chloride and different concentrations of ferric chloride were added to induce and activate the two two-component systems. The final concentrations of ferric chloride were 0 μM, 10 μM, 50 μM, 100 μM, 200 μM, 300 μM, and 500 μM. The test tubes were wrapped with aluminum foil and cultured in a shaker at 200 rpm and 37°C. When the bacteria grew to the OD... 600 When the pH is 0.6, take 1 mL of bacterial culture medium into an Eppendorf tube, centrifuge at 5000 rpm for 5 minutes to collect the bacteria, then wash the bacteria twice with 1 mL of 1×PBS (pH 7.0), centrifuge at 5000 rpm for 5 minutes to collect the bacteria, resuspend in 1 mL of 1×PBS, vortex to fully disperse the bacteria, wrap the test tube with aluminum foil, and operate in the dark throughout the process. Place at 4℃ for 2 hours before use for subsequent observation and detection of bacterial fluorescence.

[0214] 2. Observe bacterial luminescence using a fluorescence microscope.

[0215] Take 3 μL of bacterial suspension and dilute it with water to a concentration of 10 μL. μ Drop L onto a glass slide, cover with a coverslip, and observe the bacteria using an oil immersion fluorescent microscope at 100x magnification and an exposure time of 200 ms.

[0216] The results are as follows Figure 5 As shown in A. 10 μ Ferric chloride (M) induces bacteria to fluoresce, and as the concentration of ferric chloride increases, more bacteria emit strong green fluorescence.

[0217] 3. Detect the fluorescence intensity of bacteria using flow cytometry.

[0218] Take 0.5 mL of bacterial suspension and detect bacterial fluorescence using a flow cytometer (BD FACSCalibur). Gating settings: FSC E01, SSC 365, FL1 791, FL2 587. Count the fluorescence signals of 30,000 bacteria and take the logarithm. Analyze the data using FlowJo software to obtain the median fluorescence intensity (MFI).

[0219] Flow cytometry results are as follows Figure 5As shown in Figure B, the accurate detection range of this biosensor for iron ions is 50-300 μM (i.e., 2.80-16.8 mg / L). Within this range, the higher the iron ion concentration, the stronger the fluorescence of the bacteria. However, the fluorescence value decreases beyond 300 μM, exhibiting a fluorescence quenching effect. Therefore, in practical applications, high concentrations of iron ions can be diluted according to specific circumstances before detection using this biosensor.

[0220] 4. Detect the fluorescence intensity of bacteria using an enzyme-linked immunosorbent assay (ELISA) reader.

[0221] 200 μL of bacterial suspension was transferred to black 96-well microplates, with three replicates for each sample. The fluorescence intensity of the bacteria was detected using a microplate reader or a fluorescence microplate reader. Microplate reader settings: excitation wavelength 488 nm, scanning emission wavelength 525 nm. Fluorescence intensity is expressed as a relative value in arbitrary units (AU). Detection results are shown below. Figure 5 As shown in Figure C. When using an ELISA reader, the detection range of this biosensor for iron ions is 50-300. μ Within the range of M, the higher the iron ion concentration, the stronger the fluorescence of the bacteria.

[0222] 5. Detect the iron ion concentration in the sample.

[0223] First, prepare the standard curve ( Figure 5 (C), with final concentrations of 0 μM , 1 μM 10 μM , 25 μM 50 μM 100 μM 300 μM Ferric chloride induced bacterial luminescence, and fluorescence values ​​were obtained. A standard curve was constructed using GraphPad_Prism software, and the data was fitted using a nonlinear regression curve to obtain the values ​​in the Hill equation Y=Bottom + (Top-Bottom) / (1+10^((LogEC50-X)*HillSlope)), where Y is the fluorescence intensity, i.e., the fluorescence intensity of bacteria after adding ferric chloride minus the fluorescence intensity of the blank control bacteria; X is the logarithmic value of the ferric chloride concentration; the fluorescence amount at the bottom (Bottom) and top (Top) of the S-curve were obtained using the software, LogEC50 is the logarithmic value of the TMAO concentration at which half of the maximum fluorescence amount is reached, and HillSlope is the Hill factor. The results are as follows. Figure 5 As shown in D.

[0224] The concentration of iron ions in the sample can be calculated using the standard curve formula and the fluorescence intensity of the sample. The standard curve formula is Y = 5.728 + 53.82 / (1 + 10^((0.08359 - X) × 0.1787)). Where Y is the fluorescence intensity; X is the logarithmic value of the ferric chloride concentration.

[0225] Example 4: Analysis of bacterial resistance to polymyxin B

[0226] First, engineered strain MG-WY5 (pBAD-EptA, pT7RNAP-sfGFP) was streaked onto LB agar plates containing 100 μg / mL ampicillin and 100 μg / mL spectinomycin. Then, a single colony was inoculated into 3 mL of LB medium containing ampicillin and spectinomycin and cultured overnight. Next, it was transferred 1:100 to 100 mL of basal medium (pH 7.0) containing 300 μM FeCl3, 10 μM MgCl2, 100 μg / mL ampicillin, 100 μg / mL spectinomycin, and 0.02% L-arabinose. The medium was incubated at 37°C and 200 rpm for 5-6 hours until the OD600nm reached 0.6. The bacteria were then counted using a bacterial counter, yielding 10... 8 CFU / mL bacterial suspension was prepared, and then the bacteria were serially diluted 10-fold. 5 μL of each dilution was spotted onto the following three types of plates: 1) LB agar plate without polymyxin B; 2) LB agar plate containing 4 μg / mL polymyxin B and 300 μM FeCl3; 3) LB agar plate containing 4 μg / mL polymyxin B, 300 μM FeCl3, and 10 μM MgCl2. After incubation at 37°C upside down for 16 h, bacterial growth was observed.

[0227] The results showed that bacterial resistance to polymyxin B increased tenfold under the induction of 300 μM FeCl3; and bacterial resistance to polymyxin B increased nearly 100fold under the co-induction of 300 μM FeCl3 and 10 μM MgCl2. Figure 6 ).

[0228] Example 5: Modification of lipopolysaccharide

[0229] 1. Culture of engineered strain MG-WY5 (pBAD-EptA, pT7RNAP-sfGFP)

[0230] The engineered bacterial strain MG-WY5 (pBAD-EptA,pT7RNAP-sfGFP) was activated as follows: First, the strain was streaked onto LB agar plates containing 100 μg / mL ampicillin and 100 μg / mL spectinomycin. Then, a single colony was inoculated into 3 mL of LB medium containing ampicillin and spectinomycin and cultured overnight. The culture was then transferred 1:100 to 2 L of basal medium (pH < 7.0), with the aforementioned inducer (300 μM FeCl3 and 10 μM MgCl2) and antibiotic (ampicillin concentration 100 μg / mL) added. μ g / mL and spectinomycin concentration of 100 g / mL μ Bacteria were cultured at 37°C and 200 rpm on a shaker until OD500 reached (g / mL). 600nm It is 1.0.

[0231] 2. Extraction and purification of lipopolysaccharide and lipid A from engineered strain MG-WY5 (pBAD-EptA, pT7RNAP-sfGFP)

[0232] Collect bacterial cells by centrifugation, wash the cells with 300 ml of cold acetone, place in a fume hood to allow evaporation, let stand to separate the layers, and discard the upper layer. Add another 300 ml of acetone and repeat the above steps, for a total of 4 times. Add ether and allow to dry naturally to allow acetone to evaporate. Add 150 mL of 45% water-saturated phenol (pH 6.6) to the dried cells and extract crude LPS using the hot phenol-water method, dissolving it in water. Obtain lipid A by hydrolyzing LPS with acetic acid according to the method described in the literature (Antimicrob Agents Chemother. 2018, 27;62(9): e00864-18). Hydrolyze LPS with 2% acetic acid at 100°C for 90 min, add an equal volume of chloroform:methanol (2:1, vol / vol), stir, centrifuge at 600 g for 15 min, and take the lower organic phase, which is the lipid.

[0233] 3. Detection and analysis of lipid A

[0234] The chemical structure of lipid A was detected using matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MULTI-TOF-MS) in positive ion reflectance mode. Figure 7 ). Figure 7 The medium ion mode with m / z 1716 represents unmodified hexanoyl monophosphate lipid A; m / z 1796 represents unmodified hexanoyl diphosphate lipid A; m / z 1954 represents hexanoyl monophosphate lipid A modified with L-Ara4N; and m / z 2034 represents hexanoyl diphosphate lipid A modified with ethanolamine phosphate and L-Ara4N.

[0235] The results showed that inducing bacterial sensors with 300 μM iron ions and 10 μM magnesium ions could alter the modification of bacterial lipopolysaccharide lipid A, leading to an increase in the positive charge of LPS.

[0236] In summary, the bacterial sensor of this invention can be used to detect the concentration of iron ions in the environment. Applying the method of this invention can improve the sensitivity of *E. coli* to iron ions, alter the chemical modification of *E. coli* LPS endotoxin, and enhance bacterial drug resistance.

[0237] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. Recombinant Escherichia coli, characterized in that: The recombinant Escherichia coli contains a superfolded green fluorescent protein sfGFP encoding gene, a sensor protein PmrB mutant encoding gene, a response regulatory protein PmrA mutant encoding gene, a signal transduction protein PmrD encoding gene, and a strong ribosome binding site RBS. It also contains a T7 RNA polymerase encoding gene driven by the promoter of phosphorylase PmrG and an sfGFP encoding gene driven by the T7 promoter, and overexpresses the phosphorylethanolamine transferase EptA encoding gene. The superfolded green fluorescent protein sfGFP is any of the following proteins: A1) The amino acid sequence is SEQ ID No. 1; A2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1); The PmrB mutant of the sensory protein is any of the following proteins: B1) The amino acid sequence is SEQ ID No. 2; B2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of B1); The PmrA mutant of the response regulatory protein is any one of the following proteins: C1) The amino acid sequence is SEQ ID No. 3; C2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of C1); The signal transduction protein PmrD is any of the following proteins: D1) The amino acid sequence is SEQ ID No. 4; D2) The fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of D1); The T7 RNA polymerase is any of the following proteins: E1) The amino acid sequence is SEQ ID No: 14; E2) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of E1); The phosphoethanolamine phosphotransferase EptA is any of the following proteins: F1) The amino acid sequence is SEQ ID No: 13; F2) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of F1).

2. The recombinant Escherichia coli according to claim 1, characterized in that: The nucleotide sequence of the strong ribosome binding site RBS in the recombinant Escherichia coli is SEQ ID No.

5.

3. The recombinant Escherichia coli according to any one of claims 1 or 2, characterized in that: The pmrD in the recombinant Escherichia coli is derived from the pmrD of Salmonella.

4. The recombinant Escherichia coli according to any one of claims 3, characterized in that: The nucleotide sequence of the superfolded green fluorescent protein sfGFP encoding gene is SEQ ID No:6; The nucleotide sequence of the gene encoding the PmrB mutant sensory protein is SEQ ID No:7; The nucleotide sequence of the gene encoding the PmrA mutant response regulatory protein is SEQ ID No:8; The nucleotide sequence of the gene encoding the signal transduction protein PmrD is SEQ ID No:9; The nucleotide sequence of the promoter of the phosphorylase PmrG is SEQ ID No:10; The nucleotide sequence of the phosphoethanolamine phosphotransferase EptA encoding gene is the sequence located at c4333947-4335590 in the genome of Escherichia coli MG1655 in GenBank: U00096.3, updated on November 6, 2024.

5. A method for constructing recombinant *Escherichia coli* according to any one of claims 1-4, characterized in that, The method includes: 1) The recipient E. coli pmrA and pmrB The genes were mutated to obtain the gene encoding the PmrB mutant sensor protein of claim 1 and the gene encoding the PmrA mutant response regulatory protein of claim 1. 2) Integrating the superfolded green fluorescent protein (sfGFP) encoding gene as described in any one of claims 1-4 into the genome of the recipient *E. coli*. pmrA and pmrB Between genes; 3) The recipient E. coli pmrD Replace with the PmrD signal transduction protein encoding gene as described in any one of claims 1-4; 4) The recipient E. coli pmr The ribosome binding site of the operon is replaced with a strong ribosome binding site as described in any of claims 1-4; 5) The expression of the T7 RNA polymerase according to any one of claims 1-4 in the receptor *E. coli* is regulated by the response regulatory protein PmrA; wherein the regulation is the regulation of the promoter of the T7 RNA polymerase, and the promoter of the T7 RNA polymerase is... pmrG The promoter; 6) The T7 RNA polymerase regulating receptor Escherichia coli as described in claim 1-4 as described in claim 5) sfGFP Gene expression, wherein the regulation is the regulation of the sfGFP promoter, and the sfGFP promoter is the T7 promoter; 7) Overexpression of the phosphoethanolamine transferase EptA encoding gene as described in any one of claims 1-4 in the receptor Escherichia coli.

6. The method of claim 5 may be applied in any of the following ways: 1) Preparation of bacterial sensors that sense iron and magnesium ions; 2) Prepare products for detecting the concentration of iron ions in the environment.

7. The use of the *Escherichia coli* according to any one of claims 1-4 in any of the following: 1) Preparation of bacterial sensors that sense iron and magnesium ions; 2) Detect the concentration of iron ions in the environment.

8. A method for preparing a bacterial sensor that senses iron and magnesium ions, comprising culturing any one of the recombinant Escherichia coli according to claims 1-4, and centrifuging the fermentation product to obtain the bacterial sensor.

Citation Information

Patent Citations

  • Method of detection

    US20200024635A1

  • USE OF ECTOENZYMES AND SECRETED ENZYMES TO MONITOR CELL PROLIFERATION

    WO2002010442A1