SNP molecular marker affecting pig teat number trait and application

Abstract

The application discloses four new SNP molecular markers affecting pig teat number traits and nucleotide sequences containing the corresponding molecular markers. The four SNP molecular markers include C>T mutation at the position of 47855059bp of chromosome 8 of the pig genome Ensembl Sscrofa11.1 version, A>G mutation at the position of 47369817bp of chromosome 12, T>C mutation at the position of 135350586bp of chromosome 15, and T>A mutation at the position of 607635bp of chromosome 17. By applying one or more of the four SNP molecular markers, the teat number traits of sows can be efficiently and safely selected, the individuals screened out with advantageous allelic genotypes are reserved for breeding, and sows with the multiple teat number traits can be bred, and the teat number traits of sows can be genetically improved. The selection of the teat traits of sows by using the above SNP molecular markers can shorten the breeding period, improve the reproductive performance of sows, and further improve the economic value and market competitiveness of sows.

Description

Technical Field

[0001] This invention relates to the fields of molecular biotechnology and genetic breeding, and in particular to an SNP molecular marker that affects the number of pig nipples and its application. Background Technology

[0002] Reproductive performance in pigs is a crucial indicator of their economic value. Teat number, a complex trait directly related to piglet survival rate and productivity, possesses moderate heritability, typically ranging from 0.1 to 0.5. The number of teats directly impacts sow milk production and the number of suckling piglets, thus affecting piglet health and survival rate. Therefore, selecting for teat number traits is an effective strategy for improving sow productivity in pig farming.

[0003] There is a positive correlation between the number of teats and the number of piglets born; the combination of a high number of teats and a high number of piglets born is an important physiological basis for achieving high reproductive capacity in sows. Although substantial progress has been made in the genetic improvement of litter size in recent years, the teat number trait has not been systematically improved through selective breeding. This has led to some sows having more piglets than their teat count allows them to nurse, affecting piglet weight gain and mortality, and increasing production costs and management difficulties. Therefore, developing and utilizing new molecular selection markers to increase the number of pig teats is of significant scientific and industrial value for achieving genetic improvement of reproductive performance in breeding pigs.

[0004] Genome-wide association studies (GWAS) are a method that integrates genetics, statistics, and computer science. It utilizes a high-density molecular marker screening across the entire genome to scan the entire population under study. Statistical methods are then used to analyze the associations between the obtained molecular marker data and phenotypic traits. Finally, genetic knowledge is combined to analyze and identify genetic variations in phenotypic traits or candidate genes influencing them. In pig breeding, GWAS has been widely used to study the nipple number trait, and several studies have reported gene loci and candidate genes associated with nipple number. However, the results often exhibit population heterogeneity, and the genetic basis and major genes controlling the nipple number trait in pigs remain unclear.

[0005] To improve the accuracy and reliability of GWAS results, meta-analysis has also been applied to pig breeding research. Meta-analysis, also known as a comprehensive analysis, statistically synthesizes information from multiple independent studies, increasing the probability of discovering new associations and reducing false negatives, thereby improving test power and the accuracy of results. The application of meta-analysis in pig breeding has not only increased the quantity and accuracy of GWAS results but also provided strong support for elucidating the genetic basis of important economic traits in pigs. Summary of the Invention

[0006] The purpose of this invention is to provide a new SNP molecular marker that affects the number of teats in pigs and its application, so as to increase the number of teats in sows, thereby improving their reproductive performance and achieving genetic improvement of the reproductive performance of breeding pigs.

[0007] According to a first aspect of the present invention, a SNP molecular marker affecting the number of teats in pigs is provided, the SNP molecular marker comprising: a C>T mutation located at position 47855059 bp on chromosome 8 of the pig genome Ensembl Sscrofa 11.1 (hereinafter referred to as "yz_8_47855059 molecular marker"); or an A>G mutation located at position 47369817 bp on chromosome 12 of the pig genome Ensembl Sscrofa 11.1 (hereinafter referred to as "rs341593917 molecular marker"); or a T>C mutation located at position 135350586 bp on chromosome 15 of the pig genome Ensembl Sscrofa 11.1 (hereinafter referred to as "yz_rs81341835 molecular marker"); or a ... The T>A mutation at position 607635bp on chromosome 17 in Sscrofa version 11.1 (hereinafter referred to as "yz_17_607635 molecular marker"). Selective breeding using any one or more of the above four SNP molecular markers can increase the number of teats in selected sows, improve the reproductive performance of the selected sow population, and further increase the economic value of sows.

[0008] According to a second aspect of the present invention, an application of SNP molecular markers in the selection of teat count traits in sows is provided, wherein the SNP molecular markers include a C>T mutation located at 47855059 bp on chromosome 8 of the pig genome Ensembl Sscrofa 11.1; or an A>G mutation located at 47369817 bp on chromosome 12 of the pig genome Ensembl Sscrofa 11.1; or a T>C mutation located at 135350586 bp on chromosome 15 of the pig genome Ensembl Sscrofa 11.1; or a T>A mutation located at 607635 bp on chromosome 17 of the pig genome Ensembl Sscrofa 11.1. Therefore, by selecting and breeding sows based on these four SNP molecular markers for the teat number trait, individuals with the dominant genotype of multiple teats can be retained and then propagated. This can gradually increase the number of teats in sows, thereby achieving the selection and breeding of the teat number trait, shortening the breeding cycle, and improving the reproductive performance of sows.

[0009] According to a third aspect of the present invention, an application of SNP molecular markers in breeding sow breeds with multiple nipples is provided. These SNP molecular markers include a C>T mutation located at 47855059 bp on chromosome 8 of the porcine genome (Ensembl Sscrofa 11.1 version); or an A>G mutation located at 47369817 bp on chromosome 12 of the porcine genome (Ensembl Sscrofa 11.1 version); or a T>C mutation located at 135350586 bp on chromosome 15 of the porcine genome (Ensembl Sscrofa 11.1 version); or a T>A mutation located at 607635 bp on chromosome 17 of the porcine genome (Ensembl Sscrofa 11.1 version). This allows for the acquisition of sow breeds with multiple nipples, which exhibit better reproductive performance and economic value, and thus greater market competitiveness.

[0010] In some implementations, the application method includes the following steps:

[0011] S1: Detection of the SNP molecular markers in replacement gilts;

[0012] S2: Select individuals with the TT genotype at the 47855059bp position on chromosome 8, as detected in step S1, and use them as breeding sows;

[0013] Alternatively, individuals with the GG genotype at the 47369817bp position on chromosome 12, as detected in step S1, may be selected as breeding sows and bred.

[0014] Alternatively, individuals with the CC genotype at the 135350586bp position on chromosome 15, as detected in step S1, may be selected as breeding sows and bred.

[0015] Alternatively, individuals with the TT genotype at the 607635bp position on chromosome 17, as detected in step S1, can be selected as breeding sows and mated with them.

[0016] S3: Test the SNP molecular markers on the piglets born from mating in step S2, retain them for breeding according to the genotypes described in step S2, and then breed them to cultivate a sow breed with multiple teats.

[0017] According to a fourth aspect of the present invention, an application of SNP molecular markers in improving the teat number trait in sows is provided. These SNP molecular markers include a C>T mutation located at 47855059 bp on chromosome 8 of the pig genome (Ensembl Sscrofa 11.1 version); or an A>G mutation located at 47369817 bp on chromosome 12 of the pig genome (Ensembl Sscrofa 11.1 version); or a T>C mutation located at 135350586 bp on chromosome 15 of the pig genome (Ensembl Sscrofa 11.1 version); or a T>A mutation located at 607635 bp on chromosome 17 of the pig genome (Ensembl Sscrofa 11.1 version). Therefore, by applying one or more of the above four SNP molecular markers to select for the teat number trait in sows, the teat number trait in sows can be improved, thereby enhancing the reproductive performance and economic value of sows.

[0018] In some implementations, the application method includes the following steps:

[0019] S1: Detection of the SNP molecular markers in replacement gilts;

[0020] S2: Select individuals with the TT genotype at the 47855059bp position on chromosome 8, as detected in step S1, and use them as breeding sows;

[0021] Alternatively, individuals with the GG genotype at the 47369817bp position on chromosome 12, as detected in step S1, may be selected as breeding sows and bred.

[0022] Alternatively, individuals with the CC genotype at the 135350586bp position on chromosome 15, as detected in step S1, may be selected as breeding sows and bred.

[0023] Alternatively, individuals with the TT genotype at the 607635bp position on chromosome 17, as detected in step S1, can be selected as breeding sows and mated with them.

[0024] S3: Test the SNP molecular markers on the piglets born from mating in step S2, and retain them for breeding according to the genotypes described in step S2. Then breed them, retain the dominant genotype individuals in the offspring pigs, and eliminate other genotypes, so as to increase the frequency of dominant alleles generation by generation, thereby increasing the number of teats in the sow population and improving the number of teats in the offspring sows.

[0025] According to a fifth aspect of the present invention, an application of SNP molecular markers in detecting / screening / identifying the teat number trait in sows is provided. These SNP molecular markers include a C>T mutation located at 47855059 bp on chromosome 8 of the pig genome (Ensembl Sscrofa 11.1 version); or an A>G mutation located at 47369817 bp on chromosome 12 of the pig genome (Ensembl Sscrofa 11.1 version); or a T>C mutation located at 135350586 bp on chromosome 15 of the pig genome (Ensembl Sscrofa 11.1 version); or a T>A mutation located at 607635 bp on chromosome 17 of the pig genome (Ensembl Sscrofa 11.1 version). Thus, one or more of these four SNP molecular markers can be used to safely, efficiently, and accurately detect / screen / identify the teat number trait in sows, facilitating subsequent breeding work.

[0026] In some embodiments, the sow is a Large White or Landrace sow.

[0027] According to a sixth aspect of the present invention, an application of SNP molecular markers in the preparation of kits for detecting / screening / identifying the teat number trait in sows is provided. These SNP molecular markers include a C>T mutation located at 47855059 bp on chromosome 8 of the porcine genome (EnsemblSscrofa 11.1 version); or an A>G mutation located at 47369817 bp on chromosome 12 of the porcine genome (EnsemblSscrofa 11.1 version); or a T>C mutation located at 135350586 bp on chromosome 15 of the porcine genome (EnsemblSscrofa 11.1 version); or a T>A mutation located at 607635 bp on chromosome 17 of the porcine genome (EnsemblSscrofa 11.1 version). Thus, by preparing corresponding detection kits using one or more of the aforementioned four SNP molecular markers, the teat number trait in sows can be detected / screened / identified safely, efficiently, and accurately, facilitating subsequent breeding work.

[0028] According to a seventh aspect of the present invention, a nucleotide sequence containing an SNP molecular marker affecting the number of teats in pigs is provided. This sequence contains the nucleotide sequence shown in SEQ ID No:1, where the 101st base M represents a C>T base mutation; or the nucleotide sequence shown in SEQ ID No:2, where the 101st base M represents an A>G base mutation; or the nucleotide sequence shown in SEQ ID No:3, where the 101st base M represents a T>C base mutation; or the nucleotide sequence shown in SEQ ID No:4, where the 101st base M represents a T>A base mutation. Therefore, primers or probes can be designed based on the above sequences to detect / screen / identify the SNP molecular marker, which can then be used for breeding sows to improve the number of teats and reproductive performance of sows, effectively shorten the breeding cycle, and increase the economic value and market competitiveness of sows.

[0029] According to an eighth aspect of the present invention, an application is provided of a nucleotide sequence containing an SNP molecular marker affecting the number of teats in sows for detecting / screening / identifying the teat count trait. This sequence contains the nucleotide sequence shown in SEQ ID No:1, where the 101st base M represents a C>T base mutation; or the nucleotide sequence shown in SEQ ID No:2, where the 101st base M represents an A>G base mutation; or the nucleotide sequence shown in SEQ ID No:3, where the 101st base M represents a T>C base mutation; or the nucleotide sequence shown in SEQ ID No:4, where the 101st base M represents a T>A base mutation. Therefore, by designing corresponding primers or probes from this nucleotide sequence containing the SNP molecular marker affecting the number of teats in sows for detecting / screening / identifying the teat count trait, the detection / screening / identification of the teat count trait in sows can be performed simply, safely, and efficiently, laying the foundation for subsequent breeding work.

[0030] According to a ninth aspect of the present invention, there is an application of a nucleotide sequence containing an SNP molecular marker affecting the number of pig teats in the preparation of products for detecting / screening / identifying the number of pig teats. This sequence contains the nucleotide sequence shown in SEQ ID No:1, where the 101st base M represents a C>T base mutation; or the nucleotide sequence shown in SEQ ID No:2, where the 101st base M represents an A>G base mutation; or the nucleotide sequence shown in SEQ ID No:3, where the 101st base M represents a T>C base mutation; or the nucleotide sequence shown in SEQ ID No:4, where the 101st base M represents a T>A base mutation. Therefore, by utilizing the nucleotide sequence containing the SNP molecular marker affecting the number of pig teats to prepare corresponding detection kits and other products, the number of sow teats can be detected / screened / identified efficiently, rapidly, safely, and without side effects.

[0031] The beneficial effects of this invention are as follows: This invention discloses four novel SNP molecular markers that influence the number of teats in pigs, along with the corresponding nucleotide sequences. By applying one or more of these four SNP molecular markers, efficient and safe selection can be performed on the teat number trait in sows. Individuals with dominant alleles selected can be retained for breeding, leading to the development of sow breeds with multiple teat number traits. Furthermore, the genetic improvement of the teat number trait in sows can also be achieved. Using the aforementioned SNP molecular markers for the selection of sow teat traits can shorten the breeding cycle, improve the reproductive performance of sows, and further enhance the economic value and market competitiveness of sows. Attached Figure Description

[0032] Figure 1 Manhattan plot of Meta-GWAS for the left nipple count trait;

[0033] Figure 2 Manhattan plot of Meta-GWAS for the right nipple count trait;

[0034] Figure 3 Manhattan plot of Meta-GWAS for total nipple count trait. Detailed Implementation

[0035] The invention will be further described in detail below with reference to the embodiments.

[0036] Example 1: Screening of Molecular Markers

[0037] (1) Phenotypic-pedigree data collection

[0038] This study included breeding pigs from six strains: Danish Large White, Chinese Large White, Topk Large White, Danish Landrace, Chinese Landrace, and Topk Landrace, all sourced from the core breeding farm of Guangxi Yangxiang Group Co., Ltd. Phenotypic data, including the number of left teats, right teats, and pre-umbilical teats, were recorded between 2015 and 2022. The total teat count was calculated as: Total teat count = Number of left teats + Number of right teats. After filtering for abnormal phenotypic data, teat count trait observations from 15,214 pigs were obtained for phenotypic and genotypic association analysis.

[0039] (2) Genotyping and Quality Control

[0040] Ear tissue or blood samples were collected from breeding pigs, and total DNA was extracted. Genotyping of qualified DNA samples was performed using a porcine 80K functional locus gene chip [shadow gene, CHN, DNBSEQ-T7 (BGI Genomics)]. Quality control was performed using PLINKv2.0 software under the following conditions: removal of SNP loci at unknown locations and on sex chromosomes, with an individual detection rate ≥90%; SNP detection rate ≥90%; minimum allele frequency ≥0.01; Hardy-Weinberg equilibrium P-value ≥10. -6 The missing loci were identified. Genotypes for the missing loci were filled using Beagle software (version 4.1). After filling, quality control was performed again under the same conditions as before. This yielded 7506 pigs with both phenotypic and genotypic data for subsequent analysis.

[0041] (3) Principal component analysis and quality control

[0042] This application uses PLINKv2.0 software to evaluate the population structure. Principal Component Analysis (PCA) was performed on the quality-controlled SNP chip data. The first five principal component features were calculated, and the first three principal components were used to plot the principal component results. Since Danish Landrace and Chinese Landrace could not be distinguished in the first three principal components, they were analyzed as a single population in subsequent analyses. Based on the results, discrete populations outside the 95% confidence interval were removed. Finally, data from 7338 pigs in five populations—Danish-Chinese Landrace, Topco Landrace, Danish Large White, Chinese Large White, and Topco Large White—were used for subsequent analysis. Raw chip data for five populations were extracted from the raw chip data. Quality control-filling-quality control were performed using PLINK v2.0 and Beagle software (version 4.1), with the same operation steps and quality control conditions as before. The final data analysis yielded 3729 Danish Large Whites with 74147 SNPs, 250 Chinese Large Whites with 100066 SNPs, 263 Topek Large Whites with 94946 SNPs, 2914 Danish and Chinese Long Whites with 88625 SNPs, and 182 Topek Long Whites with 69752 SNPs.

[0043] (4) Statistical Model

[0044] 4.1 Genome-wide association analysis model

[0045] This application used univariate mixed linear models in GEMMA software to perform genome-wide association analysis on the nipple number trait in the five populations. The univariate mixed linear models are as follows:

[0046] y = Wα + Xβ + μ + ε

[0047] Where y is the phenotypic vector, W is the indicator matrix of fixed effects and covariates, including gender, field, year / season and the first three principal component features of PCA, α is the corresponding correlation coefficient in each fixed effect, X is the indicator matrix of SNP, β represents the effect vector of SNP, μ is the n×1 random effects matrix, and ε represents the residuals.

[0048] 4.2 Meta-analysis model

[0049] This application uses METAL software to perform a meta-analysis by combining the weights of the GWAS results from the five populations. Based on METAL software, the effect direction and p-value of the target population are converted into Z-scores. The formula for calculating the Z-test statistic (Z-scores) is as follows:

[0050]

[0051] Where Pi is the P-value of the i-th group, Δi represents the direction of the effect of the i-th group, and Ni is the sample size of the i-th group.

[0052] (5) Marking and filtering

[0053] The meta-analysis results were processed, and the false discovery rate (FDR) was used to correct the results. The FDR was set to 0.01, and the threshold formula was as follows:

[0054] P = FDR × n / m

[0055] Where FDR is the set value of 0.01, n is the number of sites with a P value less than 0.01 in the GWAS results, and m is the total number of SNP sites after quality control.

[0056] A Manhattan plot was drawn for the effect values ​​of all the above markers, displaying and filtering SNP markers below the threshold. The results are as follows: Figure 1 and 2 As shown, Figure 1 The middle plot is the Manhattan plot of the meta-GWAS of the right nipple count trait. Figure 2The Manhattan plot of the meta-GWAS for the total nipple count trait identified four SNP molecular markers associated with the porcine nipple count trait: yz_8_47855059, rs341593917, yz_rs81341835, and yz_17_607635.

[0057] The molecular marker yz_8_47855059, as described in Ensembl (Sscrofa11.1), is located at position 47855059 bp on chromosome 8 of the pig genome in the EnsemblSscrofa11.1 version. This position represents a C>T base mutation. The nucleotide sequences of the 100 bp upstream and downstream of this SNP marker are shown in SEQ ID No:1, where the 101st base... M(C / T) Indicates a C>T base mutation:

[0058] TACCTTGCCCTGYTGGGGCTTCCCAGGCATCACTTGCCTTTTTGTGTC

[0059] AGGATCAGAAAACAACGAGGGGAAGAAAGGGGAGGAGCACTTATTT CAGCTG M(C / T )GTGATGGCAACCCAGGGGAAGGTTGGTTAGGAGACT ATAGCAATGTTGACTCAATTTAGTTTTGGACAAGTTTATCCAGAAGGCAAACTTGACTTTCTTG.

[0060] The molecular marker rs341593917, as described in Ensembl (Sscrofa11.1), is located at position 47369817 bp on chromosome 12 of the pig genome in the EnsemblSscrofa11.1 version. This position represents an A>G base mutation. The nucleotide sequences of the 100 bp upstream and downstream of this SNP marker are shown in SEQ ID No:2, where the 101st base... M(A / G) This indicates an A>G base mutation:

[0061] RCTCGGAGGTGGGGGATGGCACTTGWACTTGGAACCTGGGAAGTGR

[0062] GCCAAKGGACCRGGRTGACCGGGGACAGTGTCTTGTGTCCCTAGGGG AGTGAAC M(A / G)AGGGTGAACTTCYTGTAGTGGTCTGGGCAGATGCY GAGKCAGGGGAGGTTTCCATGCCATCCAGGGGCCATGAGAGATGCCCTCAGTGGAGGGGCCACGT.

[0063] The molecular marker yz_rs81341835, as described in Ensembl (Sscrofa11.1), is located at position 135350586 bp on chromosome 15 of the pig genome in the EnsemblSscrofa11.1 version. This position represents a T>C base mutation. The nucleotide sequences of the 100 bp upstream and downstream of this SNP marker are shown in SEQ ID No:3, where the 101st base... M(T / C) Indicates T>C base mutation: CGCCAGGCCCAGGTGACCYGCCCTCGCCTGCGATGGAGACCAGAGGT GTCACCCTGTTTCGGCTCCTGGAGATGGGACCACAAAAGCTGCAGGC ACTAMG M(T / C) TGGGGTGACAGACATCATGAAAGCCAGGGAGGAAA GCAATCAGGGACCAAGGCCACGTCCACCAGGCAAAGCCAGAGTCAG GGCCAGGCCAGCTCTCTGA.

[0064] The molecular marker yz_17_607635, as described in Ensembl (Sscrofa11.1), is located at position 607635 bp on chromosome 17 of the pig genome in the EnsemblSscrofa11.1 version. This position represents a T>A base mutation. The nucleotide sequences of the 100 bp upstream and downstream of this SNP marker are shown in SEQ ID No:4, where the 101st base... M(T / A) This indicates a T>A base mutation:

[0065] TGCTTTATCTAATATAGGCAGGKRAAAAAAAGAGAGTTGGAGAGTCTT

[0066] CGTCCTTTATCACAGAGAAGCCCCACCTATAATCCTCACATTCCCACCT CAA M(T / A) CATCCAAGCCAGCTGAACAAATCTATCCCACCTCCCACAC AACCTGCYTAAACAACGTAAAACAGATCACCGAGCCCATGTCAAAGG AAAGAGTGTCCTA.

[0067] Using the nucleotide sequences containing SNP molecular markers that affect the number of teats in pigs, primers or probes can be designed to detect the genotype of the corresponding SNP molecular marker. Then, based on the detection results, further selection can be made for the number of teats in sows. Alternatively, primers can be designed using these nucleotide sequences to create corresponding detection kits for direct detection of SNP molecular markers, and then selection can be made for the number of teats in sows based on the detected genotypes.

[0068] Example 2: Association Analysis of Molecular Markers and the Number of Piglet Traits

[0069] 2.1 Association analysis between the molecular marker yz_8_47855059 and the number of pig nipples

[0070] Association analysis between the molecular marker yz_8_47855059 and the number of pig nipples was conducted using analysis of variance and multiple comparisons (R statistical analysis platform) to analyze the differences in the number of left nipples, right nipples, and total nipples among different genotype populations (Table 1).

[0071] Table 1. Association analysis of porcine nipple number trait with different genotypes using the molecular marker yz_8_47855059.

[0072]

[0073]

[0074] Note: P<0.05 indicates a significant difference, and P<0.01 indicates a highly significant difference.

[0075] As shown in Table 1, when the genotype is TT, the number of left teats, right teats, and total teats are all significantly higher than those of the CT and CC genotypes (p<0.01). In the left teat count trait, the TT genotype had 0.34 more teats than the CC genotype; in the right teat count trait, the TT genotype had 0.40 more teats than the CC genotype; and in the total teat count trait, the TT genotype had 0.75 more teats than the CC genotype. Therefore, when the mutant base in the molecular marker yz_8_47855059 is T, the pig may have a greater number of teats. Thus, T is the dominant allele, and the TT genotype is the dominant allele, which should be retained during breeding.

[0076] 2.2 Association analysis between the rs341593917 molecular marker and the number of pig nipples

[0077] Association analysis between the rs341593917 molecular marker and the number of pig nipples was conducted using analysis of variance and multiple comparisons (R statistical analysis platform) to analyze the differences in the number of left nipples, right nipples, and total nipples among different genotype populations (Table 2).

[0078] Table 2. Association analysis of nipple number trait in different genotypes of the molecular marker rs341593917 in breeding pigs.

[0079]

[0080] Note: P<0.05 indicates a significant difference, and P<0.01 indicates a highly significant difference.

[0081] As shown in Table 2, when the genotype is GG, the number of left teats, right teats, and total teats are all significantly higher than those of the AG and AA genotypes (p<0.01). In the left teat count trait, the GG genotype had 0.06 more teats than the AA genotype; in the right teat count trait, the GG genotype had 0.08 more teats than the AA genotype; and in the total teat count trait, the GG genotype had 0.14 more teats than the AA genotype. Therefore, when the mutant base in the rs341593917 molecular marker is G, the pig may have a greater number of teats. Thus, G is the dominant allele, and the GG genotype is the dominant allele, which should be retained during breeding.

[0082] 2.3 Association analysis between the molecular marker yz_rs81341835 and the number of pig nipples

[0083] Association analysis between the molecular marker yz_rs81341835 and the number of pig nipples was conducted using analysis of variance and multiple comparisons (R statistical analysis platform) to analyze the differences in the number of left nipples, right nipples, and total nipples among different genotype populations (Table 3).

[0084] Table 3. Association analysis of nipple number trait in different genotypes of the molecular marker yz_rs81341835 in breeding pigs.

[0085]

[0086] Note: P<0.05 indicates a significant difference, and P<0.01 indicates a highly significant difference.

[0087] As shown in Table 3, when the genotype is CC, the number of left teats, right teats, and total teats are all significantly higher than those of the CT and TT genotypes (p<0.01). In the left teat count trait, the CC genotype had 0.39 more teats than the TT genotype; in the right teat count trait, the CC genotype had 0.41 more teats than the TT genotype; and in the total teat count trait, the CC genotype had 0.81 more teats than the TT genotype. Therefore, when the mutation base in the yz_rs81341835 molecular marker is C, the pig may have a greater number of teats. Thus, C is the dominant allele, and the CC genotype is the dominant allele, which should be retained during breeding.

[0088] Association analysis between the molecular marker 2.4yz_17_607635 and the number of pig nipples.

[0089] Association analysis between the molecular marker yz_17_607635 and the number of pig nipples was conducted using analysis of variance and multiple comparisons (R statistical analysis platform) to analyze the differences in the number of left nipples, right nipples, and total nipples among different genotype populations (Table 4).

[0090] Table 4. Association analysis of nipple number trait in different genotypes of pigs using molecular marker yz_17_607635

[0091]

[0092] Note: P<0.05 indicates a significant difference, and P<0.01 indicates a highly significant difference.

[0093] As shown in Table 4, when the genotype is TT, the number of left teats, right teats, and total teats are all significantly higher than those of the AT and AA genotypes (p<0.01). In the left teat count trait, the TT genotype had 0.09 more teats than the AA genotype; in the right teat count trait, the TT genotype had 0.07 more teats than the AA genotype; and in the total teat count trait, the TT genotype had 0.17 more teats than the AA genotype. Therefore, when the mutant base in the yz_17_607635 molecular marker is T, the pig may have a greater number of teats. Thus, T is the dominant allele, and the TT genotype is the dominant allele, which should be retained during breeding.

[0094] Example 3: Application of SNP molecular markers in breeding sow breeds with multiple nipple counts

[0095] S1: Detect one or more SNP molecular markers from yz_8_47855059, rs341593917, yz_rs81341835, and yz_17_607635 in replacement gilts;

[0096] S2: Select individuals whose molecular marker yz_8_47855059 allele genotype is TT in step S1, and use them as breeding sows;

[0097] Alternatively, individuals whose rs341593917 molecular marker allele genotype is GG in step S1 can be selected as breeding sows and then mated with them.

[0098] Alternatively, individuals whose molecular marker yz_rs81341835 allele genotype is CC are selected in step S1 and used as breeding sows, and these breeding sows are then bred.

[0099] Alternatively, individuals whose molecular marker yz_17_607635 allele genotype is TT are selected in step S1 and used as breeding sows, and these breeding sows are then bred.

[0100] S3: Test the piglets born from mating in step S2 for one or more SNP molecular markers from yz_8_47855059, rs341593917, yz_rs81341835, and yz_17_607635, and retain them for breeding according to the genotypes described in step S2. Then, breed them to cultivate a sow breed with multiple teats.

[0101] Example 4: Application of SNP molecular markers in improving the teat number trait in sows

[0102] S1: Detect one or more SNP molecular markers from yz_8_47855059, rs341593917, yz_rs81341835, and yz_17_607635 in replacement gilts;

[0103] S2: Select individuals whose molecular marker yz_8_47855059 allele genotype is TT in step S1, and use them as breeding sows;

[0104] Alternatively, individuals whose rs341593917 molecular marker allele genotype is GG in step S1 can be selected as breeding sows and then mated with them.

[0105] Alternatively, individuals whose molecular marker yz_rs81341835 allele genotype is CC are selected in step S1 and used as breeding sows, and these breeding sows are then bred.

[0106] Alternatively, individuals whose molecular marker yz_17_607635 allele genotype is TT are selected in step S1 and used as breeding sows, and these breeding sows are then bred.

[0107] S3: Test the piglets born from mating in step S2 for one or more SNP molecular markers from yz_8_47855059, rs341593917, yz_rs81341835, and yz_17_607635. Then, retain the piglets according to the genotypes described in step S2 and carry out breeding. Retain individuals with the dominant genotype in the offspring pigs and eliminate individuals with other genotypes to increase the frequency of the dominant alleles generation by generation, thereby increasing the number of teats in the sow population and improving the number of teats in the offspring sows.

Claims

1. Application of SNP molecular markers affecting the number of teats in the breeding of Large White or Landrace sows with multiple teat counts, among which, The SNP molecular marker is a T>C mutation located at position 135350586 bp on chromosome 15 of the porcine genome Ensembl Sscrofa 11.1 version. The Large White sows are Danish Large White, Chinese Large White, and Toppen Large White, and the Landrace sows are Danish Landrace, Chinese Landrace, and Toppen Landrace. The application includes the following steps: S1: Detection of the SNP molecular markers in replacement gilts; S2: Select individuals with the CC genotype at the 135350586bp position on chromosome 15, as detected in step S1, and use them as breeding sows; S3: Test the SNP molecular markers on the piglets born from mating in step S2, retain them for breeding according to the genotypes described in step S2, and then breed them to cultivate a sow breed with multiple teats.

2. Application of SNP molecular markers affecting the number of teats in large white or landrace sows in improving the teat number trait. The SNP molecular marker is a T>C mutation located at position 135350586 bp on chromosome 15 of the porcine genome Ensembl Sscrofa 11.1 version. The Large White sows are Danish Large White, Chinese Large White, and Toppen Large White, and the Landrace sows are Danish Landrace, Chinese Landrace, and Toppen Landrace. The application includes the following steps: S1: Detection of the SNP molecular markers in replacement gilts; S2: Select individuals with the CC genotype at the 135350586bp position on chromosome 15, as detected in step S1, and use them as breeding sows; S3: Test the SNP molecular markers on the piglets born from mating in step S2, and retain them for breeding according to the genotypes described in step S2. Then breed them, retain the dominant genotype individuals in the offspring pigs, and eliminate other genotypes, so as to increase the frequency of dominant alleles generation by generation, thereby increasing the number of teats in the sow population and improving the number of teats in the offspring sows.

3. Application of SNP molecular markers affecting the number of teats in the detection / screening / identification of the number of teats in Large White or Landrace sows, among which, The SNP molecular marker is a T>C mutation located at position 135350586bp on chromosome 15 of the pig genome Ensembl Sscrofa 11.1 version, with CC genotype being the dominant allele. The Large White sows are Danish Large White, Chinese Large White, and Toppen Large White, and the Landrace sows are Danish Landrace, Chinese Landrace, and Toppen Landrace.

Images