Treatment of nervous system diseases using modulators of UNC13A gene transcript

Abstract

Disclosed herein are UNC13A oligonucleotides having one or more spacer regions or having no spacer regions. In various embodiments, UNC13A oligonucleotides with spacer regions can reduce misspliced UNC13A transcripts and increase full-length UNC13A transcripts, resulting in therapeutic efficacy against neurological diseases such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or Alzheimer's disease (AD).

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 285,786, filed on December 3, 2021, U.S. Provisional Application No. 63 / 350,206, filed on June 8, 2022, and U.S. Provisional Application No. 63 / 398,987, filed on August 18, 2022, which are hereby incorporated by reference in their entireties for all purposes. Technical Field

[0002] The present application generally relates to methods of treating neurological diseases using UNC13A splice-switching antisense oligonucleotides, particularly UNC13A antisense oligonucleotides having one or more spacers that target UNC13A transcripts. Background Art

[0003] Motor neuron disease is a class of neurological diseases (neurological disease) that causes motor neurons to degenerate and die, and these neurons coordinate the spontaneous movement of muscles by the brain. Motor neuron disease can be sporadic or hereditary, and can affect upper motor neurons and / or lower motor neurons. Motor neuron disease includes amyotrophic lateral sclerosis, progressive bulbar palsy, pseudobulbar palsy, primary lateral sclerosis, progressive muscular atrophy, spinal muscular atrophy and post-polio syndrome.

[0004] Amyotrophic lateral sclerosis (ALS) is a group of motor neuron diseases that affects approximately 15,000 individuals in the United States. ALS is characterized by the degeneration and death of upper and lower motor neurons, resulting in a loss of voluntary muscle control. Motor neuron death is accompanied by muscle fasciculations and atrophy. Early symptoms of ALS include muscle cramps, muscle spasticity, muscle weakness (for example, affecting the arms, legs, neck, or diaphragm), slurred and nasal speech, and difficulty chewing or swallowing. Eventually, patients lose strength and control of movements, including those needed to speak, eat, and breathe. Disease progression can be accompanied by weight loss, malnutrition, anxiety, depression, an increased risk of pneumonia, muscle cramps, neuropathy, and possibly dementia. Most individuals diagnosed with ALS die from respiratory failure within 5 years of the first onset of symptoms. Currently, there is no effective treatment for ALS.

[0005] ALS occurs in people of all ages but is most common between the ages of 55 and 75, with a slightly higher incidence in men. ALS can be sporadic or familial. Sporadic ALS appears to occur randomly and accounts for over 90% of all ALS cases. Familial ALS accounts for 5-10% of all ALS cases.

[0006] FTD refers to a series of progressive neurodegenerative diseases caused by the loss of neurons in the frontal and temporal lobes of the brain. FTD is the third most common form of dementia (after Alzheimer's disease and Lewy body dementia) and the second most common form of dementia in individuals under 65 years old. It is estimated that FTD affects 50,000 to 60,000 individuals in the United States. FTD is characterized by changes in behavior and personality and language dysfunction. Forms of FTD include behavioral variant FTD (bvFTD), semantic variant primary progressive aphasia (svPPA) and non-fluent variant primary progressive aphasia (nfvPPA). ALS with FTD is characterized by symptoms associated with FTD, as well as symptoms of ALS such as muscle weakness, atrophy, fasciculations, muscle spasticity, speech disorders (dysarthria) and inability to swallow (dysphagia). Individuals usually die from FTD within 5 to 10 years, while ALS with FTD usually leads to death within 2 to 3 years of the first onset of disease symptoms.

[0007] As with ALS, there is currently no known cure for FTD or ALS with FTD, and no known treatments to prevent or slow the progression of either disease.

[0008] Therefore, there is an urgent need to identify compounds and / or compositions that can prevent, ameliorate and treat neurological diseases, such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injury (e.g., brachial plexus injury), neuropathies (e.g., chemotherapy-induced neuropathy), TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry syndrome, Lewy body dementia associated with Alzheimer's disease, Parkinson's disease with or without dementia, and limbic system-dominant age-related TDP-43 encephalopathy (LATE)), epilepsy, brain age-related TDP-43 with sclerosis (CARTS), facial onset sensory motor neuronopathy, Guam Parkinsonism and Dementia syndrome, multisystem proteinopathies, CTE and synaptic diseases such as autism. Summary of the Invention

[0009] Described herein are oligonucleotides comprising one or more spacers and comprising a sequence that is at least 85% complementary to an equal length portion of a UNC13A transcript. In one aspect, the present disclosure provides UNC13A oligonucleotides that target UNC13A transcripts (e.g., mis-spliced ​​UNC13A transcripts). In various embodiments, oligonucleotides targeting transcripts are used to treat neurological diseases, including motor neuron disease and / or neuropathy. For example, UNC13A oligonucleotides can be used to treat PD, ALS, FTD, ALS with FTD, and AD.

[0010] In one aspect, the present disclosure provides a compound comprising a modified oligonucleotide comprising an isolongated portion of any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208, a sequence having 90% identity thereto, or a sequence at least 85% complementary to a 15 to 50 consecutive nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside bond of the oligonucleotide is a non-natural bond. In various embodiments, the oligonucleotide comprises a spacer.

[0011] In one aspect, present disclosure provides a kind of compound comprising the oligonucleotide of modification, the oligonucleotide of described modification comprises and SEQ ID NO:5057-5065 or SEQ ID NO:5206-5208 any one of isometric portion, with its sequence of 90% homogeneity or its 15 to 50 continuous core base part at least 85% complementary sequence, wherein at least one (i.e. one or more) nucleoside bond of oligonucleotide is non-natural bond, and wherein oligonucleotide comprises spacer.In various embodiments, oligonucleotide comprises section with at most 11 connection nucleosides.In various embodiments, oligonucleotide comprises section with at most 10,9 or 8 connection nucleosides.In various embodiments, oligonucleotide comprises section with at most 7 connection nucleosides.In certain embodiments, oligonucleotide comprises section with at most 6,5,4,3 or 2 connection nucleosides.In certain embodiments, each section of oligonucleotide comprises at most 7 connection nucleosides.

[0012] In various embodiments, the oligonucleotide comprises a sequence that is at least 85% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292. In various embodiments, the oligonucleotide comprises a sequence that is at least 90% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292. In various embodiments, the oligonucleotide comprises a sequence that is 95% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292. In various embodiments, the oligonucleotide comprises a sequence that is 100% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292.

[0013] In various embodiments, the oligonucleotide comprises a segment of up to 11 linked nucleosides or up to 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence that is at least 85% identical to an equal length portion of any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208. In various embodiments, the oligonucleotide comprises a segment of up to 6, 5, 4, 3, or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence that is at least 85% identical to an equal length portion of any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208. In various embodiments, the oligonucleotide comprises a segment of up to 6, 5, 4, 3, or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence that is at least 90% identical to an equal length portion of any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208.

[0014] In various embodiments, the oligonucleotide is at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 19 oligonucleotide units in length. In various embodiments, the spacer is a nucleoside surrogate group comprising a non-sugar substituent that cannot be attached to a nucleotide base.

[0015] In various embodiments, the spacer is located between positions 10 and 15 of the oligonucleotide. In various embodiments, the spacer is located between positions 7 and 11 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 14 and 22 of the oligonucleotide. In various embodiments, the spacer and the second spacer in the oligonucleotide are separated by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases. In various embodiments, the spacer is located between positions 7 and 9 of the oligonucleotide, and wherein the second spacer is located between positions 15 and 18 of the oligonucleotide. In various embodiments, the spacer is located between position 8 of the oligonucleotide, and wherein the second spacer is located at position 16 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 21 and 24 of the oligonucleotide.

[0016] In various embodiments, the oligonucleotide further comprises a second spacer, wherein the second spacer is between the position 2 and 5 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer, wherein the second spacer is between the position 8 and 12 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a third spacer, wherein the third spacer is between the position 18 and 22 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer and a third spacer, wherein the position of the three spacers in the oligonucleotide makes each section of the oligonucleotide have at most 7 connection nucleosides. In various embodiments, at least two of the three spacers are adjacent to the guanine core base. In various embodiments, each of the at least two spacers in the three spacers is immediately before the guanine core base.

[0017] In various embodiments, each of the first spacer, the second spacer, or the third spacer is a nucleoside surrogate group comprising a non-sugar substituent, wherein the non-sugar substituent does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal, or hemiaminal moiety and is incapable of forming a covalent bond with a nucleotide base.

[0018] In certain embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by formula (X), wherein: Ring A is an optionally substituted 4-8 membered monocyclic cycloalkyl or 4-8 membered monocyclic heterocyclyl, wherein the heterocyclyl contains 1 or 2 heteroatoms selected from O, S and N, provided that A cannot form a covalent bond with a nucleobase; and The symbol indicates the point of attachment to the internucleoside bond.

[0019] In various embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by formula (Xa), wherein:

[0020] In some embodiments, ring A is an optionally substituted 4-8 membered monocyclic cycloalkyl selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl; or a 4-8 membered monocyclic heterocyclyl selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl and azepanyl.

[0021] In other embodiments, Ring A is tetrahydrofuranyl.

[0022] In other embodiments, Ring A is tetrahydropyranyl.

[0023] In various embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by Formula I, wherein: X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.

[0024] In various embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by Formula I', wherein: X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.

[0025] In various embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by Formula (Ia), wherein: as well as n is 0, 1, 2 or 3.

[0026] In various embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by Formula (Ia'), wherein: as well as n is 0, 1, 2 or 3.

[0027] In certain embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by Formula II, wherein: as well as X is selected from -CH2- and -O-.

[0028] In other embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by Formula II', wherein: as well as X is selected from -CH2- and -O-.

[0029] In various embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by Formula (Iia), wherein:

[0030] In other embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by formula (Iia'), wherein:

[0031] In some embodiments, the spacer is represented by formula (III), wherein: X is selected from -CH2- and -O-.

[0032] In some embodiments, the spacer is represented by formula (III'), wherein: X is selected from -CH2- and -O.

[0033] In some embodiments, the spacer is represented by formula (IIIb), wherein:

[0034] In some embodiments, the spacer is represented by formula (Iiib'), wherein:

[0035] In various embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by Formula III, wherein: as well as X is selected from -CH2- and -O-.

[0036] In other embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by Formula III', wherein: as well as X is selected from -CH2- and -O-.

[0037] In some embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by formula (IIIa), wherein:

[0038] In other embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by formula (IIIa'), wherein:

[0039] In various embodiments, the oligonucleotide comprising a spacer has a GC content of at least 10%. In various embodiments, the oligonucleotide comprising a spacer has a GC content of at least 20%. In various embodiments, the oligonucleotide comprising a spacer has a GC content of at least 25%. In various embodiments, the oligonucleotide comprising a spacer has a GC content of at least 30%. In various embodiments, the oligonucleotide comprising a spacer has a GC content of at least 40%. In various embodiments, the oligonucleotide comprising a spacer has a GC content of at least 50%.

[0040] In various embodiments, the oligonucleotide is from 12 to 40 oligonucleotide units in length.

[0041] In various embodiments, at least one (i.e., one or more) nucleoside linkages of an oligonucleotide are independently selected from a phosphodiester linkage, a phosphorothioate linkage, an alkylphosphoester linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropylphosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylenephosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a thiophosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., including phosphorodiamidate morpholino (PMO), a 3' aminoribose, or a 5' aminoribose) linkage, an aminoalkylphosphoamidate linkage, a thiophosphoramidate linkage, a thioalkylphosphonate linkage, a thioalkylphosphotriester linkage, a phosphorothioate linkage, a selenophosphate linkage, and a boranophosphate linkage.

[0042] In various embodiments, one or more nucleoside bonds connecting the base at position 3 or position 4 of the oligonucleotide are phosphodiester bonds. In various embodiments, only one nucleoside bond connecting the base at position 3 or position 4 of the oligonucleotide is a phosphodiester bond. In various embodiments, the nucleoside bond connecting the base at position 3 and position 4 of the oligonucleotide is a phosphodiester bond. In various embodiments, one or more bases immediately before the spacer in the oligonucleotide are connected by a phosphodiester bond. In various embodiments, only the base immediately before the spacer in the oligonucleotide is connected with the spacer by a phosphodiester bond. In various embodiments, the base immediately before the spacer in the oligonucleotide is further connected with another preceding base by a phosphodiester bond. In various embodiments, the oligonucleotide comprises a second spacer, and the base wherein immediately before the second spacer is connected with another preceding base by a phosphodiester bond.

[0043] In various embodiments, one or more bases immediately after the spacer in the oligonucleotide are connected by a phosphodiester bond. In various embodiments, only the base immediately after the spacer in the oligonucleotide is connected to the spacer by a phosphodiester bond. In various embodiments, two bases immediately before the spacer in the oligonucleotide are connected by a phosphodiester bond. In various embodiments, one or more bases immediately before the spacer in the oligonucleotide are connected by a phosphodiester bond, and wherein one or more bases immediately after the spacer in the oligonucleotide are connected by a phosphodiester bond. In various embodiments, a base immediately before the spacer and a base immediately after the spacer are connected by a phosphodiester bond. In various embodiments, the oligonucleotide includes a second spacer, and wherein the one or more bases immediately before the second spacer in the oligonucleotide are connected by a phosphodiester bond, and wherein the one or more bases immediately after the second spacer in the oligonucleotide are connected by a phosphodiester bond. In various embodiments, a base immediately before the second spacer and a base immediately after the second spacer are connected by a phosphodiester bond. In various embodiments, the oligonucleotide comprises a series of bases connected by a phosphodiester bond, and the series of bases comprises at least two bases. In various embodiments, the oligonucleotide comprises a series of bases connected by a phosphodiester bond, and the series of bases comprises at least five bases. In various embodiments, the oligonucleotide comprises two or more spacers, and wherein the series of bases is located between at least two spacers.

[0044] Further disclosed herein is a compound comprising an oligonucleotide comprising a nucleobase sequence that is at least 90% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292. Further disclosed herein is an oligonucleotide comprising a nucleobase sequence that is at least 90% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292. In various embodiments, the nucleobase is at least 95% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292. In various embodiments, the nucleobase is at least 100% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292. In various embodiments, the oligonucleotide is any one of a 19mer, a 21mer, a 23mer, or a 25mer.

[0045] In various embodiments, the internucleoside bond of an oligonucleotide is a modified internucleoside bond. In various embodiments, the internucleoside bond of an oligonucleotide is a phosphorothioate bond. In various embodiments, the internucleoside bond of all oligonucleotides is a phosphorothioate bond. In various embodiments, the phosphorothioate bond is one of Rp configuration or Sp configuration. In various embodiments, an oligonucleotide comprises a sugar moiety that is modified at least one. In various embodiments, the modified sugar moiety is one of the following: a 2'-OMe modified sugar moiety, a bicyclic sugar moiety, a 2'-O-(2-methoxyethyl) (MOE), a 2'-deoxy-2'-fluoro nucleoside, a 2'-fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid (tcDNA) (e.g., a tricyclic nucleic acid having an ethyl (2'O-CH2-CH2-4'C) as a bridge or a tricyclic nucleic acid having a methyl substituted methyl (2'O-CH(CH2)-4'C) bridge), a constrained ethyl 2'-4'-bridge nucleic acid (cEt), S-cEt, tcDNA, a hexitol nucleic acid (HNA), a tricyclic analog (e.g., tcDNA), and a non-locked nucleic acid.

[0046] In various embodiments, the oligonucleotide exhibits an increase of at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the full-length UNC13A protein. In various embodiments, the oligonucleotide exhibits an increase of at least 100% of the full-length UNC13A protein. In various embodiments, the oligonucleotide exhibits an increase of at least 200% of the full-length UNC13A protein. In various embodiments, the oligonucleotide exhibits an increase of at least 300% of the full-length UNC13A protein. In various embodiments, the oligonucleotide exhibits an increase of at least 400% of the full-length UNC13A protein. In various embodiments, the increase in full-length UNC13A protein is measured as compared to the reduced level of full-length UNC13A protein achieved using a TDP43 antisense oligonucleotide. In various embodiments, the oligonucleotides exhibit at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full-length UNC13A protein. In various embodiments, the oligonucleotides exhibit at least 50%, 60%, 70%, 80%, or 90% reduction of mis-spliced ​​UNC13A transcripts.

[0047] Additionally disclosed is a method of treating a neurological disease and / or a neuropathy in a patient in need thereof, the method comprising administering to the patient any of the oligonucleotides disclosed above. In various embodiments, the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injury (e.g., brachial plexus injury), neuropathy (e.g., chemotherapy-induced neuropathy), TDP43 proteinopathy (e.g., chronic traumatic encephalopathy, Perry syndrome, Lewy body dementia associated with Alzheimer's disease, Parkinson's disease with or without dementia, and age-related TDP-43 encephalopathy (LATE) predominantly limbic), epilepsy, brain age-related TDP-43 with sclerosis (CARTS), facial onset sensory motor neuronopathy, Guam Parkinsonism and Dementia syndrome, multisystem proteinopathy, CTE, and synaptic diseases such as autism. In various embodiments, the neurological disease is ALS. In various embodiments, the neurological disease is FTD. In various embodiments, the neurological disease is ALS with FTD. In various embodiments, the neurological disease is AD. In various embodiments, the neurological disease is PD. In various embodiments, the neuropathy is chemotherapy-induced neuropathy.

[0048] Also disclosed is a method for restoring neuronal axonal growth and / or regeneration, comprising exposing a motor neuron to any of the above oligonucleotides. Also disclosed is a method for increasing, promoting, stabilizing or maintaining UNC13A expression and / or function in a neuron, comprising exposing a cell to any of the above oligonucleotides.

[0049] In various embodiments, the neuron is a neuron in a patient who needs to treat a neurological disease and / or a neuropathy. In various embodiments, the neuropathy is a chemotherapy-induced neuropathy. In various embodiments, exposure is carried out in vivo or in vitro. In various embodiments, exposure includes administering an oligonucleotide to a patient in need. In various embodiments, the oligonucleotide is administered topically, parenterally, intrathecally, intrathalamus, intracisternal, orally, rectal, buccal (buccally), sublingually, vaginally, pulmonary, intratracheally, intranasally, transdermally, or intraduodenally. In various embodiments, the oligonucleotide is administered orally. In various embodiments, the oligonucleotide is administered intrathecally, intrathalamus, or intracisternal for a therapeutically effective amount. In various embodiments, the patient is a human.

[0050] Further disclosed herein is a pharmaceutical composition comprising any one of the oligonucleotides disclosed above, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient. In various embodiments, the pharmaceutical composition is suitable for topical, intrathecal, intrathalamic, intracisternal, intraventricular, parenteral, oral, pulmonary, intratracheal, intranasal, transdermal, rectal, buccal, sublingual, vaginal, or intraduodenal administration.

[0051] Additionally disclosed herein is a method of treating a neurological disease or neuropathy in a patient in need thereof, comprising administering to the patient in need thereof a therapeutically effective amount of the pharmaceutical composition disclosed above. In various embodiments, the neurological disease is selected from amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Parkinson's disease with dementia, dementia with Lewy bodies, synucleinopathy, Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, tuberous sclerosis, Pick's disease, tauopathy, primary age-related tauopathy, Down syndrome, epilepsy / seizures, depression, traumatic brain injury (TBI), chronic traumatic encephalopathy (CTE), HIV-associated neurocognitive disorder (HAND), multiple system atrophy, amnestic mild cognitive impairment, corticobasal degeneration (CBD) and / or a neuropathy such as chemotherapy-induced neuropathy, spinocerebellar ataxia (SCA), SCA In various embodiments, the neurological disease is ALS. In various embodiments, the neurological disease is FTD. In various embodiments, the neurological disease is ALS with FTD. In various embodiments, the neurological disease is ALS with FTD. In various embodiments, the neuropathy is chemotherapy-induced neuropathy. In various embodiments, the pharmaceutical composition is administered topically, parenterally, orally, pulmonary, rectal, buccal, sublingual, vaginal, intratracheal, intranasal, intracisternal, intrathecal, intrathalamic, intravenous, intramuscular, transdermal, or intraduodenally. In various embodiments, wherein the pharmaceutical composition is administered intrathecally, intrathalamically, intraventricularly, or intracisternal. In various embodiments, a therapeutically effective amount of the oligonucleotide is administered intrathecally, intrathalamically, or intracisternal. In various embodiments, the patient is a human.

[0052] Further disclosed herein is a method for treating a neurological disease in a subject in need thereof, comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide is conjugated to SEQ ID NO: 1-1264, SEQ ID NO: 2529-3792, SEQ ID NO: 5066-5166, SEQ ID NO: 5168-5202, SEQ ID NO: 5209-5221, or SEQ ID NO: 5260-5261. any one of NOs: 5235-5292 having at least 85% identity; wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are independently selected from a phosphodiester linkage, a phosphorothioate linkage, an alkylphosphoester linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropylphosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylenephosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a thiophosphoramidate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate ester (e.g., including morpholinophosphorodiamidate (PMO), 3' aminoribose or 5' aminoribose) linkage, an aminoalkylphosphodiamidate linkage, thiophosphoramidate linkages, thioalkylphosphonate linkages, thioalkylphosphotriester linkages, phosphorothioate linkages, selenophosphate linkages and boranophosphate linkages, and / or wherein at least one (i.e., one or more) nucleosides are substituted with a component selected from the group consisting of 2'-O-(2-methoxyethyl) nucleosides, 2'-O-methyl nucleosides, 2'-O-(N-methylacetamide) nucleosides, 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabino nucleosides, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET) and peptide nucleic acids (PNA), optionally wherein the oligonucleotide further comprises a spacer.

[0053] Further disclosed herein is a method for treating ALS in a subject in need thereof, comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide is conjugated to SEQ ID NO: 1-1264, SEQ ID NO: 2529-3792, SEQ ID NO: 5066-5166, SEQ ID NO: 5168-5202, SEQ ID NO: 5209-5221, or SEQ ID NO: 5230. any one of NOs: 5235-5292 having at least 85% identity; wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are independently selected from a phosphodiester linkage, a phosphorothioate linkage, an alkylphosphoester linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropylphosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylenephosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a thiophosphoramidate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate ester (e.g., including morpholinophosphorodiamidate (PMO), 3' aminoribose or 5' aminoribose) linkage, an aminoalkylphosphodiamidate linkage, thiophosphoramidate linkages, thioalkylphosphonate linkages, thioalkylphosphotriester linkages, phosphorothioate linkages, selenophosphate linkages and boranophosphate linkages, and / or wherein at least one (i.e., one or more) nucleosides are substituted with a component selected from the group consisting of 2'-O-(2-methoxyethyl) nucleosides, 2'-O-methyl nucleosides, 2'-O-(N-methylacetamide) nucleosides, 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabino nucleosides, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET) and peptide nucleic acids (PNA), optionally wherein the oligonucleotide further comprises a spacer.

[0054] Further disclosed herein is a method for treating FTD in a subject in need thereof, comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide is conjugated to SEQ ID NO: 1-1264, SEQ ID NO: 2529-3792, SEQ ID NO: 5066-5166, SEQ ID NO: 5168-5202, SEQ ID NO: 5209-5221, or SEQ ID NO: 5230. any one of NOs: 5235-5292 having at least 85% identity; wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are independently selected from a phosphodiester linkage, a phosphorothioate linkage, an alkylphosphoester linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropylphosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylenephosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a thiophosphoramidate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate ester (e.g., including morpholinophosphorodiamidate (PMO), 3' aminoribose or 5' aminoribose) linkage, an aminoalkylphosphodiamidate linkage, thiophosphoramidate linkages, thioalkylphosphonate linkages, thioalkylphosphotriester linkages, phosphorothioate linkages, selenophosphate linkages and boranophosphate linkages, and / or wherein at least one (i.e., one or more) nucleosides are substituted with a component selected from the group consisting of 2'-O-(2-methoxyethyl) nucleosides, 2'-O-methyl nucleosides, 2'-O-(N-methylacetamide) nucleosides, 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabino nucleosides, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET) and peptide nucleic acids (PNA), optionally wherein the oligonucleotide further comprises a spacer.

[0055] Further disclosed herein is a method for treating ALS with FTD in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide is a member of a family of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: any one of NOs: 5235-5292 having at least 85% identity; wherein at least one (i.e., one or more) nucleoside bonds of the oligonucleotide are independently selected from a phosphodiester bond, a phosphorothioate bond, an alkylphosphoester bond, a phosphorodithioate bond, a phosphotriester bond, an alkylphosphonate bond, a 3-methoxypropylphosphonate bond, a methylphosphonate bond, an aminoalkylphosphotriester bond, an alkylenephosphonate bond, a phosphinate bond, a phosphoramidate bond, a thiophosphoramidate bond, a thiophosphorodiamidate bond, a phosphorodiamidate ester (e.g., including phosphorodiamidate morpholino (PMO), 3' aminoribose or 5' aminoribose) bond, an aminoalkylphosphodiamidate bond, thiophosphoramidate linkages, thioalkylphosphonate linkages, thioalkylphosphotriester linkages, phosphorothioate linkages, selenophosphate linkages and boranophosphate linkages, and / or wherein at least one (i.e., one or more) nucleosides are substituted with a component selected from the group consisting of 2'-O-(2-methoxyethyl) nucleosides, 2'-O-methyl nucleosides, 2'-O-(N-methylacetamide) nucleosides, 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabino nucleosides, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET) and peptide nucleic acids (PNA), optionally wherein the oligonucleotide further comprises a spacer.

[0056] In various embodiments, one or more nucleoside bonds connecting the base at position 3 or position 4 of the oligonucleotide are phosphodiester bonds. In various embodiments, only one nucleoside bond connecting the base at position 3 or position 4 of the oligonucleotide is a phosphodiester bond. In various embodiments, the nucleoside bond connecting the base at position 3 and position 4 of the oligonucleotide is a phosphodiester bond. In various embodiments, one or more bases immediately before the spacer in the oligonucleotide are connected by a phosphodiester bond. In various embodiments, only the base immediately before the spacer in the oligonucleotide is connected with the spacer by a phosphodiester bond. In various embodiments, the base immediately before the spacer in the oligonucleotide is further connected with another preceding base by a phosphodiester bond. In various embodiments, the oligonucleotide comprises a second spacer, and the base wherein immediately before the second spacer is connected with another preceding base by a phosphodiester bond.

[0057] In various embodiments, one or more bases immediately after the spacer in the oligonucleotide are connected by a phosphodiester bond. In various embodiments, only the base immediately before the spacer in the oligonucleotide is connected to the spacer by a phosphodiester bond. In various embodiments, two bases immediately before the spacer in the oligonucleotide are connected by a phosphodiester bond. In various embodiments, one or more bases immediately before the spacer in the oligonucleotide are connected by a phosphodiester bond, and wherein one or more bases immediately after the spacer in the oligonucleotide are connected by a phosphodiester bond. In various embodiments, a base immediately before the spacer and a base immediately after the spacer are connected by a phosphodiester bond. In various embodiments, the oligonucleotide includes a second spacer, and wherein the one or more bases immediately before the second spacer in the oligonucleotide are connected by a phosphodiester bond, and wherein the one or more bases immediately after the second spacer in the oligonucleotide are connected by a phosphodiester bond. In various embodiments, a base immediately before the second spacer and a base immediately after the second spacer are connected by a phosphodiester bond. In various embodiments, the oligonucleotide comprises a series of bases connected by a phosphodiester bond, and this series of bases comprises at least two bases. In various embodiments, the oligonucleotide comprises a series of bases connected by a phosphodiester bond, and this series of bases comprises at least five bases. In various embodiments, the oligonucleotide comprises two or more spacers, and wherein this series of bases is located between at least two spacers. In various embodiments, the oligonucleotide is any one of 19mer, 21mer, 23mer or 25mer.

[0058] In various embodiments, at least one (ie, one or more) internucleoside linkage of an oligonucleotide is a phosphorothioate linkage. In various embodiments, all internucleoside linkages of an oligonucleotide are phosphorothioate linkages.

[0059] Also disclosed herein is an oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208, a sequence with 90% identity thereto, or a 15 to 50 contiguous nucleobase portion thereof, wherein the oligonucleotide comprises a spacer, and wherein the oligonucleotide is capable of increasing, restoring or stabilizing expression of UNC13A mRNA capable of translating functional UNC13A and / or activity and / or function of a UNC13A protein in cells or human patients with an immune-mediated demyelinating disease, and wherein the level of increase, restoration or stabilization of expression and / or activity and / or function is sufficient for the oligonucleotide to be used as a drug for treating an immune-mediated demyelinating disease.

[0060] In various embodiments, the oligonucleotide contains one or more chiral centers and / or double bonds.In various embodiments, the oligonucleotide exists as stereoisomers selected from geometric isomers, enantiomers, and diastereomers.

[0061] Disclosed herein is a method for treating a neurological disease and / or neuropathy in a patient in need thereof, the method comprising administering to a patient in need thereof a therapeutically effective amount of a pharmaceutical composition disclosed above in combination with a second therapeutic agent. In various embodiments, the second therapeutic agent is selected from riluzole (Rilutek), PrimeC (a combination of celecoxib and ciprofloxacin), edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AMX0035 (ELYBRIO), ZILUCOPLAN (RA101495), pridopidine, dual A ON intrathecal administration (e.g., BIIB067, BIIB078, and BIIB105), BIIB100, levodopa / carbidopa, dopaminergic agents (e.g., ropinirole, pramipexole, rotigotine), medroxyprogesterone, KCNQ2 / KCNQ3 openers (e.g., retigabine, XEN1101, QRL-101), anticonvulsant drugs, and psychostimulants and / or therapies (e.g., selected from respiratory care, physical therapy, occupational therapy, speech therapy, nutritional support) for the treatment of neurological diseases.

[0062] Further disclosed herein is a method of treating a neurological disease and / or a neuropathy in a patient in need thereof, the method comprising administering to a patient in need thereof a therapeutically effective amount of a pharmaceutical composition disclosed above, wherein at least one (i.e., one or more) internucleoside linkage of the oligonucleotide is a non-natural linkage, wherein the oligonucleotide comprises a spacer, and wherein the oligonucleotide further comprises a targeting or conjugation moiety selected from cholesterol, lipoic acid, pantothenic acid, polyethylene glycol, and an antibody for crossing the blood-brain barrier.

[0063] In various embodiments, the spacer is a nucleoside replacement group comprising a non-sugar substituent that can not be connected to a nucleotide base. In various embodiments, the spacer is between position 10 and 15 of the oligonucleotide. In various embodiments, the spacer is between position 7 and 11 of the oligonucleotide. In various embodiments, the oligonucleotide also comprises a second spacer, wherein the second spacer is between position 14 and 22 of the oligonucleotide. In various embodiments, the spacer and the second spacer in the oligonucleotide are separated by at least 5 core bases, at least 6 core bases, or at least 7 core bases. In various embodiments, the spacer is between position 7 and 9 of the oligonucleotide, and wherein the second spacer is between position 15 and 18 of the oligonucleotide. In various embodiments, the spacer is at position 8 of the oligonucleotide, and wherein the second spacer is at position 16 of the oligonucleotide.

[0064] In various embodiments, the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 21 and 24 of the oligonucleotide. In various embodiments, the spacer is located between positions 2 and 5 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 8 and 12 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 18 and 22 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer and a third spacer, wherein the three spacers are located in the oligonucleotide such that each segment of the oligonucleotide has at most 7 linked nucleosides.

[0065] In various embodiments, at least two of the three spacers are adjacent to a guanine nucleobase. In various embodiments, each of at least two of the three spacers is immediately preceded by a guanine nucleobase.

[0066] In various embodiments of the methods described herein, each of the first spacer, the second spacer, or the third spacer is a nucleoside surrogate group comprising a non-sugar substituent, wherein the non-sugar substituent does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal, or hemiaminal moiety and is incapable of forming a covalent bond with a nucleotide base.

[0067] In certain embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by formula (X), wherein: Ring A is an optionally substituted 4-8 membered monocyclic cycloalkyl or 4-8 membered monocyclic heterocyclyl, wherein the heterocyclyl contains 1 or 2 heteroatoms selected from O, S and N, provided that A cannot form a covalent bond with a nucleobase; and The symbol indicates the point of attachment to the internucleoside bond.

[0068] In various embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by formula (Xa), wherein:

[0069] In some embodiments, Ring A is an optionally substituted 4-8 membered monocyclic cycloalkyl selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl; or a 4-8 membered monocyclic heterocyclyl selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, and azepanyl.

[0070] In other embodiments, Ring A is tetrahydrofuranyl.

[0071] In other embodiments, Ring A is tetrahydropyranyl.

[0072] In various embodiments, each of the first spacer, the second spacer, or the third spacer is independently represented by formula (I), wherein: X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.

[0073] In various embodiments, the spacer or second spacer is represented by formula (I'), wherein: X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.

[0074] In various embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by Formula (Ia), wherein: as well as n is 0, 1, 2 or 3.

[0075] In various embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by Formula (Ia'), wherein: as well as n is 0, 1, 2 or 3.

[0076] In certain embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by Formula II, wherein: as well as X is selected from -CH2- and -O-.

[0077] In other embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by Formula II', wherein: as well as X is selected from -CH2- and -O-.

[0078] In various embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by Formula (Iia), wherein:

[0079] In other embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by formula (Iia'), wherein:

[0080] In some embodiments, the spacer is represented by formula (III), wherein: X is selected from -CH2- and -O-.

[0081] In some embodiments, the spacer is represented by formula (III'), wherein: X is selected from -CH2- and -O.

[0082] In some embodiments, the spacer is represented by formula (IIIb), wherein:

[0083] In some embodiments, the spacer is represented by formula (Iiib'), wherein:

[0084] In various embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by Formula III, wherein: as well as X is selected from -CH2- and -O-.

[0085] In other embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by Formula III', wherein: as well as X is selected from -CH2- and -O-.

[0086] In other embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by formula (IIIa), wherein:

[0087] In other embodiments, the first spacer, the second spacer, or the third spacer are each independently represented by formula (IIIa'), wherein:

[0088] In various embodiments, the oligonucleotide comprising a spacer has a GC content of at least 10%. In various embodiments, the oligonucleotide comprising a spacer has a GC content of at least 20%. In various embodiments, the oligonucleotide comprising a spacer has a GC content of at least 25%. In various embodiments, the oligonucleotide comprising a spacer has a GC content of at least 30%. In various embodiments, the oligonucleotide comprising a spacer has a GC content of at least 40%. In various embodiments, the oligonucleotide comprising a spacer has a GC content of at least 50%. BRIEF DESCRIPTION OF THE DRAWINGS

[0089] Figure 1 Shown are examples of antisense oligonucleotides (AONs), a portion of which is complementary to an mRNA transcript or pre-mRNA transcript. The dotted line indicates the position of the AON, which may or may not be occupied by a spacer. DETAILED DESCRIPTION

[0090] The features and other details of the present disclosure will now be described in more detail. Certain terms are used in the specification, examples, and appended claims. These definitions should be read in light of the remainder of this disclosure and as understood by those skilled in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art.

[0091] Disclosed herein are oligonucleotides capable of targeting a region of a transcript transcribed from a gene. In various embodiments, such oligonucleotides target a UNC13A transcript. Additionally disclosed herein are oligonucleotides comprising antisense oligonucleotide sequences, and methods of using the same to treat neurological diseases such as amyotrophic lateral sclerosis and frontotemporal dementia and / or neuropathy such as chemotherapy-induced neuropathy. In various embodiments, the oligonucleotide targets a sequence of the UNC13A transcript, resulting in a reduction in the level of mis-spliced ​​UNC13A transcripts. Also disclosed are pharmaceutical compositions comprising UNC13A oligonucleotides targeting a region of the UNC13A transcript for use in treating neurological diseases and / or neuropathy, and methods of preparing medicaments containing the disclosed UNC13A oligonucleotides targeting a region of the UNC13A transcript for use in treating neurological diseases and / or neuropathy. definition

[0092] As used herein, the terms "treat," "treatment," "treating," and the like generally mean obtaining a desired pharmacological and / or physiological effect. The effect may be therapeutic, i.e., partially or completely curing a disease and / or adverse effects caused by the disease. As used herein, the term "treatment" encompasses any treatment of a disease in a mammal, particularly a human, and includes: (a) inhibiting the disease, i.e., preventing an increase in the severity or extent of the disease; (b) alleviating the disease, i.e., causing a partial or complete improvement in the disease; or (c) preventing the recurrence of the disease, i.e., preventing the disease from returning to an active state after a previous successful treatment of the symptoms of the disease or treatment of the disease.

[0093] "Prevention" includes delaying the onset of clinical symptoms, complications, or biochemical markers of a developing condition, disorder, disease, or condition in a subject who may be suffering from or susceptible to a condition, disorder, disease, or condition but who does not yet experience or display clinical or subclinical symptoms of the condition, disorder, disease, or condition. "Prevention" includes prophylactic treatment of a developing condition, disorder, disease, or condition in or in a subject, including prophylactic treatment of clinical symptoms, complications, or biochemical markers of a condition, disorder, disease, or condition in or in a subject.

[0094] The terms "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient," as used interchangeably herein, refer to any and all solvents, dispersion media, coatings, isotonicity agents, absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The composition may also contain other active compounds that provide supplemental, additional, or enhanced therapeutic function.

[0095] As used herein, the term "pharmaceutical composition" refers to a composition comprising at least one biologically active compound disclosed herein, such as a UNC13A antisense oligonucleotide (AON), formulated together with one or more pharmaceutically acceptable excipients.

[0096] "Individual," "patient," or "subject" are used interchangeably and include any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, pigs, cattle, sheep, horses, or non-human primates, and most preferably humans. The compounds of the present invention can be administered to mammals, such as humans, but can also be other mammals, such as animals requiring veterinary treatment, such as livestock (e.g., dogs, cats, etc.), farm animals (e.g., cattle, sheep, pigs, horses, etc.), and laboratory animals (e.g., rats, mice, guinea pigs, non-human primates, etc.). In some embodiments, the mammal treated using the methods of the present invention is ideally a mammal in which modulation of UNC13A expression and / or activity is desired.

[0097] As used herein, "UNC13A" (also known as Unc-13 homolog A, Munc13-1, KIAA1032, unc-13 homolog A (Caenorhabditis elegans) or protein Unc-13 homolog A) refers to the gene or gene product (e.g., the protein or mRNA transcript (including pre-mRNA) encoded by the gene) identified by Entrez Gene ID No. 23025 and its allelic variants, as well as orthologs found in non-human species (e.g., non-human primates or mice).

[0098] The term "UNC13A transcript" refers to a UNC13A transcript that can be a UNC13A pre-mRNA sequence or a UNC13A mature RNA sequence. The UNC13A transcript sequence is shown to contain thymine (T), but those skilled in the art will understand that thymine (T) can generally be replaced with uracil (U) in the RNA sequence.

[0099] The term "UNC13A oligonucleotide," "UNC13A antisense oligonucleotide," or "UNC13A AON" refers to an oligonucleotide that is capable of increasing, restoring, or stabilizing full-length UNC13A activity, e.g., full-length UNC13A expression, e.g., full-length UNC13A mRNA and / or full-length UNC13A protein expression. Typically, a UNC13A oligonucleotide reduces the level of mis-spliced ​​UNC13A transcripts by targeting UNC13A transcripts (e.g., UNC13A pre-mRNA or mis-spliced ​​UNC13A with a target sequence). In various embodiments, the UNC13A oligonucleotide comprises a sequence that is at least 85% complementary to an equal length portion of a transcript comprising a sequence at least 90% identical to SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208, or a contiguous 15 to 50 nucleobase portion of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208. The UNC13A target sequence is shown to contain thymine (T), but one skilled in the art will understand that thymine (T) can typically be replaced with uracil (U) in the RNA sequence.

[0100] In various embodiments, a UNC13A oligonucleotide is characterized by having one or more spacers, wherein each spacer divides the UNC13A oligonucleotide into segments of linked nucleosides. In various embodiments, a UNC13A oligonucleotide has two spacers. In one embodiment, a UNC13A oligonucleotide has two segments of linked nucleosides separated by one spacer. In one embodiment, a UNC13A oligonucleotide has three segments of linked nucleosides separated by two spacers. In such embodiments, a UNC13A oligonucleotide has one segment with up to 7 linked nucleosides. For example, a UNC13A oligonucleotide may have, from the 5' to the 3' end, 5 linked nucleosides, followed by a spacer, 10 linked nucleosides, followed by a second spacer, and 8 linked nucleosides. Thus, the first segment of 5 linked nucleosides satisfies one segment of up to 7 linked nucleosides. In various embodiments, a UNC13A oligonucleotide has three spacers that divide the UNC13A oligonucleotide into four segments. In various embodiments, each of the four segments of the UNC13A oligonucleotide has at most 7 linked nucleosides.

[0101] As used herein, the term "UNC13A oligonucleotide" encompasses a "UNC13A parent oligonucleotide," a "UNC13A oligonucleotide having one or more spacers" (e.g., a UNC13A oligonucleotide having two spacers or a UNC13A oligonucleotide having three spacers), and a "UNC13A oligonucleotide variant having one or more spacers." Examples of UNC13A oligonucleotides include oligonucleotides comprising any of SEQ ID NOs: 1-1264, 2529-3792, 5066-5166, 5168-5202, 5209-5221, or 5235-5292.

[0102] The term "UNC13A parent oligonucleotide" refers to an oligonucleotide that targets a UNC13A transcript and is capable of increasing, restoring, or stabilizing full-length UNC13A activity (e.g., full-length UNC13A expression, e.g., full-length UNC13A mRNA and / or full-length UNC13A protein expression). The UNC13A parent oligonucleotide does not include a spacer. Examples of UNC13A parent oligonucleotides include oligonucleotides comprising any one of SEQ ID NOs: 1-1264. As described below, UNC13A oligonucleotides and UNC13A oligonucleotide variants having a spacer are described relative to the corresponding UNC13A parent oligonucleotide.

[0103] The term "UNC13A oligonucleotide variant" refers to a UNC13A oligonucleotide that represents a modified form of the corresponding UNC13A parent oligonucleotide. For example, a UNC13A oligonucleotide variant represents a shortened form of a UNC13A parent oligonucleotide. In various embodiments, the UNC13A oligonucleotide variant is any of a 15mer, 16mer, 17mer, 18mer, 19mer, 20mer, 21mer, 22mer, 23mer, 24mer, 25mer, 26mer, or 27mer. Examples of UNC13A oligonucleotide variants include oligonucleotides comprising any of SEQ ID NOs: 2529-3792. In various embodiments, the UNC13A oligonucleotide variant comprises one or more spacers. Such UNC13A oligonucleotide variants comprise any of SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292.

[0104] The term "oligonucleotide with one or more spacers" or "oligonucleotide comprising a spacer" refers to an oligonucleotide with at least one spacer. In various embodiments, the oligonucleotide with one or more spacers can include one spacer, two spacers, three spacers, four spacers, five spacers, six spacers, seven spacers, eight spacers, nine spacers, or ten spacers. In various embodiments, the oligonucleotide comprising one or more spacers includes at least one segment with up to 7 connected nucleosides. For example, as described in the 5' to 3' direction, the oligonucleotide comprising a spacer can include a segment with 7 connected nucleosides, followed by a spacer, a second segment with 9 connected nucleosides, followed by a second spacer and a third segment with 7 connected nucleosides. Here, the first segment of 7 connected nucleosides and the third segment of 7 connected nucleosides each represent a segment with up to 7 connected nucleosides. As another example, the oligonucleotide comprising an intermolecular spacer can include a section with 10 connection nucleosides, followed by an intermolecular spacer, a second section with 10 connection nucleosides, followed by the second intermolecular spacer and a third section with 3 connection nucleosides.Here, the third section of 3 connection nucleosides represents a section with at most 7 connection nucleosides.In various embodiments, the oligonucleotide with one or more intermolecular spacers includes a plurality of sections with at most 7 connection nucleosides.In various embodiments, each section of the oligonucleotide with one or more intermolecular spacers has at most 7 connection nucleosides.For example, the oligonucleotide can be a 23mer and includes two intermolecular spacers, and the intermolecular spacer is divided into three sections of 7 connection nucleosides separately that separate.Therefore, each section of the oligonucleotide has at most 7 connection nucleosides.

[0105] Typically, UNC13A oligonucleotides comprising one or more spacers are described with reference to the corresponding UNC13A parent oligonucleotide or a corresponding UNC13A oligonucleotide variant. Examples of UNC13A oligonucleotides comprising one or more spacers include any of SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292.

[0106] In various embodiments, one or more spacers can be located at one or more positions of an oligonucleotide. The spacer can be located between the first position and the second position of the oligonucleotide. As used herein, the spacer located between the first position and the second position encompasses a spacer located at the first position, the second position, or an arbitrary position of an oligonucleotide sandwiched between the first position and the second position.

[0107] As used herein, the term "therapeutically effective amount" refers to an amount of an oligonucleotide that is capable of eliciting the biological or medical response of a tissue, system, animal, or human being that is being sought by a researcher, veterinarian, medical doctor, or other clinician. In one embodiment, the oligonucleotide comprises a sequence that is at least 85% complementary to an equal length portion of a transcript comprising a sequence that is at least 90% identical to SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208, or a contiguous 15 to 50 nucleobase portion of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208. The oligonucleotide is administered in a therapeutically effective amount to treat and / or prevent a disease, condition, disorder, or state, such as a neurological disease and / or neuropathy. Alternatively, a therapeutically effective amount of an oligonucleotide is an amount required to achieve the desired therapeutic and / or prophylactic effect, such as an amount that results in the prevention or reduction of symptoms associated with a disease associated with decreased UNC13A activity in motor neurons.

[0108] The phrase "UNC13A oligonucleotide that targets a UNC13A transcript" refers to a UNC13A oligonucleotide that binds to a UNC13A transcript.

[0109] The term "pharmaceutically acceptable salt" as used herein refers to salts of acidic or basic groups that may be present in the UNC13A oligonucleotide used in the composition of the present invention. The UNC13A oligonucleotide contained in the present composition is basic in nature and can form a variety of salts with various inorganic and organic acids. Acids that can be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmaceutically acceptable anions, including but not limited to malate, oxalate, chloride, bromide, iodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisate, fumarate, gluconate, glucuronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, and pamoate (i.e., 1,1'-methylene-bis-(2-hydroxy-3-naphthoate)). In addition to the acids listed above, the UNC13A oligonucleotides comprising an amino moiety included in the compositions of the present invention can form pharmaceutically acceptable salts with various amino acids. The compounds included in the compositions of the present invention that are acidic in nature are capable of forming base salts with various pharmacologically acceptable cations. Examples of such salts include alkali metal or alkaline earth metal salts, particularly calcium, magnesium, sodium, and lithium salts. Pharmaceutically acceptable salts of the present disclosure include, for example, pharmaceutically acceptable salts of UNC13A oligonucleotides comprising any of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292.

[0110] The UNC13A oligonucleotides disclosed herein may contain one or more chiral centers, groups, linkages, and / or double bonds and, therefore, exist as stereoisomers, such as geometric isomers, enantiomers, or diastereomers. As used herein, the term "stereoisomer" encompasses all geometric isomers, enantiomers, or diastereomers. These compounds may be represented by the symbols "R" or "S" (or "Rp" or "Sp"), depending on the configuration of substituents around the stereogenic atom (e.g., stereogenic carbon, phosphorus, or sulfur atoms). In some embodiments, one or more bonds of the compound may have an Rp or Sp configuration (e.g., one or more phosphorothioate bonds may have an Rp or Sp configuration). The configuration of each phosphorothioate bond may be independent of the other phosphorothioate bonds (e.g., one phosphorothioate bond may have an Rp configuration and a second phosphorothioate bond may have an Sp configuration). In various embodiments, the UNC13A oligonucleotides may have mixed configurations of phosphorothioate bonds. For example, a UNC13A oligonucleotide may have 5 phosphorothioate bonds in the Rp configuration, followed by 15 phosphorothioate bonds in the Sp configuration, followed by 5 phosphorothioate bonds in the Rp configuration. The present invention encompasses various stereoisomers of these compounds and mixtures thereof. Stereoisomers include enantiomers and diastereomers. A mixture of enantiomers or diastereomers may be designated as "(±)" in nomenclature, but those skilled in the art will recognize that a structure may implicitly represent a chiral center.

[0111] Individual stereoisomers of the UNC13A oligonucleotides of the present invention can be prepared synthetically from commercially available starting materials containing asymmetric or stereogenic centers, or by preparing a racemic mixture followed by resolution methods well known to those skilled in the art. Examples of such resolution methods include: (1) coupling the mixture of enantiomers to a chiral auxiliary, separating the resulting mixture of diastereomers by recrystallization or chromatography, and releasing the optically pure product from the auxiliary, (2) forming salts using an optically active resolving agent, or (3) directly separating the mixture of optical enantiomers on a chiral chromatographic column. Stereoisomeric mixtures can also be resolved into their component stereoisomers by well-known methods, such as chiral gas chromatography, chiral supercritical liquid chromatography, chiral simulated moving bed chromatography, chiral high performance liquid chromatography, crystallizing the compound as a chiral salt complex, or crystallizing the compound in a chiral solvent. Stereoisomers can also be obtained from stereoisomerically pure intermediates, reagents, and catalysts by well-known asymmetric synthetic methods.

[0112] The UNC13A oligonucleotides disclosed herein may exist in solvated as well as unsolvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and it is intended that the present invention encompass both solvated and unsolvated forms.

[0113] The present disclosure also includes fluorescently labeled compounds of the present invention. The present disclosure also includes isotopically labeled compounds of the present invention (i.e., isotopically labeled UNC13A oligonucleotides) that are identical to those described herein except that one or more atoms are replaced by atoms having an atomic mass or mass number different from the atomic mass or mass number found in abundance in nature. Examples of isotopes that can be incorporated into compounds of the present invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, and chlorine, for example, 2 H. 3 H. 11 C. 13 C. 14 C. 15 N. 18 O. 17 O. 31 P. 32 P. 33 P. 35 S. 18 F and 36 Cl.

[0114] Certain isotopically labeled disclosed compounds (e.g., 3 H. 14 C or 35 S-labeled) can be used in compound and / or substrate tissue distribution assays. 3 H), carbon-14 (i.e. 14 C) isotopes are particularly preferred because of their ease of preparation and detectability. In addition, heavier isotopes such as deuterium (i.e., 2 H) substitutions may offer certain therapeutic advantages resulting from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements) and therefore may be preferred in some circumstances.

[0115] As used herein, "2'-O-(2-methoxyethyl)" (also known as 2'-MOE and 2'-O(CH2)2OCH3 and MOE) refers to an O-methoxyethyl modification of the 2' position of the furanose ring. 2'-O-(2-methoxyethyl) is used interchangeably in this disclosure as "2'-O-methoxyethyl." The sugar moiety in a nucleoside modified with 2'-MOE is a modified sugar.

[0116] As used herein, "2'-MOE nucleoside" (also known as 2'-O-(2-methoxyethyl) nucleoside) refers to a nucleoside comprising a 2'-MOE modified sugar moiety.

[0117] As used herein, "2'-substituted nucleosides" refer to nucleosides that contain a substituent other than H or OH at the 2'-position of the furanose ring. In certain embodiments, 2'-substituted nucleosides include nucleosides with bicyclic sugar modifications.

[0118] As used herein, "5-methylcytosine" (5-MeC) refers to cytosine modified with a methyl group attached to position 5. 5-Methylcytosine (5-MeC) is a modified nucleobase.

[0119] As used herein, "bicyclic sugar" refers to a furanose ring modified by bridging two atoms. A bicyclic sugar is a modified sugar.

[0120] As used herein, "bicyclic nucleoside" (also known as BNA) refers to a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring.

[0121] As used herein, "cap structure" or "terminal cap moiety" refers to a chemical modification that has been incorporated into either terminus of an antisense compound.

[0122] As used herein, "cEt" or "constrained ethyl" refers to a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4'-carbon and the 2'-carbon, wherein the bridge has the formula: 4'-CH(CH3)-0-2'.

[0123] As used herein, "constrained ethyl nucleoside" (also referred to as cEt nucleoside) refers to a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH3)—O-2' bridge. In some embodiments, cEt can be modified. In some embodiments, cEt can be S-cEt (in an S-constrained ethyl 2'-4'-bridged nucleic acid). In some other embodiments, cEt can be R-cEt.

[0124] As used herein, "internucleoside linkage" refers to a covalent bond between adjacent nucleosides in an oligonucleotide. In some embodiments, as used herein, "non-natural linkage" refers to a "modified internucleoside linkage".

[0125] As used herein, in the context of an oligonucleotide, "continuous" refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, "continuous nucleobases" refers to nucleobases that are immediately adjacent to one another in a sequence. As a contrary example, two nucleosides separated by a spacer are not continuous.

[0126] As used herein, "locked nucleic acid" or "LNA" or "LNA nucleoside" refers to a nucleic acid monomer having a bridge (e.g., a methylene, ethylene, aminooxy, or hydroxyimino bridge) connecting two carbon atoms between the 4' and 2' positions of the nucleoside sugar unit to form a bicyclic sugar. Examples of such bicyclic sugars include, but are not limited to, (A) α-L-methyleneoxy (4'-CH2—O-2') LNA, (B) β-D-methyleneoxy (4'-CH2—O-2') LNA, (C) ethyleneoxy (4'-(CH2)2—O-2') LNA, (D) aminooxy (4'-CH2—O—N(R)-2') LNA, and (E) oxyamino (4'-CH2—N(R)—O-2') LNA; wherein R is H, C1-C 12 An alkyl group or a protecting group (see U.S. Patent No. 7,427,672, issued September 23, 2008).

[0127] As used herein, LNA compounds include, but are not limited to, compounds having at least one bridge between the 4' and 2' positions of the sugar, wherein each bridge independently comprises 1 or 2 to 4 linking groups independently selected from —[C(R1)(R2)] n —,—C(R1)=C(R2)—,—C(R1)=N—,—C(=NR1)—,—C(=O)—,—C(=S)—,—O—,—Si(R1)2—,—S(=O) x — and —N(R1)—; wherein: x is 0, 1 or 2; n is 1, 2, 3 or 4; R1 and R2 are each independently H, a protecting group, a hydroxyl group, a C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic group, substituted heterocyclic group, heteroaryl, substituted heteroaryl, C5-C7 alicyclic group, substituted C5-C7 alicyclic group, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl group (C(=O)—H), substituted acyl group, CN, sulfonyl group (S(=O)2-J1) or sulfoxyl group (S(=O)-J1); and J1 and J2 are each independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C (= O) -H), substituted acyl, heterocyclic, substituted heterocyclic, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl or a protecting group.

[0128] Examples of 4'-2' bridging groups encompassed within the definition of LNA include, but are not limited to, one of the following formulae: - [C(R1)(R2)] n —, —[C(R1)(R2)] n —O—, —C(R1R2)—N(R1)—O— or —C(R1R2)—O—N(R1)—. In addition, other bridging groups encompassed in the definition of LNA are 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2—O-2', 4'-(CH2)2—O-2', 4'-CH2—O—N(R1)-2' and 4'-CH2—N(R1)—O-2'-bridges, wherein R1 and R2 are each independently H, a protecting group or a C1-C 12 alkyl.

[0129] Also comprising such LNA according to the definition of LNA of the present invention, wherein the 2 '-hydroxyl of ribosyl sugar ring is connected to 4 ' carbon atom of sugar ring, thereby forms bridge to form dicyclic sugar moiety.Bridge can be the methylene (-CH2-) group connecting 2 ' oxygen atom and 4 ' carbon atom, wherein uses term methyleneoxy (4 '-CH2-O-2 ') LNA.In addition, when dicyclic sugar moiety has ethylene bridging group in this position, uses term ethyleneoxy (4 '-CH2CH2-O-2 ') LNA.

[0130] As used herein, a "spacer" refers to a nucleoside substituted group (e.g., a non-nucleoside group that replaces a nucleoside present in a UNC13A parent oligonucleotide). A spacer is characterized by the absence of a nucleotide base and the replacement of the nucleoside sugar moiety with a non-sugar substitute. The non-sugar substituted group of the spacer lacks an aldehyde, ketone, acetal, ketal, hemiacetal, or hemiketal group. Thus, the non-sugar substituted group of the spacer is capable of linking to the 3' and 5' positions of a nucleoside adjacent to the spacer via an internucleoside linker as described herein, but cannot form a covalent bond with a nucleotide base (i.e., cannot link a nucleobase to another group, such as an internucleoside bond, a conjugate group, or a terminal group in an oligonucleotide). Generally, a UNC13A oligonucleotide having a spacer is described relative to a UNC13A parent oligonucleotide, wherein the spacer replaces a nucleoside of the UNC13A parent oligonucleotide. In all embodiments of the present disclosure, the spacer is not capable of hybridizing to a nucleoside comprising the nucleobase at the corresponding position of the UNC13A transcript within the numerical sequence of the length of the AON oligonucleotide, (i.e., if the spacer is located after nucleoside 4 of the AON (i.e., at position 5 from the 5'-end), the spacer is not complementary to the nucleoside (A, C, G, or U) at the same corresponding position of the target UNC13A transcript).

[0131] As used herein, "mismatch" or "non-complementary groups" refers to the situation when a group (eg, a nucleobase) of a first nucleic acid cannot pair with a corresponding group (eg, a nucleobase) of a second or target nucleic acid.

[0132] As used herein, "modified internucleoside linkage" refers to a substitution or any alteration from a naturally occurring internucleoside linkage (eg, a phosphodiester internucleoside linkage).

[0133] As used herein, "modified nucleobase" refers to any nucleobase other than adenine, cytosine, guanine, thymine, or uracil. Examples of modified nucleobases include 5-methylcytosine, pseudouridine, or 5-methoxyuridine. "Unmodified nucleobase" refers to the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0134] As used herein, "modified nucleosides" refers to nucleosides that independently have a modified sugar moiety and / or a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases. Modified nucleosides include abasic nucleosides, which lack a nucleobase. However, modified nucleosides do not include spacers or other groups that cannot connect to a nucleobase.

[0135] As used herein, " connection nucleosides " are nucleosides connected in a continuous sequence (i.e., there is no additional nucleoside between the nucleosides connected). In various embodiments, oligonucleotides can have different sections of connection nucleosides connected by a spacer. Here, the spacer (i.e., nucleoside replacement) is not considered as a nucleoside, so the oligonucleotide is divided into two sections connecting nucleosides. Oligonucleotides can have a first section of Y connecting nucleosides (e.g., a Y nucleoside connected in a continuous sequence), followed by a spacer, and then a second section of Z connecting nucleosides. Here, Y and Z connect nucleosides with 5' to 3' direction or 3' to 5' direction description. In various embodiments, the first section consists of 7 or less connection nucleosides (e.g., Y=7 or less), and the second section includes 8 or more connection nucleosides (e.g., Z=8 or more).

[0136] As used herein, "modified oligonucleotide" refers to an oligonucleotide comprising at least one (ie, one or more) modified internucleoside linkage, modified sugar, and / or modified nucleobase.

[0137] As used herein, "modified sugar" or "modified sugar moiety" refers to a modified furanosyl sugar moiety or a modified sugar moiety having other groups in addition to a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide.

[0138] As used herein, "monomer" refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.

[0139] As used herein, "motif" refers to the pattern of unmodified and modified nucleosides in an antisense compound.

[0140] As used herein, "natural sugar moiety" refers to a sugar moiety found in DNA (2'-H) or RNA (2'-OH).

[0141] As used herein, a "naturally occurring internucleoside linkage" refers to a 3' to 5' phosphodiester linkage.

[0142] As used herein, "non-complementary nucleobases" refers to a pair of nucleobases that do not hydrogen bond with each other or support hybridization.

[0143] As used herein, "nucleic acid" refers to a molecule composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acid, double-stranded nucleic acid, non-coding RNA, small interfering RNA (siRNA), short hairpin RNA (shRNA), and microRNA (miRNA).

[0144] As used herein, "nucleobase" refers to a heterocyclic moiety capable of base pairing with a base of another nucleic acid.

[0145] As used herein, "nucleobase complementarity" refers to a nucleobase that can base pair with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobases refer to nucleobases of antisense compounds that can base pair with the corresponding nucleobases of their target nucleic acid. For example, if a nucleobase at a certain position of the antisense compound can hydrogen bond with a nucleobase at a certain position of the target nucleic acid, the hydrogen bonding positions between the oligonucleotide and the target nucleic acid are considered to be complementary at the nucleobase pair.

[0146] As used herein, "nucleobase sequence" refers to the order of nucleobases independent of any sugar, linkage and / or nucleobase modification.

[0147] As used herein, "nucleoside" refers to a nucleobase linked to a sugar. The term "nucleoside" also includes "modified nucleosides" independently having a modified sugar moiety and / or a modified nucleobase.

[0148] As used herein, " nucleoside mimetics " comprises the sugar or sugar and base for replacing oligomeric compounds and not necessarily those structures of the key of one or more positions, for example, there is the nucleoside mimetics of morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, dicyclo or tricyclic sugar mimetics (for example, non-furanose sugar unit).Nucleotide mimetics comprises the nucleoside for replacing oligomeric compounds and those structures of the key of one or more positions, for example peptide nucleic acid or morpholino (morpholino connected by diaminophosphoroester or other non-phosphodiester bonds).Sugar surrogate (sugar surrogate) overlaps with slightly broad term nucleoside mimetics, but is intended to only represent the replacement of sugar unit (furanose ring).Tetrahydropyranyl ring provided herein is the explanation of the example of sugar surrogate, and wherein furanose glycosyl is replaced by tetrahydropyranyl ring system." mimetic " refers to the group of key between substituted sugar, core base and / or nucleoside. Typically, a mimetic is used to replace the sugar or combination of sugar-internucleoside linkages and maintain the nucleobase for hybridization to the target of choice.

[0149] As used herein, "nucleotide" refers to a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

[0150] As used herein, "oligomeric compound" or "oligomer" refers to a polymer of linked monomeric subunits capable of hybridizing to at least a region of a nucleic acid molecule.

[0151] As used herein, "oligonucleotide" refers to a polymer of one or more stretches of linked nucleosides, each of which may independently of the others be modified or unmodified.

[0152] As used herein, a "hotspot region" is a series of nucleobases on a target nucleic acid that are amenable to oligomeric compound-mediated modulation of target nucleic acid splicing.

[0153] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding, which can be Watson-Crick hydrogen bonding, Hoogsteen hydrogen bonding, or reversed Hoogsteen hydrogen bonding between complementary nucleobases.

[0154] As used herein, "increasing the amount of activity" refers to greater transcript expression, more accurate splicing resulting in full-length mature mRNA and / or protein expression, and / or greater activity relative to transcript expression or activity in an untreated or control sample. Antisense therapeutic drugs

[0155] Antisense therapeutics are a class of nucleic acid-based compounds that can be used to modulate transcripts (e.g., mRNA). In various embodiments, antisense therapeutics comprise one or more spacers and can be used to modulate transcripts transcribed from genes such as UNC13A pre-mRNA.

[0156] Antisense therapeutic drugs can be based on single-stranded or double-stranded deoxyribonucleic acid (DNA), based on ribonucleic acid (RNA) or DNA / RNA chemical analog compounds. Generally, antisense therapeutic drugs are designed to include sequences complementary or almost complementary to mRNA or pre-mRNA sequences transcribed from a given gene, to promote the binding between antisense therapeutic drugs and pre-mRNA or mRNA. In certain embodiments, antisense therapeutic drugs work by binding to mRNA or pre-mRNA, thereby inhibiting protein translation, (for example, by preventing the binding of appropriate proteins such as splicing activators) to change pre-mRNA splicing into mature mRN and / or causing the destruction of mRNA. In certain embodiments, antisense therapeutic drug sequences are complementary to a portion of a target gene or mRNA sense sequence. In certain embodiments, antisense therapeutic drugs as described herein are compounds based on oligonucleotides, which include oligonucleotide sequences and one or more spacers complementary to pre-mRNA sense sequences or their portions. In certain embodiments, antisense therapeutic drugs as described herein can also be compounds based on nucleotide chemical analogs.

[0157] In certain embodiments, an oligonucleotide, such as an oligonucleotide disclosed herein, can be an oligonucleotide sequence of 5 to 100 oligonucleotide units in length, e.g., 10 to 60 oligonucleotide units in length, e.g., 12 to 50 oligonucleotide units in length, 14 to 40 oligonucleotide units in length, 10 to 30 oligonucleotide units in length, e.g., 14 to 30 oligonucleotide units in length, e.g., 14 to 25 or 15 to 22 oligonucleotide units in length, or 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 oligonucleotide units in length. As used herein, "oligonucleotide unit" refers to a nucleoside (e.g., a nucleoside comprising a sugar and / or a nucleobase) or a nucleoside surrogate group (e.g., a spacer) of an oligonucleotide.

[0158] In a specific embodiment, the oligonucleotide is 25 oligonucleotide units in length. In a specific embodiment, the oligonucleotide is 23 oligonucleotide units in length. In a specific embodiment, the oligonucleotide is 21 oligonucleotide units in length. In a specific embodiment, the oligonucleotide is 19 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 18 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 19 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 20 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 21 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 22 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 23 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 24 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 25 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 26 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 27 oligonucleotide units in length.

[0159] In certain embodiments, the AONs may include chemically modified nucleosides (e.g., 2'-O-methylated nucleosides or 2'-O-(2-methoxyethyl) nucleosides) and modified internucleoside bonds (e.g., phosphorothioate bonds). In certain embodiments, the AONs described herein include oligonucleotide sequences complementary to RNA sequences, such as UNC13A mRNA sequences. In certain embodiments, the AONs described herein may include chemically modified nucleosides and modified internucleoside bonds (e.g., phosphorothioate bonds). In specific embodiments, the AONs described herein include one or more spacers.

[0160] In a specific embodiment, the oligonucleotide comprises one or more spacers. In a specific embodiment, the oligonucleotide comprises a spacer. In various embodiments, the oligonucleotide comprises two spacers. For example, the oligonucleotide comprises 23 oligonucleotide units with 21 core bases and two nucleoside alternative groups (for example, two spacers). Other embodiments of the oligonucleotide with a spacer and the oligonucleotide with two spacers are described herein. In various embodiments, the oligonucleotide comprises three spacers.

[0161] In some embodiments, the antisense oligonucleotide can be, but is not limited to, an inhibitor of gene transcription (e.g., shRNA, siRNA, PNA, LNA, 2'-O-methyl (2'OMe) antisense oligonucleotide (AON), 2'-O-(2-methoxyethyl) (MOE) AON, or morpholino oligomer (e.g., phosphorodiamidate morpholino (PMO))) or a composition comprising such a compound. In some embodiments, the oligonucleotide is an antisense oligonucleotide (AON) comprising 2'OMe (e.g., an AON comprising one or more 2'OMe modified sugars), MOE (e.g., an AON comprising one or more MOE modified sugars), a peptide nucleic acid (e.g., an AON comprising one or more N-(2-aminoethyl)-glycine units linked by amide bonds or carbonylmethylene bonds as repeating units in place of a sugar-phosphate backbone), a locked nucleic acid (e.g., an AON comprising one or more locked ribose sugars, and which can be a mixture of 2'-deoxynucleotides or 2'OMe nucleotides), a c-ET (e.g., an AON comprising one or more cET sugars), or a composition comprising a 2'OMe antisense oligonucleotide (AON). N), constrained methoxyethyl (cMOE) (e.g., an AON comprising one or more cMOE sugars), morpholino oligomers (e.g., an AON comprising a backbone containing one or more PMOs), deoxy-2'-fluoronucleosides (e.g., an AON comprising one or more 2'-fluoro-β-D-arabinonucleosides), tricyclic DNA (tcDNA) (e.g., an AON comprising one or more tcDNA-modified sugars), 2'-O,4'-C-ethylene-bridged nucleic acids (ENA) (e.g., an AON comprising one or more ENA-modified sugars), or hexitol nucleic acids (HNA) (e.g., an AON comprising one or more HNA-modified sugars). In some embodiments, the AON comprises one or more internucleoside bonds independently selected from the group consisting of phosphorothioate, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate, thiophosphoramidate, thiophosphordiamidate, phosphorodiamidate morpholino (PMO) (morpholino), PNA, or any combination of phosphorothioate, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate, thiophosphoramidate, thiophosphordiamidate, phosphorodiamidate morpholino (PMO) (morpholino), and PNA. In some embodiments, the UNC13AAON comprises one or more phosphorothioate, phosphodiester, or a combination of phosphorothioate and phosphodiester bonds.

[0162] Peptide nucleic acids (PNAs) are short, synthetic polymers with a structure that mimics DNA or RNA. PNAs include a backbone composed of repeating N-(2-aminoethyl)-glycine units linked by peptide bonds. In certain embodiments, the PNAs described herein can be used as antisense therapeutics that bind to RNA sequences with high specificity and increase, restore, and / or stabilize levels (e.g., full-length UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, such as UNC13A activity).

[0163] Locked nucleic acids (LNA) are oligonucleotide sequences comprising one or more modified RNA nucleotides in which the ribose moiety is modified with an additional bridge connecting the 2' oxygen and the 4' carbon. LNAs are believed to have a higher Tm than similar oligonucleotide sequences. In certain embodiments, the LNAs described herein can be used as antisense therapeutics that bind to RNA sequences with high specificity. For example, LNAs can bind to UNC13A pre-mRNA and prevent mis-splicing of UNC13A pre-mRNA, and increase, restore and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, such as UNC13A activity).

[0164] Morpholino oligomers are oligonucleotide compounds that include DNA bases on a methylene morpholine ring backbone linked by phosphorodiamidate groups. In certain embodiments, the morpholino oligomers of the present invention can be designed to bind to a specific precursor mRNA sequence of interest. For example, the morpholino oligomers bind to UNC13A precursor mRNA, thereby preventing mis-splicing of the precursor mRNA and increasing, restoring, and / or stabilizing UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, such as UNC13A activity). In certain embodiments, the UNC13A morpholino oligomers described herein can be used as antisense therapeutics that bind to UNC13A precursor mRNA sequences with high specificity and prevent mis-splicing of UNC13A precursor mRNA, and increase, restore, and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, such as UNC13A activity). In certain embodiments, the UNC13A morpholino oligomers described herein can also be used to bind to UNC13A pre-mRNA sequences, alter UNC13A pre-mRNA splicing and UNC13A gene expression, and increase, restore, and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, such as UNC13A activity).

[0165] In some embodiments, the UNC13A AON comprises a sequence that is at least 90% complementary to a sequence that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to a UNC13A transcript region (e.g., SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208). In some embodiments, the UNC13A AON comprises a sequence that is at least 90-95% complementary to a sequence that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to a UNC13A transcript region (e.g., SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208). In specific embodiments, the UNC13A AON comprises a sequence that is at least 85% complementary to a sequence that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to a UNC13A transcript region (e.g., SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208). In specific embodiments, the UNC13A AON comprises a sequence that is at least 84% to 88% complementary to a sequence that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to a UNC13A transcript region (e.g., SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208). In specific embodiments, the UNC13A AON comprises a sequence that is at least 89% to 92% complementary to a sequence that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to a mis-spliced ​​UNC13A transcript region (e.g., SEQ ID NOs: 5057-5065). In specific embodiments, the UNC13A AON comprises a sequence that is at least 94% to 96% complementary to a sequence that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to a UNC13A transcript region (e.g., SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208).

[0166] In various embodiments, the UNC13A AON comprises a sequence that is at least 85% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292. In various embodiments, the UNC13A AON comprises a sequence that is at least 90% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292.

[0167] In some embodiments, the UNC13A AON comprises a spacer and has a segment containing up to 7 linked nucleosides. In some embodiments, the UNC13A AON comprises a spacer and has a segment containing up to 6, 5, 4, 3, or 2 linked nucleosides.

[0168] UNC13A AON binding specificity can be assessed by measuring parameters such as dissociation constant, melting temperature, or other criteria such as changes in protein or RNA expression levels or other assays that measure UNC13A activity or expression.

[0169] In some embodiments, the UNC13A AON may comprise a non-double-stranded oligonucleotide. In some embodiments, the UNC13A AON may comprise a duplex of two oligonucleotides, wherein the first oligonucleotide comprises a nucleobase sequence that is completely or nearly completely complementary to the UNC13A pre-mRNA sequence, and the second oligonucleotide comprises a nucleobase sequence that is complementary to the nucleobase sequence of the first oligonucleotide.

[0170] In some embodiments, the UNC13A AON can target a UNC13A pre-mRNA produced by a UNC13A gene of one or more species. For example, the UNC13A AON can target a mammalian UNC13A gene, such as a UNC13A pre-mRNA of a human (i.e., Homo sapiens) UNC13A gene. In specific embodiments, the UNC13A AON targets a human UNC13A pre-mRNA. In some embodiments, the UNC13A AON comprises a nucleobase sequence that is complementary to a nucleobase sequence of a UNC13A gene or UNC13A pre-mRNA, or a portion thereof.

[0171] The UNC13A AONs described herein include antisense oligonucleotides comprising the oligonucleotide sequences listed in Table 1 below: Table 1. Example UNC13A AON sequences. *At least one (i.e., one or more) nucleoside linkages of the oligonucleotide sequence are independently selected from phosphorothioate, alkylphosphonate, phosphorodithioate, phosphotriester, alkylphosphonate, 3-methoxypropylphosphonate, methylphosphonate, aminoalkylphosphotriester, alkylenephosphonate, phosphinate, phosphoramidate, thiophosphoramidate, thiophosphorodiamidate, phosphorodiamidate (e.g., including phosphorodiamidate morpholino (PMO), 3' aminoribose, or 5' aminoribose) linkages, aminoalkylphosphoramidate, thiophosphoramidate, thioalkylphosphonate, thioalkylphosphotriester, phosphorothioate, selenophosphate, and boranophosphate. UNC13A transcripts

[0172] (SEQ ID NO:5057 (SOURCE NCBI Reference Sequence NM_001080421.3)).

[0173] SEQ ID NO: 5058 (SOURCE NCBI Reference Sequence NM_001387021.1)).

[0174] In various embodiments, the UNC13A mRNA transcript comprises the sequence shown as SEQ ID NO:5059. (SEQ ID NO:5059 (SOURCE NCBI Reference Sequence NM_001387022.1)).

[0175] (SEQ ID NO:5060 (SOURCE NCBI Reference Sequence NM_001387023.1)).

[0176] SEQ ID NO: 5061 (SOURCE NCBI Reference Sequence XM_011527810.2)).

[0177] In various embodiments, the UNC13A mRNA transcript comprises the sequence shown as SEQ ID NO:5062. SEQ ID NO: 5062 (SOURCE (NCBI Reference Sequence XM_017026502.1)).

[0178] In various embodiments, the UNC13A mRNA transcript comprises the sequence shown as SEQ ID NO:5063. SEQ ID NO: 5063 (SOURCE NCBI Reference Sequence XM_011527811.2)).

[0179] In various embodiments, the UNC13A transcript is a pre-mRNA UNC13A transcript. In various embodiments, the UNC13A pre-mRNA transcript comprises the sequence shown in SEQ ID NO: 5064. (SEQ ID NO:5064 (SOURCE NCBI Reference Sequence NG_052872.1)).

[0180] In various embodiments, the UNC13A transcript is a pre-mRNA UNC13A transcript. In various embodiments, the UNC13A pre-mRNA transcript comprises the sequence shown in SEQ ID NO: 5065. The Primary Assembly of the NCBI Reference Sequence NC_000019.10 Reference GRCh38.p13 is SEQ ID NO: 5065. UNC13A transcripts with cryptic exons

[0181] In some embodiments, the UNC13A AON targets a region of the UNC13A transcript comprising a cryptic exon sequence, the UNC13A mRNA transcript comprising the sequence set forth in SEQ ID NO:5206. TTCTGCCACCATGGGAGAGAAAGTGTCATGGAGAGTGCAAGGGGTCGCCGGGGGTCAGAGGTCCCAGGGTCTGGGGCAGCTTACATCATCCATCTGCCTGTTTATTCATTAATTCATTCATCTACTCTTTTATCCATC CACACA CCCACCCATCTAACTACCCCAAATTTCACCCATCCACTCTTCCAACCTTTCAGTAATTCAAC CACACA TCCATCCATCCATCCATTCATCCATCCCATACATTGATCCGCAACTTAATCCACCTACCCAATCATTCATTCTTTCATACAACCAACCATCCATCCACCCATCAATTTATCCAACCATCCATTTTTCGTCTGTCCACCAGCCACTCACAACCATCCATCTAAATATTCAGAAATTATGAACCCAATTATCAATACTTGCAATAGTTCAAC CACACATCCTTCCATTCATCCACCCACCCATTCATCCATTTGTCCATCTGCCTATCATCCATCCATCCATCCATCCATCTACCTATCTACCCATCTGACTATCAACAAATTCACCTATCTACTCAATCTTCCTTCTAATAACTCAACCACACTTCCATCCATCCCATCCAATACAACTTAATCTGCTCATCCAACATTTCATCTATCCACCCAGTCAATCATCTATCCAGCAATCTATCTATCCACTCATCAAGTTATCCATCCATCATTCATCTATACTCATCCATCATCTAACAATTACCCCCAAATTCACCCATCCATACATCTATACTTTCAATAGTTCAATCATATATCCATCCATCTGTCCATCCATCCATCATCCATCTAGCCACGAATCTACCCACCAACTCATCCATCTATCCATCCATGTACTCACCCATCTCTCCATCCATCCTTTTATCTACTCATCACTCATTCATCTGTTCAATCATTCATTCATTCACCAGCATTTATTCAACAAACTAGTTCCTGGGGATAAGAGTTCTTTCCAGGAAACCCAGGCAGCTGGAAGAGACATACCCAGACACAAACGGCCCAATCCTGAGTGGTTAGGGCTGGAATAGAAGGAAGAACCTGATGATGAGTAGTGAGAGTCAACCTGGAGGCCAAGGTGGGCTTCCCAGAGGAGGTGACCCTGAATCTGGACTTTGATGGATAGGGAGGAGTTTTCCAGGTAAAGGGAATGGCATGGCGGGCAGTCTCAGAGGGCCAGGAGAGTGTGGATGGTGTGGCCAGAAAGAGGAAGAGCTGGGCAGGCAGGAATGGTGAGTGGAAGTGGCATGGGAGGGGCCGAGCAATGACCCTCAC (SEQ ID NO:5206) where the underline = TDP-43 binding site.

[0182] In some embodiments, the cryptic exon sequence within the UNC13A mRNA transcript is as shown in SEQ ID NO:5207. CCATCTCTCCATCCATCCTTTTATCTACTCATCACTCATTCATCTGTTCAATCATTCATTCATTCACCAGCATTTATTCAACAAACTAGTTCCTGGGGATAAGAGTTCTTTCCAGGAAACCCAGGCAGCTGGAAGAGACATACCCAGACACAAACGGCCCAATCCTGAGTGGTTAGGG (SEQ ID NO:5207).

[0183] In some embodiments, the cryptic exon sequence within the UNC13A mRNA transcript is shown as SEQ ID NO:5208. CCATCTCTCCATCCATCCTTTTATCTACTCATCACTCATTCATCTGTTCAATCATTCATTCATTCACCAGCATTTATTCAACAAACTAGTTCCTGGGGATAAGAGTTCTTTCCAGGAAACCCAGGCAG (SEQ ID NO:5208). UNC13A oligonucleotide targeting region of UNC13A transcripts

[0184] In various embodiments, the UNC13A AONs disclosed herein are complementary to a specific region of a UNC13A transcript (e.g., a UNC13A pre-mRNA) comprising a sequence that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208. In some embodiments, the UNC13A AON comprises a sequence that is complementary to a specific region of a UNC13A transcript comprising a sequence that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208. In some embodiments, the UNC13A AON comprises a sequence that is at least 85% complementary to a specific region of a UNC13A transcript. In some embodiments, the UNC13A AON comprises a sequence that is at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% complementary to a specific region of a UNC13A transcript. In some embodiments, the UNC13A AON comprises a sequence that is 90% to 99% complementary to a specific region of a UNC13A transcript. In some embodiments, the UNC13A AON comprises a sequence that is 90% to 95% complementary to a specific region of a UNC13A transcript. In some embodiments, the UNC13A AON comprises a sequence that is 95% to 99% complementary to a specific region of a UNC13A transcript.

[0185] In some embodiments, a UNC13A AON (e.g., a UNC13A AON) has a segment containing up to 7 linked nucleosides. In some embodiments, a UNC13A AON has a segment containing up to 6, 5, 4, 3, or 2 linked nucleosides. A segment of a UNC13A_AON can be separated from other segments of a UNC13A_AON by a spacer. The segment of UNC13AAON is complementary to a specific region of a UNC13A transcript (e.g., a UNC13A transcript) that comprises a sequence that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to any one of SEQ ID NOs: 5057-5063, or a UNC13A pre-mRNA transcript transcribed from SEQ ID NOs: 5064 or 5065, or SEQ ID NOs: 5206-5208. UNC13A oligonucleotide variants

[0186] In various embodiments, the UNC13A AON comprises different variants, hereinafter referred to as UNC13A AON variants. The UNC13A AON variant can be an oligonucleotide sequence of 5 to 100 nucleobases in length, for example, 10 to 40 nucleobases in length, for example, 14 to 40 nucleobases in length, 10 to 30 nucleobases in length, for example, 14 to 30 nucleobases in length, for example, 16 to 28 nucleobases in length, for example, 19 to 23 nucleobases in length, for example, 21 to 23 nucleobases in length, for example, or 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length. The UNC13A AON variant can be an oligonucleotide sequence that is complementary to a portion of a UNC13A pre-mRNA sequence or a UNC13A gene sequence.

[0187] In various embodiments, the UNC13A AON variant represents a modified version of the corresponding UNC13A parent oligonucleotide comprising a nucleobase sequence selected from any one of SEQ ID NOs: 1- 1264. In some embodiments, the UNC13A AON variant comprises a nucleobase sequence that represents a shortened version of the nucleobase sequence of a UNC13A AON selected from any one of SEQ ID NOs: 1- 1264. As an example, if the UNC13A parent oligonucleotide comprises a 25mer (e.g., 25 oligonucleotide units in length), the variant (e.g., UNC13A variant) can comprise a shorter version (e.g., 15mer, 16mer, 17mer, 18mer, 19mer, 20mer, 21mer, or 23mer) of the 25mer UNC13A parent oligonucleotide. In one embodiment, the nucleobase sequence of a UNC13A AON variant differs from the corresponding nucleobase sequence of a UNC13A parent oligonucleotide in that 1, 2, 3, 4, 5, or 6 oligonucleotide units are removed from one or both of the 3' and 5' ends of the nucleobase sequence of the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 23mer in which two oligonucleotide units are removed from either the 3' or 5' end of a 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 23mer in which one nucleotide base is removed from each of the 3' and 5' ends of a 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 21mer in which two oligonucleotide units are removed from each of the 3' and 5' ends of a 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 21mer wherein four oligonucleotide units are removed from the 3' or 5' end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 20mer wherein two oligonucleotide units are removed from the 3' end of the 25mer included in the UNC13A parent oligonucleotide, and three oligonucleotide units are removed from the 5' end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 20mer wherein three oligonucleotide units are removed from the 3' end of the 25mer included in the UNC13A parent oligonucleotide, and two oligonucleotide units are removed from the 5' end of the 25mer included in the UNC13A parent oligonucleotide.In one embodiment, the corresponding UNC13A AON variant may comprise a 20mer wherein five oligonucleotide units are removed from the 3' or 5' end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 19mer wherein three oligonucleotide units are removed from each of the 3' and 5' ends of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 19mer wherein two oligonucleotide units are removed from the 3' end of the 25mer included in the UNC13A parent oligonucleotide and four oligonucleotide units are removed from the 5' end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 19mer wherein four oligonucleotide units are removed from the 3' end of the 25mer included in the UNC13A parent oligonucleotide and two oligonucleotide units are removed from the 5' end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 19mer in which six oligonucleotide units are removed from the 3' or 5' end of the 25mer comprised in the UNC13A parent oligonucleotide.

[0188] In one embodiment, the corresponding UNC13A AON variant may comprise an 18mer wherein two oligonucleotide units are removed from the 3' terminus of the 25mer included in the UNC13A parent oligonucleotide and five oligonucleotide units are removed from the 5' terminus of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise an 18mer wherein five oligonucleotide units are removed from the 3' terminus of the 25mer included in the UNC13A parent oligonucleotide and two oligonucleotide units are removed from the 5' terminus of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise an 18mer wherein one oligonucleotide unit is removed from the 3' terminus of the 25mer included in the UNC13A parent oligonucleotide and six oligonucleotide units are removed from the 5' terminus of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise an 18mer wherein six oligonucleotide units are removed from the 3' end of the 25mer comprised in the UNC13A parent oligonucleotide and one oligonucleotide unit is removed from the 5' end of the 25mer comprised in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise an 18mer wherein seven oligonucleotide units are removed from either the 3' or 5' end of the 25mer comprised in the UNC13A parent oligonucleotide.

[0189] In one embodiment, the corresponding UNC13A AON variant may comprise a 17mer wherein two oligonucleotide units are removed from the 3' end of the 25mer included in the UNC13A parent oligonucleotide, and six oligonucleotide units are removed from the 5' end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 17mer wherein six oligonucleotide units are removed from the 3' end of the 25mer included in the UNC13A parent oligonucleotide, and two oligonucleotide units are removed from the 5' end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 17mer wherein eight oligonucleotide units are removed from either the 3' or 5' end of the 25mer included in the UNC13A parent oligonucleotide.

[0190] In one embodiment, the corresponding UNC13A AON variant may comprise a 16mer wherein two oligonucleotide units are removed from the 3' end of the 25mer included in the UNC13A parent oligonucleotide and seven oligonucleotide units are removed from the 5' end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 16mer wherein seven oligonucleotide units are removed from the 3' end of the 25mer included in the UNC13A parent oligonucleotide and two oligonucleotide units are removed from the 5' end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 16mer wherein nine oligonucleotide units are removed from either the 3' or 5' end of the 25mer included in the UNC13A parent oligonucleotide.

[0191] In one embodiment, the corresponding UNC13A AON variant may comprise a 15mer wherein two oligonucleotide units are removed from the 3' end of the 25mer included in the UNC13A parent oligonucleotide, and eight oligonucleotide units are removed from the 5' end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 15mer wherein eight oligonucleotide units are removed from the 3' end of the 25mer included in the UNC13A parent oligonucleotide, and two oligonucleotide units are removed from the 5' end of the 25mer included in the UNC13A parent oligonucleotide. In one embodiment, the corresponding UNC13A AON variant may comprise a 15mer wherein ten oligonucleotide units are removed from either the 3' or 5' end of the 25mer included in the UNC13A parent oligonucleotide. Tables 2A and 2B below show example sequences of UNC13A AON variants. Table 2A. Example UNC13A oligonucleotide variant sequences *The at least one nucleoside linkage of the nucleobase is selected from the group consisting of phosphorothioate, alkylphosphonate, phosphorodithioate, phosphotriester, alkylphosphonate, 3-methoxypropylphosphonate, methylphosphonate, aminoalkylphosphotriester, alkylenephosphonate, phosphinate, phosphoramidate, thiophosphoramidate, thiophosphorodiamidate, phosphorodiamidate (e.g., including phosphorodiamidate morpholino (PMO), 3' aminoribose, or 5' aminoribose) linkages, aminoalkylphosphoramidate, thiophosphoramidate, thioalkylphosphonate, thioalkylphosphotriester, phosphorothioate, selenophosphate, and boranophosphate. Table 2B. Example UNC13A oligonucleotide variant sequences *The at least one nucleoside linkage of the nucleobase is selected from the group consisting of phosphorothioate, alkylphosphonate, phosphorodithioate, phosphotriester, alkylphosphonate, 3-methoxypropylphosphonate, methylphosphonate, aminoalkylphosphotriester, alkylenephosphonate, phosphinate, phosphoramidate, thiophosphoramidate, thiophosphorodiamidate, phosphorodiamidate (e.g., including phosphorodiamidate morpholino (PMO), 3' aminoribose, or 5' aminoribose) linkages, aminoalkylphosphoramidate, thiophosphoramidate, thioalkylphosphonate, thioalkylphosphotriester, phosphorothioate, selenophosphate, and boranophosphate.

[0192] In various embodiments, each nucleoside of the antisense oligonucleotides shown in Table 2B is a modified nucleoside having a 2'-O-(2-methoxyethyl) (2'MOE) sugar moiety, and each "C" is replaced by 5-methylcytosine (5-MeC). In addition, each internucleoside linkage between nucleosides is a phosphorothioate internucleoside linkage. Antisense oligonucleotides with one or more locked nucleic acids (LNA)

[0193] In various embodiments, the antisense oligonucleotides disclosed herein (e.g., UNC13A parent oligonucleotides and / or UNC13A oligonucleotide variants) comprise one or more locked nucleic acids (LNAs). In specific embodiments, the antisense oligonucleotide comprises one LNA. In specific embodiments, the antisense oligonucleotide comprises two LNAs. In specific embodiments, the antisense oligonucleotide comprises three LNAs. Generally, LNAs refer to nucleic acid monomers having a bridge (e.g., a methylene, ethylene, aminooxy, or hydroxyimino bridge) connecting two carbon atoms between the 4' and 2' positions of the nucleoside sugar unit, thereby forming a bicyclic sugar.

[0194] In some embodiments, if counting from 5' to 3', the antisense oligonucleotides disclosed herein include an LNA at the 4th position of the antisense oligonucleotide. In some embodiments, if counting from 5' to 3', the antisense oligonucleotides disclosed herein include an LNA at the 7th position of the antisense oligonucleotide. In some embodiments, if counting from 5' to 3', the antisense oligonucleotides disclosed herein include an LNA at the 9th position of the antisense oligonucleotide. In some embodiments, if counting from 5' to 3', the antisense oligonucleotides disclosed herein include an LNA at the 12th position of the antisense oligonucleotide. In some embodiments, if counting from 5' to 3', the antisense oligonucleotides disclosed herein include an LNA at the 15th position of the antisense oligonucleotide. In some embodiments, if counting from 5' to 3', the antisense oligonucleotides disclosed herein include an LNA at the 17th position of the antisense oligonucleotide. In some embodiments, if counting from 5' to 3', the antisense oligonucleotides disclosed herein include an LNA at the 20th position of the antisense oligonucleotide.

[0195] In various embodiments, the antisense oligonucleotides disclosed herein (e.g., UNC13A parent oligonucleotides and / or UNC13A oligonucleotide variants) comprise two LNAs located at two different positions of the antisense oligonucleotide. In some embodiments, if counting from 5' to 3', the antisense oligonucleotides disclosed herein comprise a first LNA at the 4th position of the antisense oligonucleotide and a second LNA at the 20th position of the antisense oligonucleotide. In some embodiments, if counting from 5' to 3', the antisense oligonucleotides disclosed herein comprise a first LNA at the 7th position of the antisense oligonucleotide and a second LNA at the 15th position of the antisense oligonucleotide. In some embodiments, if counting from 5' to 3', the antisense oligonucleotides disclosed herein comprise a first LNA at the 7th position of the antisense oligonucleotide and a second LNA at the 17th position of the antisense oligonucleotide. In some embodiments, if counting from 5' to 3', the antisense oligonucleotides disclosed herein comprise a first LNA at the 9th position of the antisense oligonucleotide and a second LNA at the 17th position of the antisense oligonucleotide.

[0196] In various embodiments, the antisense oligonucleotides disclosed herein (e.g., UNC13A parent oligonucleotides and / or UNC13A oligonucleotide variants) comprise three LNAs located at three different positions of the antisense oligonucleotide. In some embodiments, if counting from 5' to 3', the antisense oligonucleotides disclosed herein include a first LNA at the 4th position of the antisense oligonucleotide, a second LNA at the 12th position of the antisense oligonucleotide, and a third LNA at the 20th position of the antisense oligonucleotide. Antisense oligonucleotides with one or more spacers

[0197] In various embodiments, the antisense oligonucleotide comprises one or more spacers. In a specific embodiment, the antisense oligonucleotide comprises one spacer. In a specific embodiment, the antisense oligonucleotide comprises two spacers. In a specific embodiment, the antisense oligonucleotide comprises three spacers. Generally, a spacer refers to a nucleoside replacement group lacking a nucleotide base, wherein the nucleoside sugar moiety is replaced by a non-sugar substituent. The non-sugar substituent group cannot be connected to the core base, but can be connected to the 3' and 5' positions of the nucleoside adjacent to the spacer through an internucleoside linking group.

[0198] In certain embodiments, an oligonucleotide having one or more spacers, such as an oligonucleotide disclosed herein, can be an oligonucleotide of 5 to 100 oligonucleotide units in length, e.g., 10 to 60 oligonucleotide units in length, e.g., 12 to 50 oligonucleotide units in length, 14 to 40 oligonucleotide units in length, 10 to 30 oligonucleotide units in length, e.g., 14 to 30 oligonucleotide units in length, e.g., 14 to 25 or 15 to 22 oligonucleotide units in length, or 18, 19, 20, 21, 22, 23, 24, or 25 oligonucleotide units in length. As used herein, an "oligonucleotide unit" refers to a nucleoside (e.g., a nucleoside comprising a sugar and / or a nucleobase) or a nucleoside surrogate group (e.g., a spacer) of an oligonucleotide.

[0199] In a specific embodiment, the oligonucleotide having one or more spacers is 25 oligonucleotide units in length. In a specific embodiment, the oligonucleotide having one or more spacers is 23 oligonucleotide units in length. In a specific embodiment, the oligonucleotide having one or more spacers is 21 oligonucleotide units in length. In a specific embodiment, the oligonucleotide having one or more spacers is 19 oligonucleotide units in length. In various embodiments, the oligonucleotide having one or more spacers is at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units in length. In various embodiments, the oligonucleotide having one or more spacers is at least 18 oligonucleotide units in length. In various embodiments, the oligonucleotide having one or more spacers is at least 19 oligonucleotide units in length. In various embodiments, the oligonucleotide having one or more spacers is at least 20 oligonucleotide units in length. In various embodiments, the oligonucleotide having one or more spacers is at least 21 oligonucleotide units in length. In various embodiments, the oligonucleotide having one or more spacers is at least 22 oligonucleotide units in length. In various embodiments, the oligonucleotide having one or more spacers is at least 23 oligonucleotide units in length. In various embodiments, the oligonucleotide having one or more spacers is at least 24 oligonucleotide units in length. In various embodiments, the oligonucleotide having one or more spacers is at least 25 oligonucleotide units in length.

[0200] In various embodiments, the UNC13A AON comprises a sequence that is at least 80% identical to an equal length portion of any one of SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292. In various embodiments, the UNC13A AON comprises a sequence that is at least 85% identical to an equal length portion of any one of SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292. In various embodiments, the UNC13A AON comprises a sequence that is at least 90% identical to an equal length portion of any one of SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292. In various embodiments, the UNC13A AON comprises a sequence that is at least 95% identical to an equal length portion of any one of SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292. In various embodiments, the UNC13A AON comprises a sequence that is 100% identical to an equal length portion of any one of SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292.

[0201] In some embodiments, the spacer has formula (X): wherein Ring A is as defined herein.

[0202] In some embodiments, the spacer has formula (Xa): wherein Ring A is as defined herein and the -CH2-O- group is located on the Ring A atom adjacent to the -O- group.

[0203] As generally defined herein, Ring A of Formula (X) and (Xa) is an optionally substituted 4-8 membered monocyclic cycloalkyl group (e.g., Ring A is cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl) or a 4-8 membered monocyclic heterocyclic group, wherein the heterocyclic group contains 1 or 2 heteroatoms selected from O, S and N (e.g., Ring A is oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, azepanyl). In some embodiments, Ring A is tetrahydrofuranyl. In some embodiments, Ring A is tetrahydropyranyl. In some embodiments, Ring A is pyrrolidinyl. In some embodiments, Ring A is cyclopentyl. In some embodiments, the monocyclic cycloalkyl or monocyclic heterocyclic group is not further substituted. In some embodiments, the cycloalkyl or heterocyclyl is further substituted with 0, 1, 2, or 3 substituents selected from halogen (e.g., -F, -Cl), -OMe, -OEt, -OEt-O(CH2)OMe, -O(CH2)2OMe, and CN.

[0204] In some embodiments, tetrahydrofuranyl is substituted with 1 or 2 substituents selected from halogen (e.g., -F, -Cl), -OMe, -OEt, -OEt-O(CH2)OMe, -O(CH2)2OMe, and CN. In some embodiments, tetrahydrofuranyl is substituted with 2 substituents selected from halogen (e.g., -F, -Cl), -OMe, -OEt, -OEt-O(CH2)OMe, -O(CH2)2OMe, and CN. In some embodiments, tetrahydrofuranyl is substituted with 1 substituent selected from halogen (e.g., -F, -Cl), -OMe, -OEt, -OEt-O(CH2)OMe, -O(CH2)2OMe, and CN. In some embodiments, tetrahydrofuranyl is substituted with -O(CH2)2OMe.

[0205] In some embodiments, the spacer is represented by formula (I), wherein: X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.

[0206] In some embodiments, the spacer is represented by formula (I'), wherein: X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.

[0207] In some embodiments, the spacer is represented by Formula (Ia), wherein: And n is 0, 1, 2 or 3.

[0208] In some embodiments, the spacer is represented by formula (Ia'), wherein: And n is 0, 1, 2 or 3.

[0209] As generally defined herein, X is selected from -CH2- and -O-. In some embodiments, X is -CH2-. In other embodiments, X is -O-.

[0210] As generally defined herein, n is 0, 1, 2, or 3. In some embodiments, n is 0. In some embodiments, n is 1 or 2. In some embodiments, n is 1. In other embodiments, n is 2. In certain embodiments, n is 3.

[0211] In some embodiments, the spacer is represented by formula (II), wherein: X is selected from -CH2- and -O-.

[0212] In some embodiments, the spacer is represented by formula (II'), wherein: X is selected from -CH2- and -O.

[0213] In some embodiments, the spacer is represented by Formula (Iia), wherein:

[0214] In some embodiments, the spacer is represented by formula (Iia'), wherein:

[0215] In some embodiments, the spacer is represented by formula (III), wherein: X is selected from -CH2- and -O-.

[0216] In some embodiments, the spacer is represented by formula (III'), wherein: X is selected from -CH2- and -O.

[0217] In some embodiments, the spacer is represented by formula (IIIb), wherein:

[0218] In some embodiments, the spacer is represented by formula (Iiib'), wherein:

[0219] In some embodiments, the spacer is represented by formula (III), wherein: X is selected from -CH2- and -O-.

[0220] In some embodiments, the spacer is represented by formula (III'), wherein: X is selected from -CH2- and -O.

[0221] In some embodiments, the spacer is represented by formula (IIIa), wherein:

[0222] In some embodiments, the spacer is represented by formula (IIIa'), wherein:

[0223] In some embodiments, the open positions (i.e., positions not specifically described as bearing only hydrogen atoms, including -CH2- groups for X) of Formula (I), (I'), (Ia), (Ia'), (II), (II'), (Iia), (Iia'), (III), (III'), (IIIa), and (IIIa') are further substituted with 0-3 substituents independently selected from halogen (e.g., -F, -Cl), -OMe, -OEt, -OEt-O(CH2)OMe, -O(CH2)2OMe, and CN. In some embodiments, Formula (I), (I'), (Ia), (Ia'), (II), (II'), (Iia), (Iia'), (III), (III'), (IIIa), and (IIIa') are not further substituted.

[0224] As further described below, UNC13A oligonucleotides having one or more spacers are described with reference to a corresponding UNC13A parent oligonucleotide or a corresponding UNC13A variant oligonucleotide. In various embodiments, a UNC13A oligonucleotide having a spacer differs from a UNC13A parent oligonucleotide or a UNC13A variant oligonucleotide in that the spacer replaces a nucleoside in the UNC13A parent oligonucleotide or UNC13A variant oligonucleotide. As used below, a "position" of a UNC13A oligonucleotide refers to a specific location counted from the 5' end of the UNC13A oligonucleotide. In various embodiments, the spacer replaces a nucleoside at any of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 of a UNC13A parent oligonucleotide or a UNC13A variant oligonucleotide. In specific embodiments, the spacer replaces a nucleoside at one of positions 7, 8, 11, 14, 16, 19, or 22 of a UNC13A parent oligonucleotide or a UNC13A variant oligonucleotide.

[0225] In various embodiments, a UNC13A oligonucleotide includes a spacer that replaces a nucleoside in a UNC13A oligonucleotide (e.g., a spacer replaces a nucleoside in a UNC13A oligonucleotide). In specific embodiments, the spacer replaces the nucleoside between positions 9 and 15 of a UNC13A oligonucleotide. In specific embodiments, the spacer replaces the nucleoside between positions 9 and 12 of a UNC13A oligonucleotide. In specific embodiments, the spacer replaces the nucleoside at position 10 of a UNC13A oligonucleotide. In specific embodiments, the spacer replaces the nucleoside at position 11 of a UNC13A oligonucleotide. In specific embodiments, the spacer replaces the nucleoside at position 12 of a UNC13A oligonucleotide. In specific embodiments, the spacer replaces the nucleoside between positions 12 and 16 of a UNC13A oligonucleotide. In specific embodiments, the spacer replaces the nucleoside at position 15 of a UNC13A oligonucleotide.

[0226] In various embodiments, a UNC13A oligonucleotide comprising a spacer has two segments, wherein at least one of the two segments has at most 11 linked nucleosides. For example, a UNC13A oligonucleotide can be 23 oligonucleotide units in length, and the spacer can be located at position 12. Thus, the UNC13A oligonucleotide has two segments separated by a spacer, wherein both segments are 11 nucleobases in length. In various embodiments, a UNC13A oligonucleotide comprising a spacer has two segments, wherein at least one of the two segments has at most 10 linked nucleosides. For example, a UNC13A oligonucleotide can be 21 oligonucleotide units in length, and the spacer can be located at position 11. Thus, the UNC13A oligonucleotide has two segments separated by a spacer, wherein both segments are 10 nucleobases in length. As another example, a UNC13A oligonucleotide can be 25 oligonucleotide units in length, and the spacer can be located at position 15. Thus, the UNC13A oligonucleotide has two segments separated by a spacer, wherein one of the two segments is 14 nucleobases in length and the second of the two segments is 10 nucleobases in length.

[0227] In various embodiments, the UNC13A oligonucleotide comprises two spacers, each spacer replacing a nucleoside in the UNC13A oligonucleotide (e.g., two spacers replacing two individual nucleosides in the UNC13A oligonucleotide). In various embodiments, the first spacer and the second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, at least 7 nucleobases, at least 8 nucleobases, at least 9 nucleobases, or at least 10 nucleobases in the oligonucleotide. In specific embodiments, the first spacer and the second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases. In specific embodiments, the first spacer and the second spacer are not adjacent to each other in the oligonucleotide.

[0228] In specific embodiments, the first spacer replaces nucleosides between positions 7 and 11 of the UNC13A oligonucleotide. In various embodiments, the first spacer replaces nucleosides between positions 8 and 11, positions 9 and 11, positions 10 and 11, positions 7 and 10, positions 7 and 9, positions 7 and 8, positions 8 and 10, positions 8 and 9, or positions 9 and 10 of the UNC13A oligonucleotide. In specific embodiments, the second spacer replaces nucleosides between positions 14 and 22 of the UNC13A oligonucleotide. In various embodiments, the second spacer replaces the nucleosides between positions 15 and 22, positions 16 and 22, positions 17 and 22, positions 18 and 22, positions 19 and 22, positions 20 and 22, positions 21 and 22, positions 15 and 21, positions 16 and 21, positions 17 and 21, positions 18 and 21, positions 19 and 21, positions 20 and 21, positions 15 and 20, positions 16 and 20, positions 17 and 20, positions 18 and 20, positions 19 and 20, positions 15 and 19, positions 16 and 19, positions 17 and 19, positions 18 and 19, positions 15 and 18, positions 16 and 18, positions 17 and 18, positions 15 and 17, positions 16 and 17, or positions 15 and 16 of the UNC13A oligonucleotide.

[0229] In a preferred embodiment, the first spacer replaces the nucleoside at position 7 of the UNC13A oligonucleotide, and the second spacer replaces the nucleoside at position 14 of the UNC13A oligonucleotide. In a preferred embodiment, the first spacer replaces the nucleoside at position 7 of the UNC13A oligonucleotide, and the second spacer replaces the nucleoside at position 19 of the UNC13A oligonucleotide. In a preferred embodiment, the first spacer replaces the nucleoside at position 8 of the parent UNC13A oligonucleotide, and the second spacer replaces the nucleoside at position 16 of the parent UNC13A oligonucleotide. In a preferred embodiment, the first spacer replaces the nucleoside at position 8 of the UNC13A oligonucleotide, and the second spacer replaces the nucleoside at position 15 of the UNC13A oligonucleotide. In a preferred embodiment, the first spacer replaces the nucleoside at position 11 of the UNC13A oligonucleotide, and the second spacer replaces the nucleoside at position 22 of the UNC13A oligonucleotide. In a preferred embodiment, the first spacer replaces the nucleoside at position 9 of the UNC13A oligonucleotide, and the second spacer replaces the nucleoside at position 19 of the UNC13A oligonucleotide.

[0230] In various embodiments, a UNC13A oligonucleotide comprises three spacers, each spacer replacing a nucleoside in a UNC13A oligonucleotide (e.g., three spacers replace three separate nucleosides of a UNC13A oligonucleotide). In specific embodiments, a first spacer replaces nucleosides between positions 7 and 11 of a UNC13A oligonucleotide. In specific embodiments, a second spacer replaces nucleosides between positions 14 and 22 of a UNC13A oligonucleotide. In specific embodiments, a third spacer replaces nucleosides between positions 21 and 24 of a UNC13A oligonucleotide. In some embodiments, a first spacer replaces nucleosides between positions 2 and 5 of a UNC13A oligonucleotide. In specific embodiments, a second spacer replaces nucleosides between positions 8 and 12 of a UNC13A oligonucleotide. In specific embodiments, a third spacer replaces nucleosides between positions 18 and 22 of a UNC13A oligonucleotide.

[0231] In various embodiments, the three spacers in a UNC13A oligonucleotide are positioned such that each of the four segments of the UNC13A oligonucleotide is at most 7 linked nucleosides in length. For example, a UNC13A oligonucleotide can have a first segment of 7 linked nucleosides linked to a first spacer, followed by a second segment of 7 linked nucleosides linked to the first spacer at one end and to the second spacer at the other end, followed by a third segment of 6 linked nucleosides linked to the second spacer at one end and to the third spacer at the other end, followed by a fourth segment of 6 linked nucleosides linked to the third spacer.

[0232] In various embodiments, one or more spacers are positioned in oligonucleotide to replace one or more adenosine or thymidine (relative to guanine or cytidine). For example, one or more spacers can replace one, two, three, four, five, six, seven, eight or nine adenosine or thymidine in oligonucleotide. In various embodiments, one or more spacers are positioned in oligonucleotide to replace one or more guanine or cytidine (relative to adenosine or thymidine). For example, one or more spacers can replace one, two, three, four, five, six, seven, eight or nine guanine or cytidine in oligonucleotide. In various embodiments, spacers are positioned in oligonucleotide to replace equivalent adenosine / thymidine and guanine / cytidine. For example, the first spacer in oligonucleotide can replace adenosine / thymidine, and the second spacer in oligonucleotide can replace guanine / cytidine.

[0233] In various embodiments, one or more spacers are positioned in the oligonucleotide to control the sequence content in the oligonucleotide.For example, the position of one or more spacers is such that at least one spacer is adjacent to the guanine group.In various embodiments, the oligonucleotide with spacer can include a spacer adjacent to the guanine group, two spacers adjacent to the guanine group, three spacers adjacent to the guanine group, four spacers adjacent to the guanine group, or five spacers adjacent to the guanine group.In one embodiment, if counting from the 5 ' end of the oligonucleotide, then before the guanine group in the spacer next to the sequence.Therefore, in various embodiments, the oligonucleotide with spacer can include a spacer next to the guanine group, two spacers next to the guanine group, three spacers next to the guanine group, four spacers next to the guanine group, or five spacers next to the guanine group.In one embodiment, if counting from the 5 ' end of the oligonucleotide, after the guanine group, the spacer is next to the sequence. Thus, in various embodiments, an oligonucleotide with a spacer can include one spacer immediately adjacent to a guanine group, two spacers immediately adjacent to a guanine group, three spacers immediately adjacent to a guanine group, four spacers immediately adjacent to a guanine group, or five spacers immediately adjacent to a guanine group. In various embodiments, the spacers in an oligonucleotide can be positioned to maximize the number of spacers adjacent to a guanine group.

[0234] In various embodiments, one or more spacers are positioned in an oligonucleotide to replace one or more adenosine or thymidine nucleosides such that one or more spacers are positioned adjacent to a guanine group. For example, two spacers can replace an adenosine or thymidine nucleoside in an oligonucleotide, with each of the two spacers being adjacent to a guanine group.

[0235] In various embodiments, the UNC13A oligonucleotides having one or more spacers have a specific GC content. As used herein, GC content (or guanine-cytosine content) is the percentage of nitrogenous bases that are guanine (G) or cytosine (C) in an oligonucleotide. In various embodiments, the UNC13A oligonucleotides having one or more spacers have a GC content of at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%. In specific embodiments, the UNC13A oligonucleotides having one or more spacers have a GC content of at least 30%. In specific embodiments, a UNC13A oligonucleotide having one or more spacers has a GC content of at least 40%. In various embodiments, one or more spacers are positioned in a UNC13A oligonucleotide to maximize GC content. For example, rather than selecting guanine or cytosine for spacer substitution in a UNC13A oligonucleotide, thymine or adenine can be selected for spacer substitution.

[0236] In various embodiments, UNC13A oligonucleotides with spacers are designed such that 1) each segment of the UNC13A oligonucleotide has at most 7 linked nucleosides, and 2) at least two, three, or four spacers are adjacent to a guanine group. In some embodiments, UNC13A oligonucleotides with spacers are designed such that 1) each segment of the UNC13A oligonucleotide has at most 7 linked nucleosides, and 2) each of the two spacers is located before a guanine group.

[0237] In various embodiments, the inclusion of one or more spacers in a UNC13A oligonucleotide does not reduce the efficacy of the UNC13A oligonucleotide with a spacer in restoring full-length UNC13A protein or full-length UNC13A mRNA, as compared to the efficacy of the corresponding UNC13A parent oligonucleotide. In various embodiments, the inclusion of one or more spacers in a UNC13A oligonucleotide increases the efficacy of the UNC13A oligonucleotide with a spacer in restoring full-length UNC13A protein or full-length UNC13A mRNA, as compared to the efficacy of the corresponding UNC13A parent oligonucleotide. In various embodiments, the inclusion of one or more spacers in a UNC13A oligonucleotide does not reduce the efficacy of the UNC13A oligonucleotide with a spacer in reducing the number of UNC13A transcripts, as compared to the efficacy of the corresponding UNC13A parent oligonucleotide. In various embodiments, the inclusion of one or more spacers in a UNC13A oligonucleotide increases the efficacy of the UNC13A oligonucleotide with a spacer in reducing the number of UNC13A transcripts, as compared to the efficacy of the corresponding UNC13A parent oligonucleotide.

[0238] Tables 3A, 3B, 4, and 5 record examples of UNC13A oligonucleotides having one or more spacers and their relationship to the corresponding UNC13A parent oligonucleotides. Each UNC13A oligonucleotide is assigned a sequence name. As used below, the sequence name nomenclature is represented as "X_spA" (for a UNC13A AON having one spacer), "X_spA_spB" (for a UNC13A AON having two spacers), or "X_spA_spB_spC" (for a UNC13A AON having three spacers). Here, "X" refers to the length of the UNC13A AON, "A" refers to the position of the first spacer in the UNC13A AON, "B" refers to the position of the second spacer in the UNC13A AON, and "C" (if present) refers to the position of the third spacer in the UNC13A AON.

[0239] In various embodiments, the UNC13A oligonucleotide comprises a spacer. In various embodiments, the UNC13A oligonucleotide is an oligonucleotide variant, such as any of a 23mer, a 21mer, or a 19mer. In various embodiments, the inclusion of the spacer divides the UNC13A oligonucleotide into two separate segments, wherein at least one segment is at most 11 linked nucleosides in length. In various embodiments, the inclusion of the spacer divides the UNC13A oligonucleotide into two separate segments, wherein at least one segment is at most 10 linked nucleosides in length.

[0240] In various embodiments, the spacer is located between positions 10 and 15 of the oligonucleotide. In various embodiments, the spacer is located between positions 10 and 12 of the oligonucleotide. In specific embodiments, the spacer is located at position 10 of the oligonucleotide. In specific embodiments, the spacer is located at position 11 of the oligonucleotide. In specific embodiments, the spacer is located at position 12 of the oligonucleotide. In specific embodiments, the spacer is located at position 15 of the oligonucleotide. Table 3A below lists example UNC13A AONs having one spacer. Table 3A: Identification of UNC13A AONs with one spacer. Here, each UNC13A AON has 2 segments, where at least one segment has up to 11 linked nucleosides. *The at least one nucleoside linkage of the nucleobase is selected from the group consisting of phosphorothioate, alkylphosphonate, phosphorodithioate, phosphotriester, alkylphosphonate, 3-methoxypropylphosphonate, methylphosphonate, aminoalkylphosphotriester, alkylenephosphonate, phosphinate, phosphoramidate, thiophosphoramidate, phosphorodiamidate (e.g., including phosphorodiamidate morpholino (PMO), 3' aminoribose, or 5' aminoribose) linkages, aminoalkylphosphoramidate, thiophosphoramidate, thioalkylphosphonate, thioalkylphosphotriester, phosphorothioate, selenophosphate, and boranophosphate.

[0241] In various embodiments, the UNC13A oligonucleotide includes two spacers. In various embodiments, the inclusion of a spacer divides the UNC13A oligonucleotide into three separate segments, wherein at least one segment is at most 7 linked nucleosides in length. Table 3B below lists example UNC13A AONs with two spacers. Table 3B: Identification of UNC13A AONs with two spacers. Here, each UNC13A AON has three segments, with at least one segment having up to 7 linked nucleosides. *The at least one nucleoside linkage of the nucleobase is selected from the group consisting of phosphorothioate, alkylphosphonate, phosphorodithioate, phosphotriester, alkylphosphonate, 3-methoxypropylphosphonate, methylphosphonate, aminoalkylphosphotriester, alkylenephosphonate, phosphinate, phosphoramidate, thiophosphoramidate, phosphorodiamidate (e.g., including phosphorodiamidate morpholino (PMO), 3' aminoribose, or 5' aminoribose) linkages, aminoalkylphosphoramidate, thiophosphoramidate, thioalkylphosphonate, thioalkylphosphotriester, phosphorothioate, selenophosphate, and boranophosphate.

[0242] In various embodiments, a UNC13A oligonucleotide includes three spacers. The inclusion of the three spacers divides the UNC13A oligonucleotide into four separate segments. In various embodiments, the three spacers are located at different positions within the UNC13A oligonucleotide such that each segment of the UNC13A oligonucleotide is at most 7 linked nucleosides in length. Table 4 below lists example UNC13A AONs with three spacers. Table 4: Identification of UNC13A AONs or AON variants with three spacers. Here, each UNC13A AON has four segments, wherein each segment has up to seven linked nucleosides. *The at least one nucleoside linkage of the nucleobase is selected from the group consisting of phosphorothioate, alkylphosphonate, phosphorodithioate, phosphotriester, alkylphosphonate, 3-methoxypropylphosphonate, methylphosphonate, aminoalkylphosphotriester, alkylenephosphonate, phosphinate, phosphoramidate, thiophosphoramidate, phosphorodiamidate (e.g., including phosphorodiamidate morpholino (PMO), 3' aminoribose, or 5' aminoribose) linkages, aminoalkylphosphoramidate, thiophosphoramidate, thioalkylphosphonate, thioalkylphosphotriester, phosphorothioate, selenophosphate, and boranophosphate.

[0243] In various embodiments, the length of the UNC13A AON with one or more spacers is reduced compared to the UNC13A AONs in Tables 3B and 4 above. For example, such UNC13A AONs can be UNC13A oligonucleotide variants with one or more spacers. In various embodiments, the UNC13A oligonucleotide variant with one or more spacers is a 23mer, a 21mer, or a 19mer. In various embodiments, the UNC13A oligonucleotide variant includes two spacers, such that the UNC13A oligonucleotide variant includes three segments separated by two spacers. In various embodiments, at least one of the three segments has no more than 7 linked nucleosides. In various embodiments, each of the three segments has no more than 7 linked nucleosides. Example UNC13A oligonucleotide variants with one or more spacers are shown in Table 5 below. Table 5: Example UNC13A AON variants with two spacers. Here, each UNC13A AON variant has three segments, wherein at least one segment has up to 7 linked nucleosides. *The at least one nucleoside linkage of the nucleobase is selected from the group consisting of phosphorothioate, alkylphosphonate, phosphorodithioate, phosphotriester, alkylphosphonate, 3-methoxypropylphosphonate, methylphosphonate, aminoalkylphosphotriester, alkylenephosphonate, phosphinate, phosphoramidate, thiophosphoramidate, phosphorodiamidate (e.g., including phosphorodiamidate morpholino (PMO), 3' aminoribose, or 5' aminoribose), aminoalkylphosphoramidate, thiophosphoramidate, thioalkylphosphonate, thioalkylphosphotriester, phosphorothioate, selenophosphate, and boranophosphate.

[0244] In some embodiments, the antisense oligonucleotides disclosed herein (e.g., UNC13A parent oligonucleotides and / or UNC13A oligonucleotide variants) comprise one or more spacers and one or more locked nucleic acids (LNAs). In some embodiments, the antisense oligonucleotides disclosed herein (e.g., UNC13A parent oligonucleotides and / or UNC13A oligonucleotide variants) comprise two spacers and two LNAs. In some embodiments, the antisense oligonucleotides disclosed herein (e.g., UNC13A parent oligonucleotides and / or UNC13A oligonucleotide variants) comprise two spacers and three LNAs.

[0245] In various embodiments, the spacer and LNA are adjacent to each other in the antisense oligonucleotide. For example, if counting from 5' to 3', the LNA can be located at position 7 of the antisense oligonucleotide and the spacer can be located at position 8 of the antisense oligonucleotide. As another example, if counting from 5' to 3', the LNA can be located at position 9 of the antisense oligonucleotide and the spacer can be located at position 8 of the antisense oligonucleotide. As another example, if counting from 5' to 3', the LNA can be located at position 15 of the antisense oligonucleotide and the spacer can be located at position 16 of the antisense oligonucleotide. As another example, if counting from 5' to 3', the LNA can be located at position 17 of the antisense oligonucleotide and the spacer can be located at position 16 of the antisense oligonucleotide.

[0246] In a specific embodiment, in the antisense oligonucleotide, the first spacer is adjacent to the first LNA, and the second spacer is adjacent to the second LNA. For example, if counting from 5' to 3', the first LNA may be located at position 7 of the antisense oligonucleotide, the first spacer may be located at position 8 of the antisense oligonucleotide, the second LNA may be located at position 15 of the antisense oligonucleotide, and the second spacer may be located at position 16 of the antisense oligonucleotide. As another example, if counting from 5' to 3', the first LNA may be located at position 7 of the antisense oligonucleotide, the first spacer may be located at position 8 of the antisense oligonucleotide, the second LNA may be located at position 17 of the antisense oligonucleotide, and the second spacer may be located at position 16 of the antisense oligonucleotide. As another example, if counting from 5' to 3', the first LNA may be located at position 9 of the antisense oligonucleotide, the first spacer may be located at position 8 of the antisense oligonucleotide, the second LNA may be located at position 17 of the antisense oligonucleotide, and the second spacer may be located at position 16 of the antisense oligonucleotide.

[0247] In various embodiments, the one or more spacers and the one or more LNAs are not adjacent to each other in the antisense oligonucleotide. For example, if counting from 5' to 3', the LNA may be located at position 4 of the antisense oligonucleotide, and the spacer may be located at position 8 of the antisense oligonucleotide. For example, if counting from 5' to 3', the LNA may be located at position 20 of the antisense oligonucleotide, and the spacer may be located at position 16 of the antisense oligonucleotide. In specific embodiments, if counting from 5' to 3', the first LNA may be located at position 4 of the antisense oligonucleotide, the first spacer may be located at position 8 of the antisense oligonucleotide, the second LNA may be located at position 20 of the antisense oligonucleotide, and the second spacer may be located at position 16 of the antisense oligonucleotide. In specific embodiments, if counting from 5' to 3', the first LNA may be located at position 4 of the antisense oligonucleotide, the first spacer may be located at position 8 of the antisense oligonucleotide, the second LNA may be located at position 12 of the antisense oligonucleotide, the second spacer may be located at position 16 of the antisense oligonucleotide, and the third LNA may be located at position 20 of the antisense oligonucleotide. Performance of UNC13A oligonucleotides

[0248] Typically, a UNC13A oligonucleotide and / or a UNC13A parent oligonucleotide (e.g., a UNC13A oligonucleotide having any of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292) targets a UNC13A transcript (e.g., a UNC13A pre-mRNA) comprising a sequence identical to that of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5066-5166. NO: 5206-5208 have at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to increase, restore, rescue or stabilize the expression level of UNC13A mRNA that can be translated to produce a functional UNC13A protein (e.g., full-length UNC13A). In various embodiments, the UNC13A AON can exhibit an increase of at least 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the full-length UNC13A mRNA. In various embodiments, the UNC13A AON can exhibit an increase of at least 100%, 200%, 300% or 400% of the full-length UNC13A mRNA. In various embodiments, the UNC13A AON may exhibit a reduction of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% in mis-spliced ​​UNC13A mRNA. In various embodiments, the UNC13A AON may exhibit an increase of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% in full-length UNC13A protein. In various embodiments, the UNC13A AON may exhibit an increase of at least 100%, 200%, 300%, or 400% in full-length UNC13A protein. In some embodiments, the percentage increase in full-length UNC13A protein is an increase compared to the reduction in full-length UNC13A protein achieved using a TDP43 antisense oligonucleotide. For example, a TDP43 antisense oligonucleotide can be used to deplete full-length UNC13A protein, followed by an increase in full-length UNC13A protein using a UNC13A AON.

[0249] In some embodiments, the UNC13A AON can exhibit at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full-length UNC13A protein. In some embodiments, the percent rescue of full-length UNC13A refers to the % of full-length UNC13A following depletion with a TDP43 antisense oligonucleotide and treatment with a UNC13A AON compared to a negative control (e.g., cells that have not undergone depletion or treatment or cells treated with vehicle solution).

[0250] In various embodiments, the UNC13A AON may exhibit a reduction of at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% in UNC13A transcripts having cryptic exons. In various embodiments, the UNC13A AON may exhibit a reduction of at least 100% in UNC13A transcripts having cryptic exons. In various embodiments, the reduction in UNC13A transcripts having cryptic exons is measured as compared to the level of UNC13A transcripts having cryptic exons detected using TDP43 antisense oligonucleotides. In various embodiments, the UNC13A AON may exhibit a reduction of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% in UNC13A transcripts having cryptic exons. Modification

[0251] Nucleoside is base-sugar combination. The core base (also referred to as base) part of nucleoside is normally heterocyclic base part. Nucleotide is the nucleoside that also comprises the phosphate group that is covalently attached to the sugar part of nucleoside. For those nucleosides comprising pentofuranosyl, the phosphate group can be attached to the 2 ' hydroxyl moiety, 3 ' hydroxyl moiety or 5 ' hydroxyl moiety of sugar. Oligonucleotide is formed by adjacent nucleosides being covalently attached to each other, to form linear polymeric oligonucleotide. In oligonucleotide structure, phosphate group is commonly referred to as the internucleoside bond that forms oligonucleotide.

[0252] Modifications of antisense compounds include substitutions or changes in internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often superior to native forms because they possess desirable properties, such as enhanced cellular uptake, enhanced affinity for nucleic acid targets, increased stability in the presence of nucleases, or increased activity.

[0253] Chemically modified nucleosides can also be used to increase the binding affinity of shortened or truncated antisense oligonucleotides to their target nucleic acids. Thus, comparable results can often be achieved using shorter antisense compounds having such chemically modified nucleosides. Modified internucleoside linkages

[0254] The internucleoside linkage of naturally occurring RNA and DNA is a 3' to 5' phosphodiester bond. Antisense compounds having one or more modified (i.e., non-naturally occurring) internucleoside linkages are generally preferred over antisense compounds having naturally occurring internucleoside linkages due to desirable properties, such as enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

[0255] The oligonucleotide of the internucleoside bond with modification comprises the internucleoside bond that retains phosphorus atom and the internucleoside bond that does not have phosphorus atom.Representational phosphorus-containing internucleoside bond includes but is not limited to phosphodiester, phosphotriester, methylphosphonate, phosphoramide and thiophosphate.The method for preparing phosphorus-containing and non-phosphorus-containing bond is known.

[0256] In certain embodiments, antisense compounds targeted to UNC13A nucleic acids comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are interspersed throughout the antisense compound. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of the antisense compound is a phosphorothioate internucleoside linkage. In certain embodiments, antisense compounds targeted to UNC13A nucleic acids comprise at least one phosphodiester linkage and at least one phosphorothioate linkage. Modified sugar moiety

[0257] The antisense compound may optionally contain one or more nucleosides in which the sugar group has been modified. Such sugar-modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological properties to the antisense compound. In certain embodiments, the nucleoside comprises a chemically modified ribofuranose ring portion. Examples of chemically modified ribofuranose rings include, but are not limited to, the addition of substituents (including 5' and 2' substituents, bridging non-geminal ring atoms to form bicyclic nucleic acids (BNAs), the use of S, N(R), or C(R1)(R2) (R, R1, and R2 are each independently H, C1-C 12 In some embodiments, the ribosyl ring oxygen atom is substituted with an alkyl or protecting group and a combination thereof. Examples of chemically modified sugars include 2'-F-5'-methyl substituted nucleosides (for other disclosed 5', 2'-disubstituted nucleosides, see PCT International Application No. WO 2008 / 101157, published on August 21, 2008) or 2'-S substituted ribosyl ring oxygen atom, further substituted at the 2'-position (see disclosed U.S. Patent Application No. US2005-0130923, published on June 16, 2005) or alternatively 5'-substituted with BNA (see PCT International Application No. WO 2007 / 134181, published on November 22, 2007, wherein LNA is, for example, 5'-methyl or 5'-vinyl substituted).

[0258] Examples of nucleosides with modified sugar moieties include, but are not limited to, nucleosides containing 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH3, 2'-OCH2CH3, 2'-O CH2CH2F, and 2'-O(CH2)2OCH3 substituents. The substituent at the 2' position may also be selected from allyl, amino, azido, thio, O-allyl, O—C1-C 10 Alkyl, OCF3, OCH2F, O(CH2)2S CH3, O(CH2)2—O—N(R m )(R n )、O—CH2—C(=O)—N(R m )(R n ) and O—CH2—C(=O)—N(R1)—(CH2)2—N(R m )(R n )-, where R l 、R m and R n Each independently represents H or substituted or unsubstituted C1-C 10 alkyl.

[0259] Other examples of modified sugar moieties include 2'-OMe modified sugar moieties, bicyclic sugar moieties, 2'-O-(2-methoxyethyl) (2'-MOE), 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), constrained ethyl 2'-4'-bridged nucleic acids (cEt), S-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analogs (e.g., tcDNA).

[0260] As used herein, "bicyclic nucleoside" refers to a modified nucleoside comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include, but are not limited to, nucleosides comprising a bridge between 4' and 2' ribosyl ring atoms. In certain embodiments, provided herein are antisense compounds that include one or more bicyclic nucleosides comprising a 4' to 2' bridge. Examples of such 4' to 2' bridged bicyclic nucleosides include, but are not limited to, one of the following formulae: 4'-(CH2)—O-2'(LNA); 4'-(CH2)—S-2'; 4'-(CH2)2—O-2'(ENA); 4'-CH(CH3)—O-2' and 4'-CH(CH2OCH3)—O-2' (and analogs thereof, see U.S. Patent No. 7,399,845, issued on July 15, 2008); 4'-C(CH3)(CH3)—O-2' (and analogs thereof, see Publication No. 5,666,845, issued on July 15, 2008). 2′-CH2—N(OCH3)-2′ (and analogs thereof, see published international application WO / 2008 / 150729, published on December 11, 2008); 4′-CH2—O—N(CH3)-2′ (see published U.S. patent application US2004-0171570, published on September 2, 2004); 4′-CH2—N(R)—O-2′, wherein R is H, C1-C 12 Alkyl or protecting group (see U.S. Patent No. 7,427,672, issued September 23, 2008); 4'-CH2-C(H)(CH3)-2' (see Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH2-C-(=CH2)-2' (and the like, see published International Application WO 2008 / 154401, published December 8, 2008).

[0261] Other reports on bicyclic nucleosides can also be found in the open literature (see, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129(26)8362-8379; Elayadi et al., Curr. Opinion Invest. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr. Opinion Mol. Ther., 2001, 3,239-243; U.S. Patent Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,399,845; 7,547,684; and 7,696,345; U.S. Patent Publication Nos. US2008-0039618; US2009-0012281; U.S. Patent Serial Nos. 60 / 989,574; 61 / 026,995; 61 / 026,998; 61 / 056,564; 61 / 086,231; 61 / 097,787; and 61 / 099,844; published PCT International Application No. WO Each of the above-mentioned bicyclic nucleosides can be prepared with one or more stereochemical sugar configurations, including, for example, α-L-ribofuranose and β-D-ribofuranose (see PCT International Application No. PCT / DK98 / 00393, published on March 25, 1999 as WO 99 / 14226).

[0262] In certain embodiments, the bicyclic sugar moiety of the BNA nucleoside includes, but is not limited to, compounds having at least one bridge between the 4' and 2' positions of the pentofuranosyl sugar moiety, wherein such bridge independently comprises 1 or 2 to 4 linking groups independently selected from -[C(Ra )(R b )] n —, —C(R a )=C(R b )—, —C(R a )=N—, —C(=O)—, —C(=NR a )—, —C(=S)—, —O—, —Si(R a )2—, —S(=O) x — and —N(R a )—; [[ID=2*]]Where: x is 0, 1 or 2; n is 1, 2, 3 or 4; R a and R b are each independently H, a protecting group, a hydroxyl group, C1-C 12 alkyl, substituted C1-C 12 alkyl, C2-C 12 alkenyl, substituted C2-C 12 alkenyl, C2-C[[ID=4*]]<* 12 alkynyl, substituted C2-C 12 alkynyl, C5-C 20 aryl, substituted C5-C 20 aryl, heterocyclic group, substituted heterocyclic group, heteroaryl, substituted heteroaryl, C5-C7 alicyclic group, substituted C5-C7 alicyclic group, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)—H), substituted acyl, CN, sulfonyl (S(=O)2-J1) or thioxyl (S(=O)-J1); and J** and J2 are each independently H, C1-C[[ID=5*]] 12 alkyl, substituted C1-C 12 alkyl, C2-C 12 alkenyl, substituted C2-C 12 alkenyl, C2-C 12 alkynyl, substituted C2-C 12 alkynyl, C5-C 20 aryl, substituted C5-C 20 aryl, acyl (C(=O)—H), substituted acyl, heterocyclic group, substituted heterocyclic group, C1-C[[ID=*6]] 12 aminoalkyl, substituted C1-C 12 aminoalkyl or a protecting group. "**

[0263] In certain embodiments, the bridge of the bicyclic sugar moiety is —[C(R a )(R b )] n It should be noted that there seem to be some errors or incomplete information in the original text, such as the inconsistent use of "*" in the tags and the unclear "**" in the translation. But this is the translation based on the provided text as accurately as possible.—、—[—[C(R a )(R b )] n —O—、—C(R a R b )—N(R)—O—or—C(R a R b In certain embodiments, the bridge is 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-O-N(R)-2', and 4'-CH2-N(R)-O-2'-, wherein each R is independently H, a protecting group, or a C1-C 12 Alkyl, R a and R b Each independently represents H, a protecting group, a hydroxyl group, a C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, heterocyclic, substituted heterocyclic, heteroaryl, substituted heteroaryl, C5-C7 alicyclic, substituted C5-C7 alicyclic, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1) or sulfoxide (S(=O)-J1); J1 and J2 are each independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C (= O) -H), substituted acyl, heterocyclic, substituted heterocyclic, C1-C 12 Aminoalkyl, substituted C1-C 12 Aminoalkyl or protecting group; R is H, C1-C 12 An alkyl group or a protecting group (see U.S. Patent No. 7,427,672, issued September 23, 2008).

[0264] In certain embodiments, bicyclic nucleosides are further defined by isomeric configurations. For example, nucleosides containing a 4'-2' methylene-oxy bridge can be in an α-L configuration or a β-D configuration. Previously, α-L-methyleneoxy (4'-CH2—O-2') BNAs have been incorporated into antisense oligonucleotides that exhibit antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

[0265] In certain embodiments, bicyclic nucleosides include but are not limited to α-L-methyleneoxy (4'-CH2—O-2') BNA, β-D-methyleneoxy (4'-CH2—O-2') BNA, ethyleneoxy (4'-(CH2)2—O-2) BNA, aminooxy (4'-CH2—O—N(R)-2') BNA, oxyamino (4'-CH2—N(R)—O-2') BNA, methyl (methyleneoxy) (4'-CH(CH3)—O-2') BNA, methylenethio (4'-CH2—S-2') BNA, methyleneamino (4'-CH2—N(R)-2') BNA, methyl carbocycle (4'-CH2—CH(CH3)-2') BNA, and propylene carbocycle (4'-(CH2)3-2') BNA; wherein R is H, C1-C 12 An alkyl group or a protecting group (see U.S. Patent No. 7,427,672, issued September 23, 2008).

[0266] In some embodiments, the present disclosure provides methods for treating, ameliorating, or preventing neurological diseases and / or neuropathy, further comprising administering to a patient a pharmaceutically acceptable composition (e.g., a pharmaceutically acceptable formulation comprising one or more UNC13A oligonucleotides). The UNC13A oligonucleotides can increase, restore, or stabilize UNC13A activity, e.g., UNC13A activity and / or UNC13A expression levels, e.g., UNC13A mRNA and / or protein expression.

[0267] The present disclosure also provides pharmaceutical compositions comprising UNC13A oligonucleotides formulated with one or more pharmaceutically or cosmetically acceptable excipients. These formulations include those suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intrathalamic, intracisternal, intraventricular, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous) administration, transmucosal (e.g., buccal, vaginal, and rectal) or topical use, for example as part of a composition suitable for topical application to the skin and / or mucous membranes, such as a gel, paste, wax, cream, spray, liquid, foam, lotion, ointment, topical solution, transdermal patch, powder, vapor, or tincture. Although the most suitable form of administration in any given case will depend on the extent and severity of the condition being treated and the nature of the specific UNC13A oligonucleotide being used.

[0268] The present disclosure also provides a pharmaceutical composition comprising a UNC13A oligonucleotide or a pharmaceutically acceptable salt thereof (e.g., a UNC13AAON comprising any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292).

[0269] The present disclosure also provides methods comprising the use of pharmaceutical compositions comprising UNC13A AON formulated together with one or more pharmaceutically acceptable excipients. Exemplary compositions provided herein include compositions comprising UNC13A AON and one or more pharmaceutically acceptable excipients. . Formulations include those suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intrathalamic, intracisternal, intracerebroventricular, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous) administration, transmucosal (e.g., buccal, vaginal, and rectal) or topical use. The most appropriate form of administration in any given case will depend on the clinical symptoms, complications, or biochemical indicators of the condition, disorder, disease, or condition that the subject is seeking to prevent; the condition, disorder, disease, or condition that the subject is seeking to prevent; and / or the nature of the specific compound and / or composition being used. Additional chemically modified UNC13A oligonucleotides

[0270] The UNC13A AONs described herein may include chemically modified nucleosides, including modified ribonucleosides and modified deoxyribonucleosides. Chemically modified nucleosides include, but are not limited to, uracine, uridine, 2'-O-(2-methoxyethyl) modifications, such as 2'-O-(2-methoxyethyl)guanosine, 2'-O-(2-methoxyethyl)adenosine, 2'-O-(2-methoxyethyl)cytosine, and 2'-O-(2-methoxyethyl)thymidine. In certain embodiments, the mixed form is, for example, a combination of UNC13A peptide nucleic acid (PNA) and UNC13A locked nucleic acid (LNA). Chemically modified nucleosides also include, but are not limited to, locked nucleic acid (LNA), 2'-O-methyl, 2'-fluoro and 2'-fluoro-β-D-arabinonucleotides (FANA), and fluorocyclohexenyl nucleic acid (F-CeNA) modifications. Chemically modified nucleosides that can be included in the UNC13A AON described herein are described in Johannes and Lucchino, (2018) “Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs” Nucleic Acid Ther. 28(3): 178–93; Rettig and Behlke, (2012) “Progress toward in vivo use of siRNAs-II” Mol Ther 20: 483–512; and Khvorova and Watts, (2017) “The chemical evolution of oligonucleotide therapies of clinical utility” Nat Biotechnol., 35(3): 238-48, the contents of each of which are incorporated herein by reference.

[0271] The UNC13A AONs described herein may include chemical modifications that promote stabilization of the terminal 5'-phosphate of the oligonucleotide and phosphatase-resistant 5'-phosphate analogs. Chemical modifications that promote stabilization of the terminal 5'-phosphate of the oligonucleotide or phosphatase-resistant 5'-phosphate analogs include, but are not limited to, 5'-methylphosphonate, 5'-methylenephosphonate, 5'-methylenephosphonate analogs, 5'-E-vinylphosphonate (5'-E-VP), 5'-phosphorothioate, and 5'-C-methyl analogs. Chemical modifications that promote stabilization of the terminal 5'-phosphate of the AON and phosphatase-resistant 5'-phosphate analogs are described in Khvorova and Watts, (2017) "The chemical evolution of oligonucleotide therapies of clinical utility" Nat Biotechnol., 35(3): 238-48, the contents of which are incorporated herein by reference.

[0272] In some embodiments described herein, the UNC13A AONs described herein can include chemically modified nucleosides, e.g., 2'O-methyl ribonucleosides, e.g., 2'O-methyl cytidine, 2'O-methyl guanosine, 2'O-methyl uridine, and / or 2'O-methyl adenosine. The UNC13A AONs described herein can include one or more chemically modified bases, including 5-methyl pyrimidines, e.g., 5-methyl cytosine, and / or 5-methyl purines, e.g., 5-methyl guanine. Chemically modified nucleosides can also include pseudouridine or 5'-methoxyuridine. The UNC13A AONs described herein can include any of the following chemically modified nucleosides: 5-methyl-2'-O-methyl cytidine, 5-methyl-2'-O-methyl thymidine, 5-methyl cytidine, 5-methyl uridine, and / or 5-methyl 2'-deoxycytidine.

[0273] The UNC13A AONs described herein may comprise a phosphate backbone, wherein one or more oligonucleoside linkages are phosphate linkages. The UNC13A AONs described herein may comprise a modified oligonucleotide backbone, wherein one or more nucleoside linkages of the sequence are selected from the group consisting of phosphorothioate, phosphorodithioate, phosphotriester, alkylphosphonate, 3-methoxypropylphosphonate, aminoalkylphosphotriester, alkylenephosphonate, phosphinate, phosphoramidate, thiophosphoramidate, thiophosphodiamidate, phosphorodiamidate (e.g., including phosphorodiamidate morpholino (PMO), 3' aminoribose, or 5' aminoribose) linkages, aminoalkylphosphoamidate, thiophosphoramidate, thioalkylphosphonate, thioalkylphosphotriester, phosphorothioate, selenophosphate, and boranophosphate. In some embodiments of the UNC13A AONs described herein, at least one (i.e., one or more) internucleoside linkage of the oligonucleotide is a phosphorothioate linkage. For example, in some embodiments of the UNC13A AON described herein, one, two, three, or more internucleoside bonds of the oligonucleotide are phosphorothioate bonds. In preferred embodiments of the UNC13A AON described herein, all internucleoside bonds of the oligonucleotide are phosphorothioate bonds. Thus, in some embodiments, all nucleotide bonds of the UNC13A AON of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292 are phosphorothioate bonds. In some embodiments, one or more nucleotide bonds of the UNC13A AON of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292 are phosphorothioate bonds.

[0274] In various embodiments, the nucleotide linkages of the UNC13A AONs described herein (e.g., any of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292) comprise a mixture of phosphodiester and phosphorothioate linkages.

[0275] In some embodiments, the nucleoside bond connecting the base at position 3 of a UNC13A AON described herein is a phosphodiester bond. For example, the base at position 3 can be linked to each adjacent base (e.g., the preceding base and the following base) via a phosphodiester bond. An example 25mer UNC13A AON having a phosphodiester bond connecting the base at position 3 can be represented as: XXoDoXXXXXXXXXXXXXXXXXXXXXX wherein "o" represents a phosphodiester bond and "D" represents the base at position 3. Any nucleobase in the AON may be a nucleobase analog.

[0276] In some embodiments, one of the internucleoside bonds connecting the base at position 3 of a UNC13A AON described herein is a phosphodiester bond. For example, the base at position 3 can be linked to the preceding base or the following base via a phosphodiester bond. An exemplary 25mer UNC13A AON having a phosphodiester bond connecting the base at position 3 to the preceding base can be represented as: XXoDXXXXXXXXXXXXXXXXXXXXXX wherein "o" represents a phosphodiester bond and "D" represents the base at position 3. Any nucleobase in the AON may be a nucleobase analog.

[0277] An example 25mer UNC13A AON with a phosphodiester bond connecting the base at position 3 to the following base can be represented as: XXDoXXXXXXXXXXXXXXXXXXXXXX wherein "o" represents a phosphodiester bond and "D" represents the base at position 3. Any nucleobase in the AON may be a nucleobase analog.

[0278] In various embodiments, in addition to one of the internucleoside bonds connecting the base at position 3 of the UNC13A AON being a phosphodiester bond as described herein, the UNC13A AON further comprises two spacers. The two spacers can be positioned within the UNC13A AON such that the UNC13A AON comprises a segment having up to 7 linked nucleosides. An example 25mer UNC13A AON having two spacers and a phosphodiester bond connecting the base at position 3 to the preceding base can be represented as: XxoDS1XXXXXXXXXS2XXXXXXXXXXX wherein "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, and "D" represents the base at position 3. Any nucleobase in the AON may be a nucleobase analog.

[0279] An example 25mer UNC13A AON with two spacers and a phosphodiester bond connecting the base at position 3 to the following base can be represented as: XXDoXXXXXXXS1XXXXXXXXXS2XXXX wherein "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, and "D" represents the base at position 3. Any nucleobase in the AON may be a nucleobase analog.

[0280] In some embodiments, the internucleoside bond connecting the base at position 4 of a UNC13A AON described herein is a phosphodiester bond. For example, the base at position 4 can be linked to each adjacent base (e.g., the preceding base and the following base) via a phosphodiester bond. An example 25mer UNC13A AON having a phosphodiester bond connecting the base at position 4 can be represented as: XXXoDoXXXXXXXXXXXXXXXXXXXXX wherein "o" represents a phosphodiester bond and "D" represents the base at position 4. Any nucleobase in the AON may be a nucleobase analog.

[0281] In some embodiments, one of the internucleoside linkages connecting the base at position 4 of a UNC13A AON described herein is a phosphodiester bond. For example, the base at position 4 can be linked to the preceding base or the following base via a phosphodiester bond. An exemplary 25mer UNC13A AON having a phosphodiester bond connecting the base at position 4 to the preceding base can be represented as: XXXoDXXXXXXXXXXXXXXXXXXXXX wherein "o" represents a phosphodiester bond and "D" represents the base at position 4. Any nucleobase in the AON may be a nucleobase analog.

[0282] An example 25mer UNC13A AON with a phosphodiester bond connecting the base at position 4 to the following base can be represented as: XXXDoXXXXXXXXXXXXXXXXXXXXX wherein "o" represents a phosphodiester bond and "D" represents the base at position 4. Any nucleobase in the AON may be a nucleobase analog.

[0283] In some embodiments, the internucleoside bond connecting the bases at positions 3 and 4 of a UNC13A AON described herein is a phosphodiester bond. For example, the base at position 3 can be linked to each adjacent base (e.g., the preceding base and the following base) via a phosphodiester bond, and the base at position 4 can be linked to each adjacent base (e.g., the preceding base and the following base) via a phosphodiester bond. An example 25mer UNC13A AON having a phosphodiester bond connecting the bases at positions 3 and 4 can be represented as: XXoDoEoXXXXXXXXXXXXXXXXXXXXX wherein "o" represents a phosphodiester bond, "D" represents the base at position 3, and "E" represents the base at position 4. In various embodiments, all other bases of the UNC13A AON are linked by phosphorothioate bonds. Any nucleobase in the AON can be a nucleobase analog.

[0284] In various embodiments, the UNC13A AON described herein includes one or more spacers, and the phosphodiester bond is positioned relative to the one or more spacers. In some embodiments, the Y bases immediately preceding the spacer are linked by a phosphodiester bond. In various embodiments, Y is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 bases. In specific embodiments, Y is 2 bases. For example, if the spacer is located at position 15, the bases at positions 13 and 14 of the UNC13A AON are each linked to their respective adjacent bases by a phosphodiester bond. As described herein, the spacer can be located at different positions within the UNC13A AON, and thus, the two bases immediately preceding the spacer can vary within the UNC13A AON depending on the location of the spacer.

[0285] In various embodiments, a UNC13A AON can include more than one spacer. In some embodiments, only one of the spacers has Y bases immediately preceding the spacer, linked by a phosphodiester bond. In such embodiments, the other spacers are linked to the preceding bases by phosphorothioate bonds. In various embodiments, the middle two spacers have Y bases immediately preceding the spacer, linked by a phosphodiester bond. In various embodiments, each spacer in a UNC13A AON has Y bases immediately preceding the spacer, linked by a phosphodiester bond. In various embodiments, all other bases of a UNC13A AON are linked by phosphorothioate bonds.

[0286] In some embodiments, the Y bases immediately preceding the spacer and the Z bases immediately following the spacer are linked by phosphodiester bonds. In various embodiments, Y is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 bases. In various embodiments, Z is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 bases. Y and Z can be independent of each other. In specific embodiments, Y is one base and Z is one base. For example, if the spacer is at position 15, the bases at positions 14 and 16 of the UNC13A AON are each linked to their respective adjacent bases by a phosphodiester bond. To provide an example, such a UNC13A AON (e.g., a 25mer) can be represented as: XXXXXXXXXXXXXoDoSoEoXXXXXXXXX wherein "S" represents a spacer, "o" represents a phosphodiester bond, "D" represents the base immediately before the spacer, and "E" represents the base immediately after the spacer. Any nucleobase in the AON can be a nucleobase analog.

[0287] As described herein, the spacer can be located at different positions within the UNC13A AON, and thus, the bases immediately preceding or following the spacer can vary within the UNC13A AON depending on where the spacer is located.

[0288] In various embodiments, a UNC13A AON can include more than one spacer. In some embodiments, only one of the spacers has Y bases immediately preceding the spacer and Z bases immediately following the spacer, these bases being connected by phosphodiester bonds. In such embodiments, the other spacers of the UNC13A AON are connected to the respective preceding and following bases by phosphorothioate bonds. To provide an example, such a UNC13A AON (e.g., a 25mer) can be represented as: XXXXoDoS1oEoXXXXXXXXXXXS2XXXXXX wherein "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, "D" represents the base immediately before the spacer, and "E" represents the base immediately after the spacer. Any nucleobase in the AON can be a nucleobase analog.

[0289] As another example, such a UNC13A AON (e.g., 25mer) can be represented as: XXXXXS1XXXXXXXXXXXoDoS2oDoXXXXX wherein "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, "D" represents the base immediately before the spacer, and "E" represents the base immediately after the spacer. Any nucleobase in the AON can be a nucleobase analog.

[0290] In some embodiments, one of the spacers is linked to the immediately preceding base via a phosphodiester bond. For example, a UNC13A AON includes a first spacer linked to the immediately preceding base via a phosphodiester bond, which can be represented as: XXXXXXoS1XXXXXXXXXXXS2XXXXXX wherein "S1" represents the first spacer, "S2" represents the second spacer, and "o" represents a phosphodiester bond. Any nucleobase in the AON may be a nucleobase analog.

[0291] As another example, the UNC13A AON includes a second spacer region connected to the immediately preceding base via a phosphodiester bond, which can be represented as: XXXXXXS1XXXXXXXXXXXoS2XXXXXX wherein "S1" represents the first spacer, "S2" represents the second spacer, and "o" represents a phosphodiester bond. Any nucleobase in the AON may be a nucleobase analog.

[0292] In various embodiments, the UNC13A AON can be an AON variant (e.g., a 23mer, a 21mer, or a 19mer) in which one spacer is linked to the immediately preceding base via a phosphodiester bond. For example, the UNC13A AON can be a 21mer having a first spacer linked to the immediately preceding base via a phosphodiester bond, which can be represented as: XXXXXXXoS1XXXXXS2XXXXXXX wherein "S1" represents the first spacer, "S2" represents the second spacer, and "o" represents a phosphodiester bond. Any nucleobase in the AON may be a nucleobase analog.

[0293] For example, a UNC13A AON can be a 21mer with a second spacer linked to the immediately preceding base by a phosphodiester bond, which can be represented as: XXXXXXXS1XXXXXoS2XXXXXXX wherein "S1" represents the first spacer, "S2" represents the second spacer, and "o" represents a phosphodiester bond. Any nucleobase in the AON may be a nucleobase analog.

[0294] In some embodiments, the UNC13A AON can be an AON variant (e.g., a 23mer, 21mer, or 19mer) in which a spacer is linked to the immediately preceding base via a phosphodiester bond, and the immediately preceding base is in turn linked to the preceding base via a phosphodiester bond. An example 21mer UNC13A AON can be represented as: XXXEoDoS1XXXXXXS2XXXXXXX wherein "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, "D" represents the base immediately preceding S1, and "E" represents the base immediately preceding "D." Any nucleobase in the AON may be a nucleobase analog.

[0295] As another example, the 21mer UNC13A AON can be represented as: XXXXXS1XXXXEoDoS2XXXXXXX wherein "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, "D" represents the base immediately preceding S2, and "E" represents the base immediately preceding "D." Any nucleobase in the AON may be a nucleobase analog.

[0296] In some embodiments, the UNC13A AON can be an AON variant (e.g., a 23mer, 21mer, or 19mer) in which the base immediately preceding the first spacer is linked to another base via a phosphodiester bond. The base immediately preceding the first spacer can be linked to the first spacer via a non-phosphodiester bond (e.g., a phosphorothioate bond). Alternatively, the second spacer is linked to the immediately preceding base via a phosphodiester bond. An example of a 21mer UNC13A AON can be represented as: XXXEoDS1XXXXXXoS2XXXXXXX Wherein "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, "D" represents the base immediately preceding S1, and "E" represents the base immediately preceding "D". Here, base "D" is connected to the first spacer S1 through a non-phosphodiester bond (e.g., a phosphorothioate bond). In addition, base "D" is connected to base "E" through a phosphodiester bond. The second spacer S2 is connected to the immediately preceding base through a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.

[0297] Another example of such a 21mer UNC13A AON can be represented as: XXXXXoS1XXXXEoDS2XXXXXXX Wherein "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, "D" represents the base immediately preceding S2, and "E" represents the base immediately preceding "D". Here, base "D" is connected to the second spacer S2 via a non-phosphodiester bond (e.g., a phosphorothioate bond). In addition, base "D" is connected to base "E" via a phosphodiester bond. The first spacer S1 is connected to the immediately preceding base via a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.

[0298] In some embodiments, one of the spacers is linked to the immediately following base via a phosphodiester bond. For example, a UNC13A AON includes a first spacer linked to the immediately following base via a phosphodiester bond, which can be represented as: XXXXXXS1oXXXXXXXXXXXS2XXXXXX wherein "S1" represents the first spacer, "S2" represents the second spacer, and "o" represents a phosphodiester bond. Any nucleobase in the AON may be a nucleobase analog.

[0299] As another example, the UNC13A AON includes a second spacer region connected to the immediately following base via a phosphodiester bond, which can be represented as: XXXXXXS1XXXXXXXXXXXS2oXXXXXX wherein "S1" represents the first spacer, "S2" represents the second spacer, and "o" represents a phosphodiester bond. Any nucleobase in the AON may be a nucleobase analog.

[0300] In various embodiments, the UNC13A AON can be an AON variant (e.g., a 23mer, a 21mer, or a 19mer) in which one spacer is linked to the immediately following base via a phosphodiester bond. For example, the UNC13A AON can be a 21mer having a first spacer linked to the immediately following base via a phosphodiester bond, which can be represented as: XXXXXXXS1oXXXXXS2XXXXXXX wherein "S1" represents the first spacer, "S2" represents the second spacer, and "o" represents a phosphodiester bond. Any nucleobase in the AON may be a nucleobase analog.

[0301] For example, a UNC13A AON can be a 21mer with a second spacer linked to the immediately following base via a phosphodiester bond, which can be represented as: XXXXXXXS1XXXXXS2oXXXXXXX wherein "S1" represents the first spacer, "S2" represents the second spacer, and "o" represents a phosphodiester bond. Any nucleobase in the AON may be a nucleobase analog.

[0302] In various embodiments, wherein the two spacers have Y bases immediately preceding the spacer and Z bases immediately following the spacer, these bases being connected by phosphodiester bonds. In various embodiments, each spacer in a UNC13A AON has Y bases immediately preceding the spacer and Z bases immediately following the spacer, these bases being connected by phosphodiester bonds. An example of such a UNC13A AON (e.g., a 25mer) can be represented as: XXXXoDoS1oEoXXXXXXXXXXoFoS2oHoXXXXX wherein "S1" represents the first spacer, "S2" represents the second spacer, "o" represents a phosphodiester bond, "D" represents the base immediately before the first spacer, "E" represents the base immediately after the first spacer, "F" represents the base immediately before the second spacer, and "H" represents the base immediately after the second spacer. In various embodiments, all other bases of the UNC13A AON are linked by phosphorothioate bonds. Any nucleobase in the AON can be a nucleobase analog.

[0303] In various embodiments, a UNC13A AON comprises two or more spacers and a series of bases between the spacers linked by phosphodiester bonds. In various embodiments, the series of bases comprises 2, 3, 4, 5, 6, or 7 bases linked by phosphodiester bonds. In specific embodiments, the series of bases comprises two bases linked by phosphodiester bonds. In specific embodiments, the series of bases comprises four bases linked by phosphodiester bonds. In various embodiments, all other bases of the UNC13A AON are linked by phosphorothioate bonds. Any nucleobase in the AON can be a nucleobase analog.

[0304] In various embodiments, the series of bases connected by phosphodiester bonds is located Y bases after the first spacer and Z bases before the second spacer. In various embodiments, Y is 1, 2, 3, 4, 5, 6, or 7 bases. In various embodiments, Z is 1, 2, 3, 4, 5, 6, or 7 bases. Y and Z can be independent of each other. Any nucleobase in the AON can be a nucleobase analog.

[0305] In a specific embodiment, Y is 5 bases and Z is 4 bases. To provide an example, such a UNC13AAON (e.g., a 25mer) can be represented as: XXXXXXXXS1XXXXoDoEoFoHoXXXS2XXXX Wherein "S1" represents the first spacer, "S2" represents the second spacer, and "o" represents a phosphodiester bond. Bases "D," "E," "F," and "H" represent a series of bases connected by a phosphodiester bond. In this example, the series of bases is located five bases after the first spacer (e.g., D is located five bases after the first spacer) and the series of bases is located four bases before the second spacer (e.g., H is located four bases before the second spacer). Any nucleobase in the AON can be a nucleobase analog.

[0306] In a specific embodiment, Y is 4 bases and Z is 3 bases. To provide an example, such a UNC13AAON (e.g., a 23mer) can be represented as: XXXXXXXS1XXXoDoEoXXS2XXXXXXX Wherein "S1" represents the first spacer, "S2" represents the second spacer, and "o" represents a phosphodiester bond. Bases "D" and "E" represent a series of bases connected by a phosphodiester bond. In this example, the series of bases is located four bases after the first spacer (e.g., D is located four bases after the first spacer) and the series of bases is located three bases before the second spacer (e.g., E is located three bases before the second spacer). In various embodiments, the positions of the two spacers are different from those shown above, and therefore, the series of bases connected by phosphodiester bonds are positioned differently. In various embodiments, all other bases of UNC13AAON are connected by phosphorothioate bonds. Any nucleobase in AON can be a nucleobase analog.

[0307] In some embodiments, the disclosed UNC13A AONs can have at least one modified nucleobase, such as 5-methylcytosine and / or at least one methylphosphonate nucleotide, for example, located at only one of the 5' or 3' termini or at both the 5' and 3' termini or positioned along the oligonucleotide sequence.

[0308] The UNC13A AON may include at least one modified sugar. For example, the sugar moiety of at least one nucleotide comprising the oligonucleotide is ribose, wherein the 2'-OH group may be substituted with any one of OR, R, R'OR, SH, SR, NH2, NR2, N3, CN, F, Cl, Br, and I (wherein R is an alkyl or aryl group and R' is an alkylene group). Examples of modified sugar moieties include 2'-Ome modified sugar moieties, bicyclic sugar moieties, 2'-O-(2-methoxyethyl) (2'MOE or MOE), 2'-O-(N-methylacetamide), 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabinoside, locked nucleic acids (LNA), constrained ethyl 2'-4'-bridged nucleic acids (cEt), S-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analogs (e.g., tcDNA).

[0309] In some embodiments, the UNC13A AON comprises 2'OMe (e.g., a UNC13A AON comprising one or more 2'OMe-modified sugars), 2'MOE or MOE (e.g., a UNC13AAON comprising one or more 2'MOE-modified sugars), PNA (e.g., a UNC13A AON comprising one or more N-(2-aminoethyl)-glycine units linked by amide or carbonylmethylene bonds as repeating units of an alternative sugar-phosphate backbone), LNA (e.g., a UNC13AAON comprising one or more locked ribose sugars and can be a mixture of 2'-deoxynucleotides or 2'OMe nucleotides), c-ET (e.g., a UNC13A AON comprising one or more cET sugars), cMOE (e.g., a UNC13A AON comprising one or more cMOE sugars), a morpholino oligomer (e.g., a UNC13AAON comprising a backbone containing one or more PMOs), a deoxy-2'-fluoro nucleoside (e.g., a UNC13A AON comprising one or more 2'-fluoro-β-D-arabinoside), or a morpholino oligomer (e.g., a UNC13AAON comprising one or more 2'-fluoro-β-D-arabinoside). In some embodiments, the UNC13A AON comprises one or more phosphorothioate, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate, thiophosphoramidate, thiophosphordiamidate, morpholino, PNA, or any combination of phosphorothioate, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate, thiophosphoramidate, thiophosphordiamidate, morpholino, and PNA linkages. In some embodiments, the UNC13A AON comprises one or more phosphorothioate, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate, thiophosphoramidate, thiophosphordiamidate, morpholino, and PNA linkages.

[0310] In some embodiments, the UNC13A AON having any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292 is a chirality-controlled oligonucleotide, such as described in any one of U.S. Patent No. 9,982,257, U.S. Patent No. 10,590,413, US10,724,035, US10,450,568, and PCT Publication No. WO2019200185, each of which is herein incorporated by reference in its entirety.

[0311] For example, a UNC13AAON having any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292 is a chirality-controlled oligonucleotide comprising a plurality of at least one type of oligonucleotide, wherein each type is defined by: 1) base sequence; 2) pattern of backbone bonds; 3) pattern of backbone chiral centers; and 4) backbone X-moieties (—XLRs). 1 ) pattern; wherein: at least one type of oligonucleotide comprises one or more phosphorothioate triester internucleotide linkages and one or more phosphodiester linkages; at least one type of oligonucleotide comprises at least two consecutive modified internucleotide linkages; and at least one oligonucleotide type of oligonucleotide comprises one or more modified internucleotide linkages independently having the following structure: Where: P* is an asymmetric phosphorus atom and is Rp or Sp; W is O, S or Se; X, Y and Z are each independently -O-, -S-, -N(-LR 1 )- or L; L is a covalent bond or an optionally substituted straight or branched C1-C 50 Alkylene, wherein one or more methylene units of L are optionally and independently replaced by optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, —Cy—, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—; 1 is halogen, R or optionally substituted C1-C 10an aliphatic group, wherein one or more methylene units are optionally and independently substituted with C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, —Cy—, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2— , —SC(O)—, —C(O)S—, —OC(O)— or —C(O)O—; R′ is each independently —R, —C(O)R, —C02R or —S02R, or: two R′ on the same nitrogen together with the atoms between them form an optionally substituted heterocyclic or heteroaromatic ring, or two R′ on the same carbon together with the atoms between them form an optionally substituted aryl, carbocyclic, heterocyclic or heteroaromatic ring; -Cy- is an optionally substituted divalent ring selected from phenyl, carbocyclic, aryl, heteroaryl or heterocyclic; R′ is each independently hydrogen or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclic, aryl, heteroaryl or heterocyclic; and Each independently represents a connection to a nucleoside. In some embodiments, the AUNC13A AON having any of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292 is a chirality-controlled oligonucleotide comprising certain chemical modifications (e.g., 2'F (2'-Fluoro, containing a fluorine molecule at the 2' ribose position (instead of the 2'-hydroxyl in RNA monomers)), 2'-OMe, phosphorothioate bonds, lipid binding, etc.) as described in U.S. Patent No. 10,450,568. Motor neurone disease

[0312] Motor neuron diseases are a group of diseases characterized by loss of function of motor neurons, which coordinate voluntary muscle movement through the brain. Motor neuron diseases can affect upper and / or lower motor neurons and can be of sporadic or familial origin. Motor neuron diseases include amyotrophic lateral sclerosis (ALS or Lou Gehrig's disease), progressive bulbar palsy, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, post-polio syndrome, and ALS with frontotemporal dementia.

[0313] Symptoms of motor neurone disease include muscle weakness or weakening, muscle pain, spasticity, slurred speech, difficulty swallowing, loss of muscle control, joint pain, stiffness in the limbs, difficulty breathing, drooling, and complete loss of muscle control, including basic functions such as breathing, swallowing, eating, speaking, and limb movement. These symptoms are sometimes accompanied by depression, memory loss, difficulty planning, speech problems, behavioral changes, difficulty assessing spatial relationships, and / or personality changes.

[0314] Motor neuron disease can be assessed and diagnosed using various tools and tests by a skilled clinician (e.g., neurologist). For example, blood and urine tests (e.g., tests detecting the presence of creatine kinase), magnetic resonance imaging (MRI), electromyography (EMG), nerve conduction studies (NCS), spinal tap, lumbar puncture, and / or muscle biopsy can be used to assess or diagnose the presence or development risk of motor neuron disease. Motor neuron disease can be diagnosed by physical examination and / or neurological examination to assess the change in movement and sensory skills, neurological function, hearing and speech, vision, coordination and balance, mental state, and mood or behavior. Amyotrophic lateral sclerosis

[0315] ALS is a progressive motor neuron disease that disrupts signaling to all voluntary muscles. ALS causes atrophy of upper and lower motor neurons. Symptoms of ALS include bulbar muscle weakness and atrophy, generalized and bilateral loss of muscle strength, spasticity, muscle cramps, muscle cramps, fasciculations, slurred speech, and difficulty breathing or loss of the ability to breathe. Some individuals with ALS also experience cognitive decline. At the molecular level, ALS is characterized by aggregates of proteins and RNA in the cytoplasm of motor neurons, including aggregates of the RNA-binding protein TDP43.

[0316] ALS most commonly develops in men over the age of 40, but it can also occur in women and children. People who smoke, are exposed to chemicals such as lead, or have served in the military are also at increased risk for ALS. Most cases of ALS are sporadic, while only about 10% are familial. Causes of ALS include sporadic or inherited gene mutations, high levels of glutamate, and protein misprocessing. Genetic mutations associated with ALS include mutations in SOD1, C9orf72, TARDBP, FUS, ANG, ATXN2, CHCHD10, CHMP2B, DCTN1, ErbB4, FIG4, HNRPA1, MATR3, NEFH, OPTN, PFN1, PRPH, SETX, SIGMAR1, SMN1, SPG11, SQSTM1, TBK1, TRPM7, TUBA4A, UBQLN2, VAPB, and VCP. Frontotemporal dementia

[0317] Frontotemporal dementia (FTD) is a form of dementia that affects the frontal and temporal lobes of the brain. FTD includes frontotemporal lobar degeneration (FTLD). Its average age of onset is earlier than Alzheimer's disease - 40 years old. Symptoms of FTD include extreme changes in behavior and personality, speech and language problems, and movement-related symptoms such as tremors, rigidity, muscle spasms, weakness, and difficulty swallowing. Subtypes of FTD include behavioral variant frontotemporal dementia (bvFTD), which is characterized by changes in personality and behavior, and primary progressive aphasia (PPA), which affects language skills, speaking, writing, and comprehension. FTD is associated with tau protein accumulation (Pick bodies) and changes in TDP43 function. About 30% of FTD cases are familial and there are no other known risk factors besides family history. Genetic mutations associated with FTD include mutations in the genes C9orf72, progranulin (GRN), microtubule-associated protein tau (MAPT), UBQLN2, VPC, CHMP2B, TARDBP, FUS, ITM2B, CHCHD10, SQSTM1, PSEN1, PSEN2, CTSF, CYP27A1, TBK1, and TBP. Amyotrophic lateral sclerosis with frontotemporal dementia

[0318] Amyotrophic lateral sclerosis with frontotemporal dementia (ALS with FTD) is a clinical syndrome in which FTD and ALS occur in the same individual. Interestingly, mutations in C9orf72 are the most common cause of familial forms of ALS and FTD. In addition, mutations in TBK1, VCP, SQSTM1, UBQLN2, and CHMP2B have also been associated with ALS with FTD. Symptoms of ALS with FTD include significant changes in personality, as well as muscle weakness, muscle atrophy, fasciculations, muscle cramps, dysarthria, dysphagia, and degeneration of the spinal cord, motor neurons, and the frontal and temporal lobes of the brain. At the molecular level, ALS with FTD is characterized by the accumulation of TDP-43 and / or FUS proteins. TBK1 mutations have been associated with ALS, FTD, and ALS with FTD. Limbic-predominant age-related TDP-43 encephalopathy (LATE)

[0319] Limbic-predominant age-associated TDP-43 encephalopathy (LATE) is characterized by the accumulation of misfolded TDP-43 protein in the brain, particularly in the limbic system. LATE is a neurological disorder that typically manifests in elderly patients (e.g., over 80 years old). LATE can be diagnosed as dementia, and symptoms of LATE often mimic those of Alzheimer's disease, including memory loss, confusion, and mood changes. Treatment

[0320] The present disclosure contemplates, in part, the treatment of a neurological disease, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), limbic system-dominant age-related TDP-43 encephalopathy (LATE), epilepsy, cerebral age-related TDP-43 associated sclerosis (CARTS), facial onset sensory motor neuronopathy, Guam Parkinson's disease syndrome, multisystem proteinopathy, CTE and any of synaptic diseases such as autism in a patient in need thereof, comprising administering a UNC13A AON. In some embodiments, provided herein are methods of treating a neurological disease in a patient in need thereof, comprising administering a disclosed UNC13A AON. In some embodiments of the present disclosure, an effective amount of the disclosed UNC13A oligonucleotides can be administered to a patient in need thereof to treat a neurological disease and / or to increase, restore or stabilize the expression of UNC13A mRNA that can be translated to produce a functional UNC13A protein, thereby increasing, restoring or stabilizing UNC13A activity and / or function.

[0321] In some embodiments, treating a neurological disease comprises ameliorating or alleviating at least one symptom associated with the neurological disease (e.g., alleviating muscle weakness in an ALS patient). Methods of treating a patient suffering from a neurological disease (e.g., ALS, FTD, or ALS with FTD) comprising administering a disclosed UNC13A AON are provided. In some embodiments, methods of slowing the progression of a neurological disease, such as motor neuron disease, are provided.

[0322] Provided herein are methods for treating, reducing the risk of developing, or delaying the onset of a neurological disease in a subject in need thereof, comprising administering a disclosed UNC13A AON. The methods include, for example, treating a subject at risk of developing a neurological disease; for example, administering to the subject an effective amount of a disclosed UNC13A AON. Neurological diseases that can be treated in this manner include motor neuron disease, ALS, FTD, ALS with FTD, progressive bulbar palsy, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, and post-polio syndrome.

[0323] Methods for preventing or treating neurological diseases (e.g., PD, ALS, FTD, and ALS with FTD) form part of the present disclosure. Such methods may comprise administering to a patient in need thereof or at risk thereof a pharmaceutical formulation comprising a UNC13A AON disclosed herein. For example, a method for preventing or treating a neurological disease is provided, comprising administering to a patient in need thereof a UNC13A AON disclosed herein.

[0324] In patients treated using the above methods, UNC13A mRNA expression can be increased, restored, or stabilized by at least about 5%, 10%, 20%, 30%, 40%, or even 50% after administration of a UNC13A oligonucleotide (e.g., after 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months or longer), and such expression can be translated into functional UNC13A protein, thereby increasing, restoring, or stabilizing UNC13A activity and / or function in target cells (e.g., motor neurons). In some embodiments, administration of such a UNC13A oligonucleotide can be, for example, at least once daily. The UNC13A oligonucleotide can be administered orally. In some embodiments, the UNC13A oligonucleotide is administered intrathecally, intrathalamus, or intracisternal. For example, in the embodiments described herein, the UNC13A oligonucleotide is administered intrathecally, intrathalamus, or intracisternal approximately every 3 months. Administration of a UNC13A oligonucleotide disclosed herein can delay or ameliorate clinical manifestations of a neurological disease in a patient, for example, for at least 6 months, 1 year, 18 months, or even 2 years or longer, compared to a patient not administered a UNC13A oligonucleotide (such as an oligonucleotide disclosed herein).

[0325] UNC13A oligonucleotides can be used alone or in combination with one another, wherein at least two UNC13A oligonucleotides are used together in a single composition or as part of a treatment regimen. UNC13A oligonucleotides can also be used in combination with other drugs or AONs to treat neurological diseases or disorders.

[0326] In various embodiments, a method for treating amyotrophic lateral sclerosis (ALS) in a subject in need thereof is disclosed, comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide is a nucleic acid sequence of SEQ ID NO: 1-1264, SEQ ID NO: 2529-3792, SEQ ID NO: 5066-5166, SEQ ID NO: 5168-5202, SEQ ID NO: 5209-5221, or SEQ ID NO: 5230. any one of NOs: 5235-5292 having at least 85% identity; wherein at least one (i.e., one or more) nucleoside bonds of the oligonucleotide are independently selected from the group consisting of phosphodiester, phosphorothioate, alkylphosphoester, phosphorodithioate, phosphotriester, alkylphosphonate, 3-methoxypropylphosphonate, methylphosphonate, aminoalkylphosphotriester, alkylenephosphonate, phosphinate, phosphoramidate, thiophosphoramidate, thiophosphodiamidate, phosphorodiamidate, aminoalkylphosphoamidate, thiophosphoramidate, thioalkylphosphonate , thioalkylphosphotriester bonds, phosphorothioate bonds, selenophosphate bonds and borophosphate bonds, and / or wherein at least one (i.e. one or more) nucleosides are substituted with a component selected from the group consisting of 2'-O-(2-methoxyethyl) nucleosides, 2'-O-methyl nucleosides, 2'-O-(N-methylacetamide) nucleosides, 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET) and peptide nucleic acids (PNA), optionally wherein the oligonucleotide further comprises a spacer.

[0327] In various embodiments, a method for treating frontotemporal dementia (FTD) in a subject in need thereof is disclosed, comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide is conjugated to SEQ ID NO: 1-1264, SEQ ID NO: 2529-3792, SEQ ID NO: 5066-5166, SEQ ID NO: 5168-5202, SEQ ID NO: 5209-5221, or SEQ ID NO: 5230. any one of NOs: 5235-5292 having at least 85% identity; wherein at least one (i.e., one or more) nucleoside bonds of the oligonucleotide are independently selected from the group consisting of phosphodiester, phosphorothioate, alkylphosphoester, phosphorodithioate, phosphotriester, alkylphosphonate, 3-methoxypropylphosphonate, methylphosphonate, aminoalkylphosphotriester, alkylenephosphonate, phosphinate, phosphoramidate, thiophosphoramidate, thiophosphodiamidate, phosphorodiamidate, aminoalkylphosphoamidate, thiophosphoramidate, thioalkylphosphonate , thioalkylphosphotriester bonds, phosphorothioate bonds, selenophosphate bonds and borophosphate bonds, and / or wherein at least one (i.e. one or more) nucleosides are substituted with a component selected from the group consisting of 2'-O-(2-methoxyethyl) nucleosides, 2'-O-methyl nucleosides, 2'-O-(N-methylacetamide) nucleosides, 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET) and peptide nucleic acids (PNA), optionally wherein the oligonucleotide further comprises a spacer.

[0328] In various embodiments, a method for treating amyotrophic lateral sclerosis (ALS) with frontotemporal dementia (FTD) in a subject in need thereof is disclosed, the method comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide is a nucleic acid sequence of SEQ ID NO: 1-1264, SEQ ID NO: 2529-3792, SEQ ID NO: 5066-5166, SEQ ID NO: 5168-5202, SEQ ID NO: 5209-5221, or SEQ ID NO: 5230. any one of NOs: 5235-5292 having at least 85% identity; wherein at least one (i.e., one or more) nucleoside bonds of the oligonucleotide are independently selected from the group consisting of phosphodiester, phosphorothioate, alkylphosphoester, phosphorodithioate, phosphotriester, alkylphosphonate, 3-methoxypropylphosphonate, methylphosphonate, aminoalkylphosphotriester, alkylenephosphonate, phosphinate, phosphoramidate, thiophosphoramidate, thiophosphodiamidate, phosphorodiamidate, aminoalkylphosphoamidate, thiophosphoramidate, thioalkylphosphonate , thioalkylphosphotriester bonds, phosphorothioate bonds, selenophosphate bonds and borophosphate bonds, and / or wherein at least one (i.e. one or more) nucleosides are substituted with a component selected from the group consisting of 2'-O-(2-methoxyethyl) nucleosides, 2'-O-methyl nucleosides, 2'-O-(N-methylacetamide) nucleosides, 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabinonucleosides, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET) and peptide nucleic acids (PNA), optionally wherein the oligonucleotide further comprises a spacer. Treatment and evaluation

[0329] As used herein, a patient refers to any animal at risk for, suffering from, or diagnosed with a neurological disease, including but not limited to mammals, primates, and humans. In certain embodiments, a patient may be a non-human mammal, such as a cat, dog, or horse. A patient may be an individual diagnosed as being at high risk for a neurological disease, a person who has been diagnosed with a neurological disease, a person who has previously suffered from a neurological disease, or an individual being evaluated for symptoms or indications of a neurological disease, such as any signs or symptoms associated with a neurological disease, such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), traumatic brain injury, spinal cord injury, corticobasal degeneration (CBD), neurodegeneration, or other neurological disease. Injury (e.g., brachial plexus injury), neuropathies (e.g., chemotherapy-induced neuropathy), TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry syndrome, dementia with Lewy bodies associated with Alzheimer's disease, Parkinson's disease with or without dementia, and limbic-predominant age-related TDP-43 encephalopathy (LATE)), epilepsy, cerebral age-related TDP-43 with sclerosis (CARTS), facial-onset sensorimotor neuronopathy, Guam Parkinsonism-Dementia Syndrome, multisystem proteinopathies, CTE, and synaptic disorders such as autism.

[0330] As used herein, "a patient in need thereof" refers to a patient who has any symptoms or manifestations of a neurological disease, a patient who may have any symptoms or manifestations of a neurological disease, or any patient who may benefit from the methods of the present disclosure for treating a neurological disease. A patient in need thereof may include a patient diagnosed as being at risk for developing a neurological disease, a patient who has had a neurological disease in the past, or a patient who has previously received treatment for a neurological disease.

[0331] As used herein, an "effective amount" refers to an amount of an agent that, when administered to a patient, is sufficient to at least partially treat a condition. The therapeutically effective amount will vary depending on the severity of the condition, the route of administration of the agent, and the age, weight, etc. of the patient being treated. Thus, an effective amount of a disclosed UNC13A oligonucleotide is the amount of UNC13A oligonucleotide required to treat a neurological disease in a patient, such that administration of the agent prevents the onset of a neurological disease in the subject, prevents the progression of a neurological disease (e.g., prevents the onset or increase in severity of neurological symptoms (e.g., muscle weakness, spasms, or fasciculations)), or alleviates or completely ameliorates all associated symptoms of a neurological disease, i.e., results in disease regression.

[0332] The efficacy of treatment can be assessed by evaluating gross symptoms associated with the neurological disease, histological analysis of tissues, biochemical assays, imaging methods (e.g., magnetic resonance imaging), or other known methods. For example, the efficacy of treatment can be assessed by analyzing gross symptoms of the disease (e.g., changes in muscle strength and control or other aspects of gross pathology associated with the neurological disease after administration of a disclosed UNC13A oligonucleotide to a patient with the neurological disease).

[0333] The efficacy of treatment can also be assessed at the tissue or cellular level, for example, by obtaining a tissue biopsy (e.g., brain, spinal cord, muscle, motor neuron tissue biopsy, or olfactory neuron cell biopsy) and assessing gross tissue or cell morphology or staining properties. Biochemical assays that detect protein or RNA expression can also be used to assess the efficacy of treatment. For example, the level of a protein or gene product indicative of a neurological disease can be assessed in dissociated cells or non-dissociated tissue by immunocytochemistry, immunohistochemistry, Western blotting, or Northern blotting, or methods for assessing RNA levels, such as quantitative or semi-quantitative polymerase chain reaction (e.g., digital PCR (dPCR, dePCR), qPCR, etc.). Spinal fluid, cerebrospinal fluid, extracellular vesicles (e.g., exosome-like cerebrospinal fluid extracellular vesicles ("CSF exosomes")) can also be assessed (e.g., Welton et al., (2017) "Cerebrospinal fluid extracellular vesicle enrichment for protein biomarker discovery in neurological disease; multiple sclerosis" J Extracell Vesicles., 6(1): 1-10; and Street et al., (2012) "Identification and proteomic profiling of exosomes in human cerebrospinal fluid" J Extracell Vesicles ... Transl. Med., 10:5), useful biomarkers found in urine, feces, lymph, blood, plasma or serum (e.g., neurofilament light chain (NEFL), neurofilament heavy chain (NEFH), TDP-43 or p75 extracellular domain (p75 ECD)) to assess disease status and therapeutic efficacy. The presence or expression level of useful biomarkers found in plasma, neuronal extracellular vesicles / exosomes can also be assessed. Other measures of efficacy may include strength duration constant (SDTC), short interval cortical inhibition (SICI), dynamometer, limb isometric strength precision test (ATLIS), compound muscle action potential (CMAP) and ALSFRS-R. In certain embodiments, the urinary neurotrophin receptor p75 extracellular domain (p75 ECD ) is a disease progression and prognostic biomarker in amyotrophic lateral sclerosis (ALS). Phosphorylated neurofilament heavy chain (pNFH) in cerebrospinal fluid (CSF) predicts disease status and survival in patients with C9ORF72-related amyotrophic lateral sclerosis (c9ALS). Using CSF pNFH as a prognostic biomarker in clinical trials will increase the likelihood of successful development of c9ALS treatments.

[0334] When evaluating the efficacy of a treatment, appropriate controls can be selected to ensure a valid evaluation. For example, symptoms assessed in a patient with a neurological disease after administration of a disclosed UNC13A oligonucleotide can be compared to symptoms in the same patient before treatment or at an earlier stage during treatment, or in another patient who has not been diagnosed with a neurological disease. Alternatively, the results of a biochemical or histological analysis of tissue after administration of a disclosed UNC13A oligonucleotide can be compared to the results of a biochemical or histological analysis of tissue from the same patient, or from an individual not diagnosed with a neurological disease, or from the same patient before administration of a UNC13A oligonucleotide. Additionally, blood, plasma, serum, cells, urine, lymph, spinal fluid, cerebrospinal fluid, or stool samples after administration of a UNC13A oligonucleotide can be compared to comparable samples from an individual not diagnosed with a neurological disease, or from the same patient before administration of a UNC13A oligonucleotide. In some embodiments, extracellular vesicles (e.g., CSF exosomes) after administration of a UNC13A oligonucleotide can be compared to extracellular vesicles from an individual not diagnosed with a neurological disease, or from the same patient before administration of a UNC13A oligonucleotide.

[0335] Validation of UNC13A oligonucleotides can be determined by directly or indirectly assessing UNC13A expression levels or activity. For example, biochemical assays that measure UNC13A protein or RNA expression can be used to assess the overall effect on UNC13A transcripts (e.g., UNC13A pre-mRNA) comprising a sequence that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208. For example, UNC13A protein levels in cells or tissues can be measured by Western blotting to assess total UNC13A levels. UNC13A mRNA levels can also be measured by Northern blot or quantitative polymerase chain reaction to determine the overall effect on UNC13A transcripts (e.g., UNC13A pre-mRNA) comprising a sequence that is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to any one of SEQ ID NOs: 5057-5065 or 5206-5208. UNC13A protein levels or other protein levels indicative of UNC13A signaling activity can also be assessed in isolated cells, unisolated tissues, extracellular vesicles (e.g., CSF exosomes), blood, serum, or feces by immunocytochemistry or immunohistochemistry.

[0336] The biomarkers can also be determined by measuring parameters such as autophagy, endocytosis, protein aggregation, and useful biomarkers found in plasma, spinal fluid, cerebrospinal fluid, extracellular vesicles (e.g., CSF exosomes), blood, urine, lymph, fecal matter, or tissues (e.g., neurofilament light chain (NEFL), neurofilament heavy chain (NEFH), TDP-43, or p75 ECD) to indirectly assess modulation of the expression level of a UNC13A transcript (e.g., a UNC13A pre-mRNA) comprising a sequence at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208) to assess modulation of expression of a UNC13A transcript (e.g., a UNC13A pre-mRNA) comprising a sequence at least 90% (90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208. Modulation of the expression level of a UNC13A transcript (e.g., UNC13A pre-mRNA) comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208 can also be assessed indirectly by measuring parameters such as autophagy, endocytosis, protein aggregation, and the presence or expression level of physiological biomarkers such as compound muscle action potential (CMAP). Additional measurements may include strength duration constant (SDTC), short interval cortical inhibition (SICI), dynamometer, limb isometric strength precision test (ATLIS), compound muscle action potential, and ALSFRS-R. In certain embodiments, the urinary neurotrophic factor receptor p75 extracellular domain (p75 ECD ) is a disease progression and prognostic biomarker in amyotrophic lateral sclerosis (ALS). Phosphorylated neurofilament heavy chain (pNFH) in cerebrospinal fluid (CSF) can predict disease status and survival in patients with c9ALS. Using CSF pNFH as a prognostic biomarker in clinical trials will increase the likelihood of successful development of c9ALS treatments.

[0337] The present disclosure also provides methods for restoring expression of full-length UNC13A transcripts in cells of patients with neurological diseases. Full-length UNC13A transcripts can be restored in any cell in which UNC13A expression or activity occurs, including cells of the nervous system (including the central nervous system (e.g., spinal cord or brain), peripheral nervous system, motor neurons, glial cells, astrocytes, oligodendrocytes, microglia, brain, brainstem, frontal lobe, temporal lobe, spinal cord), musculoskeletal system, spinal fluid, and cerebrospinal fluid. Cells of the musculoskeletal system include skeletal muscle cells (e.g., myocytes). Motor neurons include upper motor neurons and lower motor neurons. Pharmaceutical compositions and routes of administration

[0338] The present disclosure also provides methods for treating neurological diseases by administering pharmaceutical compositions comprising the disclosed UNC13A oligonucleotides. In another aspect, the present disclosure provides pharmaceutical compositions for treating neurological diseases. The pharmaceutical compositions may comprise the disclosed UNC13A oligonucleotides and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutical composition" refers to, for example, a mixture containing a specific amount of a therapeutic compound (e.g., a therapeutically effective amount of a therapeutic compound) in a pharmaceutically acceptable carrier, which is administered to a mammal (e.g., a human) to treat a neurological disease. In some embodiments, pharmaceutical compositions comprising the disclosed UNC13A oligonucleotides and a pharmaceutically acceptable carrier are described herein. In another aspect, the present disclosure provides the use of the disclosed UNC13A oligonucleotides in the preparation of a medicament for treating a neurological disease. As used herein, "medicament" has substantially the same meaning as the term "pharmaceutical composition."

[0339] As used herein, "pharmaceutically acceptable carrier" means buffers, carriers and excipients that are suitable for contact with human and animal tissues without excessive toxicity, irritation, allergic reaction or other problems or complications, and have a reasonable benefit / risk ratio. The carrier should be "acceptable", that is, compatible with the other ingredients in the formula and harmless to the recipient. Pharmaceutically acceptable carriers include buffers, solvents, dispersion media, coatings, isotonic agents and absorption delaying agents that are compatible with drug administration. The use of such media and agents for pharmaceutical active substances is known in the art. In one embodiment, the pharmaceutical composition is administered orally and includes an enteric coating suitable for regulating the absorption site of the encapsulated substance in the digestive system or intestine. For example, the enteric coating may include ethyl acrylate-methacrylic acid copolymer.

[0340] In one embodiment, the disclosed UNC13A oligonucleotides and any pharmaceutical compositions thereof can be administered by one or more routes, including topical, intrathecal, intrathalamic, intracisternal, intraventricular, parenteral, oral, rectal, buccal, sublingual, vaginal, pulmonary, intratracheal, intranasal, transdermal, or intraduodenal. The term parenteral as used herein includes subcutaneous injection, intrapancreatic administration, intravenous, intracisternal, intraventricular, intrathecal, intrathalamic, intramuscular, intraperitoneal, intrasternal injection, or infusion techniques. For example, the disclosed UNC13A oligonucleotides can be administered subcutaneously to a subject. In another example, the disclosed UNC13A oligonucleotides can be administered orally to a subject. In another example, the disclosed UNC13A oligonucleotides can be administered directly to the nervous system, or specific regions or cells of the nervous system (e.g., brain, brainstem, lower motor neurons, spinal cord, upper motor neurons) by parenteral administration, for example, the disclosed UNC13A oligonucleotides can be administered intrathecally, intrathalamically, intracisternal, or intraventricularly.

[0341] In various embodiments, UNC13A oligonucleotides (e.g., UNC13A AONs) can be exposed to a calcium-containing buffer prior to administration. Such a calcium-containing buffer can mitigate the toxic side effects of UNC13A oligonucleotides. Further details of exemplary antisense oligonucleotide exposure to a calcium-containing buffer are described in Moazami et al., Quantifying and Mitigating Motor Phenotypes Induced by Antisense Oligonucleotides in the Central Nervous System, bioRxiv2021.02.14.431096, which is incorporated herein by reference in its entirety.

[0342] In some embodiments, UNC13A oligonucleotides (e.g., UNC13A AONs) can be encapsulated in a nanoparticle coating. Nanoparticle encapsulation is believed to prevent AON degradation and enhance cellular uptake. For example, in some embodiments, UNC13A oligonucleotides are encapsulated in a coating of a cationic polymer, such as a synthetic polymer (e.g., poly-L-lysine, polyamidoamine, poly(β-amino ester), and polyethyleneimine) or a naturally occurring polymer (e.g., chitosan and protamine). In some embodiments, UNC13A oligonucleotides are encapsulated in a lipid or lipid-like material, such as a cationic lipid, a cationic lipid-like material, or an ionizable lipid that is positively charged only at acidic pH. Examples of lipid nanoparticle nucleotide therapeutics include Exicure's XCUR-FXN, a lipid nanoparticle spherical nucleic acid (SNA)-based therapeutic candidate. For example, in some embodiments, UNC13A oligonucleotides are encapsulated in a lipid nanoparticle that includes a hydrophobic moiety, such as cholesterol and / or polyethylene glycol (PEG) lipids.

[0343] In various embodiments, pharmaceutical compositions comprising the disclosed UNC13A oligonucleotides may further comprise a bolaamphiphilic compound. Example bolaamphiphilic compounds are described in WO2014039493A1, WO2014039500A1, WO2014039502A1, WO2014039503A1, and WO2014039504A1, each of which is incorporated herein by reference in its entirety. In specific embodiments, the bolaamphiphilic compound is a compound according to Formula I: HG 2 L 1 HG 1 , or a pharmaceutically acceptable salt, solvate, hydrate, prodrug, stereoisomer, tautomer, isotopic variant or N-oxide thereof, or a combination thereof; wherein: HG 1 and HG 2 are each independently a hydrophilic head group; and L 1 is an alkylene, alkenyl, heteroalkylene or heteroalkenyl linker; and is unsubstituted or substituted by C1-C20 alkyl, hydroxy or oxo.

[0344] In one embodiment, the biphasic amphiphilic compound is a compound according to Formula II, III, IV, V or VI relative to the biphasic amphiphilic compound of Formula I:

[0345] or a pharmaceutically acceptable salt, solvate, hydrate, prodrug, stereoisomer, tautomer, isotopic variant or N-oxide thereof, or a combination thereof; in: HG 1 and HG 2 Each is independently a hydrophilic head group; Z 1 and Z 2 Each is independently -C(R 3 )2-、-N(R 3 )-or-O-; R la 、R lb 、R 3 and R 4 Each independently is H or C1-C8 alkyl; R 2a and R 2b Each independently represents H, C1-C8 alkyl, OH, alkoxy, or O-HG 1 or O-HG 2 ; n8, n9, n11 and n12 are each independently an integer from 1 to 20; n10 is an integer from 2 to 20; and Each dashed bond is independently a single bond or a double bond.

[0346] In one embodiment, relative to the biphasic amphiphilic compound of Formula I, II, III, IV, V or VI, HG 1 and HG 2 Each independently selected from:

[0347] Where: X is -NR 5a R 5b or -N + R 5a R 5b R 5c ; R 5a and R 5b Each independently represents H or substituted or unsubstituted C1-C 20 Alkyl, or R 5a and R 5b can be linked together to form a substituted or unsubstituted heteroaryl group or a substituted or unsubstituted heterocyclic group containing N; R 5c are each independently substituted or unsubstituted C1-C 20 Alkyl; R 8 are each independently H, substituted or unsubstituted C1-C 20alkyl, alkoxy or carboxyl; m1 is 0 or 1; n13, n14 and n15 are each independently an integer of 1-20.

[0348] In various embodiments, the pharmaceutical compositions disclosed herein comprise complexes between bolaamphiphiles and pharmacologically or biologically active compounds (e.g., UNC13A oligonucleotides disclosed herein). In various embodiments, the pharmaceutical compositions disclosed herein comprise bolaamphiphilic vesicle complexes comprising one or more bolaamphiphilic compounds, and the biologically active compound is an oligonucleotide (e.g., a UNC13A oligonucleotide disclosed herein).

[0349] Pharmaceutical compositions containing the disclosed UNC13A oligonucleotides (such as those disclosed) can be presented in dosage unit form and can be prepared by any suitable method. The pharmaceutical composition should be formulated to be compatible with its intended route of administration. Useful formulations can be prepared by methods well known in the pharmaceutical art. For example, see Remington's Pharmaceutical Sciences, 18th edition (Mack Publishing Company, 1990).

[0350] In some embodiments, the pharmaceutical preparation is sterile. For example, sterility can be achieved by filtration through a sterile filtration membrane. In the case of a lyophilized composition, filtration sterilization can be performed before or after lyophilization and reconstitution. Parenteral administration

[0351] The pharmaceutical compositions of the present disclosure can be formulated for parenteral administration, for example, for injection via intravenous, intracisternal, intraventricular, intramuscular, subcutaneous, intrathecal, intrathalamic, intralesional, or intraperitoneal routes. The preparation of aqueous compositions (e.g., aqueous pharmaceutical compositions containing the disclosed UNC13A oligonucleotides) will be understood by those skilled in the art based on the present disclosure. Generally, such compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for addition of liquids prior to injection to prepare solutions or suspensions can also be prepared; and the formulations can also be emulsified.

[0352] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including physiological saline, artificial cerebrospinal fluid, sesame oil, peanut oil, or aqueous propylene glycol solutions; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and fluid to the extent that easy syringability is achieved. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.

[0353] Solutions of the active compound as a free base or a pharmacologically acceptable salt can be prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, mixtures thereof, and oils. In addition, sterile fixed oils can be used as solvents or suspending media. For this purpose, any bland fixed oil can be used, including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can be used to prepare injectables. Sterile injectable preparations can also be sterile injectable solutions, suspensions, or emulsions in a non-toxic parenterally acceptable diluent or solvent, such as a solution in 1,3-butanediol. Acceptable vehicles and solvents that can be used include water, Ringer's solution, USP, and isotonic sodium chloride solution. In one embodiment, the disclosed UNC13A antisense oligonucleotides can be suspended in a suspension comprising 1% (w / v) sodium carboxymethylcellulose and 0.1% (v / v) TWEEN TM Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

[0354] Injectable formulations, such as sterile injectable aqueous or oily suspensions, can be formulated using suitable dispersants or wetting agents and suspending agents according to known techniques. Dispersions are typically prepared by incorporating the various sterilized active ingredients into a sterile carrier containing a basic dispersion medium and the desired other ingredients from those listed above. Sterile injectable solutions of the present disclosure can be prepared by mixing the disclosed UNC13A antisense oligonucleotides with the desired amount of an appropriate solvent and the various other ingredients listed above (as needed), followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, preferred methods of preparation are vacuum drying and freeze drying techniques, which produce a powder of the active ingredient plus any other desired ingredients from a previously sterile-filtered solution thereof. For example, the injectable formulation can be sterilized by filtration through a bacteria-retaining filter.

[0355] It is also contemplated to prepare higher concentrations or highly concentrated solutions for intramuscular injection. In this regard, DMSO is preferably used as a solvent because it will result in extremely rapid penetration, thereby delivering high concentrations of the disclosed oligonucleotide to a small area.

[0356] Suitable preservatives for such solutions include benzalkonium chloride, benzethonium chloride, chlorobutanol, thimerosal, and the like. Suitable buffers include boric acid, sodium bicarbonate and potassium carbonate, sodium and potassium borate, sodium carbonate and potassium carbonate, sodium acetate, sodium hydrogen phosphate, and the like, in amounts sufficient to maintain the pH between about pH 6 and pH 8, for example, between about pH 7 and pH 7.5. Suitable tonicity agents include dextran 40, dextran 70, dextrose, glycerol, potassium chloride, propylene glycol, sodium chloride, and the like, such that the sodium chloride equivalent of the solution is within the range of 0.9 ± 0.2%. Suitable antioxidants and stabilizers include sodium bisulfite, sodium metabisulfite, sodium thiosulfite, thiourea, and the like. Suitable wetting agents and clarifiers include polysorbate 80, polysorbate 20, poloxamer 282, and tyloxapol. Suitable viscosity increasing agents include dextran 40, dextran 70, gelatin, glycerin, hydroxyethylcellulose, hydroxymethylpropylcellulose, lanolin, methylcellulose, petrolatum, polyethylene glycol, polyvinyl alcohol, polyvinyl pyrrolidone, carboxymethylcellulose, and the like. Oral administration

[0357] In some embodiments, contemplated herein are compositions suitable for oral delivery of the disclosed UNC13A oligonucleotides, such as tablets comprising an enteric coating (eg, an enteric coating), such that the composition can deliver the UNC13A oligonucleotide to, for example, the gastrointestinal tract of a patient.

[0358] For example, provided is a tablet for oral administration comprising (e.g., at least partially formed of) particles comprising a disclosed UNC13A oligonucleotide, e.g., a UNC13A oligonucleotide represented by any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292, that targets a UNC13A transcript comprising a sequence at least 90% (90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208, and a pharmaceutically acceptable excipient. Such tablets may be covered with an enteric coating. The contemplated tablets may include pharmaceutically acceptable excipients such as fillers, binders, disintegrants and / or lubricants, as well as colorants, release agents, coating agents, sweeteners, flavorings such as wintergreen, orange, xylitol, sorbitol, fructose, and maltodextrin, as well as aromas, preservatives, and / or antioxidants.

[0359] In some embodiments, a contemplated pharmaceutical formulation comprises an intragranular phase comprising a disclosed UNC13A oligonucleotide, such as represented by any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292, that targets a UNC13A transcript comprising a sequence having at least 90% (90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208, and a pharmaceutically acceptable salt. In some embodiments, a contemplated pharmaceutical formulation comprises an intra-granular phase comprising a disclosed UNC13A oligonucleotide, such as represented by any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292, that targets a UNC13A transcript comprising a sequence at least 90% (90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208, and a pharmaceutically acceptable filler. For example, the disclosed UNC13A oligonucleotides and fillers can be blended, optionally with other excipients, and formed into granules. In some embodiments, the internal phase of the granules can be formed using wet granulation, for example, by adding a liquid (e.g., water) to the mixed UNC13A oligonucleotides and fillers, and then drying, grinding, and / or sieving the composition to produce granules. One skilled in the art will appreciate that other methods can be used to obtain the internal phase of the granules.

[0360] In some embodiments, contemplated formulations include an extragranular phase, which may include one or more pharmaceutically acceptable excipients, and which may be mixed with the intragranular phase to form the disclosed formulations.

[0361] The disclosed formulations may include an intragranular phase containing a filler. Exemplary fillers include, but are not limited to, cellulose, gelatin, calcium phosphate, lactose, sucrose, glucose, mannitol, sorbitol, microcrystalline cellulose, pectin, polyacrylates, dextrose, cellulose acetate, hydroxypropyl methylcellulose, partially pregelatinized starch, calcium carbonate, and other fillers including combinations thereof.

[0362] In some embodiments, the disclosed formulations may include an intragranular phase and / or an extragranular phase comprising a binder, which generally serves to hold the ingredients of the pharmaceutical formulation together. Exemplary binders of the present disclosure may include, but are not limited to, the following: starch, sugar, cellulose or modified cellulose such as hydroxypropyl cellulose, lactose, pregelatinized corn starch, polyvinyl pyrrolidone, hydroxypropyl cellulose, hydroxypropyl methylcellulose, low-substituted hydroxypropyl cellulose, sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, sugar alcohols, and other binders including combinations thereof.

[0363] The contemplated formulations, e.g., formulations comprising an intragranular phase and / or an extragranular phase, may include a disintegrant such as, but not limited to, starch, cellulose, cross-linked polyvinyl pyrrolidone, sodium starch glycolate, sodium carboxymethylcellulose, alginate, corn starch, cross-linked sodium carboxymethylcellulose, cross-linked carboxymethylcellulose, low-substituted hydroxypropyl cellulose, gum arabic, and other formulations including combinations thereof. For example, the intragranular phase and / or the extragranular phase may include a disintegrant.

[0364] In some embodiments, contemplated formulations include an intragranular phase comprising a disclosed UNC13A oligonucleotide and an excipient selected from the group consisting of mannitol, microcrystalline cellulose, hydroxypropyl methylcellulose, and sodium starch glycolate, or a combination thereof, and an extragranular phase comprising one or more of microcrystalline cellulose, sodium starch glycolate, and magnesium stearate, or a mixture thereof.

[0365] In some embodiments, the contemplated formulations may include a lubricant, for example, the extragranular phase may contain a lubricant. Lubricants include, but are not limited to, talc, silicon dioxide, fats, stearin, magnesium stearate, calcium phosphate, silicon dioxide, calcium silicate, calcium phosphate, colloidal silicon dioxide, metallic stearates, hydrogenated vegetable oils, corn starch, sodium benzoate, polyethylene glycol, sodium acetate, calcium stearate, sodium lauryl sulfate, sodium chloride, magnesium lauryl sulfate, talc, and stearic acid.

[0366] In some embodiments, the pharmaceutical preparation comprises an enteric coating. Typically, the enteric coating forms a barrier for oral medications that controls the location of drug absorption along the digestive tract. The enteric coating may include a polymer that disintegrates at different rates depending on pH. The enteric coating may include, for example, cellulose acetate phthalate, methyl acrylate-methacrylic acid copolymer, cellulose acetate succinate, hydroxypropyl methylcellulose phthalate, methyl methacrylate-methacrylic acid copolymer, ethyl acrylate-methacrylic acid copolymer, methacrylic acid copolymer type C, polyvinyl acetate-phthalate, cellulose acetate phthalate.

[0367] Exemplary enteric coatings include AMB, In some embodiments, the enteric coating may comprise from about 5% to about 10%, from about 5% to about 20%, from 8% to about 15%, from about 8% to about 20%, from about 10% to about 20%, or from about 12% to about 20%, or about 18% of the intended tablet weight. For example, the enteric coating may comprise ethyl acrylate-methacrylic acid copolymer.

[0368] For example, in contemplated embodiments, a tablet is provided that comprises, or consists essentially of, about 0.5% to about 70%, such as about 0.5% to about 10%, or about 1% to about 20%, by weight of a disclosed UNC13A oligonucleotide or a pharmaceutically acceptable salt thereof. Such a tablet may comprise, for example, about 0.5% to about 60% by weight of mannitol, such as about 30% to about 50% by weight of mannitol, such as about 40% by weight of mannitol; and / or about 20% to about 40% by weight of microcrystalline cellulose, or about 10% to about 30% by weight of microcrystalline cellulose. For example, the disclosed tablets may comprise an intragranular phase comprising, by weight, about 30% to about 60%, e.g., about 45% to about 65%, or alternatively, about 5% to about 10% by weight of a disclosed UNC13A oligonucleotide; about 30% to about 50%, or alternatively, about 5% to about 15%, by weight of mannitol; about 5% to about 15% of microcrystalline cellulose; about 0% to about 4%, or about 1% to about 7%, of hydroxypropyl methylcellulose; and about 0% to about 4%, e.g., about 2% to about 4%, by weight of sodium starch glycolate.

[0369] In another contemplated embodiment, a pharmaceutical tablet formulation for oral administration of a disclosed UNC13A oligonucleotide comprises an intragranular phase comprising a disclosed UNC13A AON or a pharmaceutically acceptable salt thereof (such as a sodium salt) and a pharmaceutically acceptable filler, and may further comprise an extragranular phase, which may comprise a pharmaceutically acceptable excipient such as a disintegrant. The extragranular phase may comprise a component selected from microcrystalline cellulose, magnesium stearate, and mixtures thereof. The pharmaceutical composition may further comprise an enteric coating comprising about 12% to 20% of the tablet weight. For example, a pharmaceutically acceptable tablet for oral use may comprise about 0.5% to 10% by weight of a disclosed UNC13A AON (e.g., a disclosed UNC13A AON or a pharmaceutically acceptable salt thereof), about 30% to 50% by weight of mannitol, about 10% to 30% by weight of microcrystalline cellulose, and an enteric coating comprising an ethyl acrylate-methacrylic acid copolymer.

[0370] In another example, a pharmaceutically acceptable tablet for oral use may comprise an intragranular phase comprising about 5 to about 10% by weight of a disclosed UNC13A AON (e.g., a disclosed UNC13A AON or a pharmaceutically acceptable salt thereof), about 40% by weight mannitol, about 8% by weight microcrystalline cellulose, about 5% by weight hydroxypropyl methylcellulose, and about 2% by weight sodium starch glycolate; an extragranular phase comprising about 17% by weight microcrystalline cellulose, about 2% by weight sodium starch glycolate, about 0.4% by weight magnesium stearate; and an enteric coating on the tablet comprising an ethyl acrylate-methacrylic acid copolymer.

[0371] In some embodiments, the pharmaceutical composition may contain an enteric coating comprising about 13% or about 15%, 16%, 17% or 18% by weight of, for example, an acid. (See, e.g., PCT Publication No. WO 2010 / 054826, which is herein incorporated by reference in its entirety).

[0372] The rate at which the coating dissolves and the active ingredient is released is its dissolution rate. In one embodiment, the intended tablet may have a dissolution profile, for example, when tested in phosphate buffer at pH 7.2 in a USP / EP Type 2 apparatus (paddle) at 100 rpm at 37° C., releasing about 50% to about 100% of the UNC13A oligonucleotide after about 120 minutes to about 240 minutes (e.g., after 180 minutes). In another embodiment, the intended tablet may have a dissolution profile, for example, when tested in dilute HCl at pH 1.0 in a USP / EP Type 2 apparatus (paddle) at 100 rpm at 37° C., wherein substantially no UNC13A oligonucleotide is released after 120 minutes. In another embodiment, the contemplated tablets can have a dissolution profile, for example, releasing from about 10% to about 30%, or no more than about 50%, of the UNC13A oligonucleotide after 30 minutes when tested in phosphate buffer at pH 6.6 in a USP / EP Type 2 apparatus (paddle) at 100 rpm and at 37°C.

[0373] In some embodiments, the methods provided herein may further comprise administering at least one additional agent intended to treat the diseases and disorders disclosed herein. In one embodiment, the contemplated additional agents may be co-administered (e.g., sequentially or simultaneously). Dosage and frequency of administration

[0374] The dosages or amounts described below refer to the oligonucleotide or a pharmaceutically acceptable salt thereof.

[0375] In some embodiments, the methods described herein comprise administering at least 1 μg, at least 5 μg, at least 10 μg, at least 20 μg, at least 30 μg, at least 40 μg, at least 50 μg, at least 60 μg, at least 70 μg, at least 80 μg, at least 90 μg, or at least 100 μg of a UNC13A antisense oligonucleotide, such as a UNC13A oligonucleotide. In some embodiments, the methods comprise administering 10 mg to 500 mg, 1 mg to 10 mg, 10 mg to 20 mg, 20 mg to 30 mg, 30 mg to 40 mg, 40 mg to 50 mg, 50 mg to 60 mg, 60 mg to 70 mg, 70 mg to 80 mg, 80 mg to 90 mg, 90 mg to 100 mg, 100 mg to 150 mg, 150 mg to 200 mg, 200 mg to 250 mg g, 250 mg to 300 mg, 300 mg to 350 mg, 350 mg to 400 mg, 400 mg to 450 mg, 450 mg to 500 mg, 500 mg to 600 mg, 600 mg to 700 mg, 700 mg to 800 mg, 800 mg to 900 mg, 900 mg to 1 g, 1 mg to 50 mg, 20 mg to 40 mg, or 1 mg to 500 mg of a UNC13A antisense oligonucleotide.

[0376] In some embodiments, the methods described herein comprise administering a formulation comprising about 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1 g, 1.5 g, 2.0 g, 2.5 g, 3.0 g, 3.5 g, 4.0 g, 4.5 g, or 5.0 g of a disclosed UNC13A oligonucleotide. In some embodiments, the formulation may contain about 40 mg, 80 mg, or 160 mg of a disclosed UNC13A oligonucleotide. In some embodiments, the formulation may contain at least 100 μg of a disclosed UNC13A oligonucleotide. For example, the formulation may contain about 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 1 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, or 30 mg of a disclosed UNC13A oligonucleotide. The amount administered will depend on variables such as the type and extent of the disease or indication being treated, the patient's general health and size, the in vivo efficacy of the UNC13A oligonucleotide, the pharmaceutical formulation, and the route of administration. The initial dose may be increased to above the upper limit level to quickly achieve the desired blood or tissue levels. Alternatively, the initial dose may be less than the optimal dose, and the dose may be gradually increased over the course of treatment. Human doses can be optimized, for example, in a conventional Phase I dose-escalation study. The frequency of dosing may vary depending on factors such as the route of administration, dose, and the disease being treated. Exemplary dosing frequencies are once a day, once a week, and once every two weeks. In some embodiments, dosing is once a day for 7 days. In some embodiments, dosing is once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, or once every 12 weeks. In some embodiments, dosing is once a month to once every three months. In some embodiments, dosing is once every two weeks for three doses, then once a month, once every two months, or once every three or four months. Combination therapy

[0377] In various embodiments, the UNC13A AONs disclosed herein may be administered in combination with one or more additional therapies. In some embodiments, combination therapies of the disclosed oligonucleotides and one or more additional therapies can synergistically treat amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injury (e.g., brachial plexus injury), neuropathies (e.g., chemotherapy-induced neuropathy), TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry syndrome, dementia with Lewy bodies associated with Alzheimer's disease, Parkinson's disease with or without dementia, and limbic-predominant age-related TDP-43 encephalopathy (LATE)), epilepsy, brain age-related TDP-43 with sclerosis (CARTS), facial-onset sensory motor neuronopathy, Guam Parkinsonism and Dementia syndrome, multisystem proteinopathies, CTE, and synaptic diseases such as autism.

[0378] Non-limiting examples of Parkinson's disease (PD) therapies include deep brain stimulation, levodopa and carbidopa (duopa, rytary, Sinemet, inbrija), istradefylline (nourianz), safinamide (xadago), pramipexole (mirapex), rotigotine (neupro), ropinirole (requip), amantadine (gocovri, symmetrel, osmolex), benztropine (Cogentin), trihexyphenidyl (artane), selegiline (eldepryl, zelapar), rasagiline, entacapone (comtan), apicapone (ongentys), tolcapone (tasmar), apomorphine (apokyn, kynmobi), exenatide, Ganoderma lucidum, BIIB054, BIIB094, caffeine, sarizotan, Nuplazid, and embryonic dopamine cell implantation.

[0379] Non-limiting examples of Alzheimer's disease (AD) therapies include aducanumab (Aduhlem), memantine (Namenda), donepezil (Aricept), rivastigmine (Exelon), galantamine (razadyne), Namzeric, suvorexant (belsomra), and lencanemab.

[0380] A non-limiting example of a treatment for amyotrophic lateral sclerosis (ALS) is pridopidine.

[0381] Non-limiting examples of frontotemporal dementia (FTD) therapies include olanzapine (Zyprexa), quetiapine (Seroquel), SSRIs (citalopram (Cipramil)), dapoxetine (Priligy), escitalopram (Cipralex), fluoxetine (Prozac or Oxactin), fluvoxamine (Faverin), paroxetine (Seroxat), sertraline (Lustral), vortioxetine (Brintellix), divalproex sodium (Depakote), carbamazepine (Tegretol), and medroxyprogesterone.

[0382] Non-limiting examples of epilepsy therapies include brivaracetam (briviact), cannabidiol (epidiolex), carbamazepine (carbatrol, Tegretol), cenobamate (xcopri), diazepam (valium), lorazepam (Ativan), clonazepam (klonopin), eslicarbazepine (aptiom), ethosuximide (zarontin), felbatol (felbatol), fenfluramine (fintepla), lacosamide (VIMPAT), lamotrigine (Lamictal), levetiracetam (Keppra), oxcarbazepine (oxtellar xr, Trileptal), balampanel (fycompa), phenobarbital, phenytoin (dilantin), pregabalin (lyrica), tiagabine (gabitril), topiramate (topamax), sodium valproate (depakene, depakote), and zonisamide (zonegran).

[0383] Other therapies of example include riluzole (Rilutek), PrimeC, edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AMX0035 (ELYBRIO), ZILUCOPLAN (RA101495), pridopidine, dual AON intrathecal administration (e.g., BIIB067, BIIB078, and BIIB105), BIIB100, levodopa / carbidopa, dopaminergic agents (e.g., ropinirole, pramipexole, rotigotine), medroxyprogesterone, KCNQ2 / KCNQ3 openers (e.g., retigabine, XEN1101, or QRL-101), bioactive scaffolds, anticonvulsants, and psychostimulants. Additional therapies may also include respiratory care, physical therapy, occupational therapy, speech therapy, and nutritional support.Other non-limiting examples of other therapies include any of the following: deep brain stimulation, levodopa and carbidopa (duopa, rytary, Sinemet, inbrija), istradefylline (nourianz), safinamide (xadago), pramipexole (Mirapex), rotigotine (neupro), ropinirole (requip), amantadine (gocovri, symmetrel, osmolex), benztropine (Cogentin), trihexyphenidyl (artane), selegiline (eldepryl, zelapa r), rasagiline, entacapone (Comtan), opicapone (Ongentys), tolcapone (Tasmar), apomorphine (Apokyn, Kynmobi), exenatide, Ganoderma lucidum, BIIB054, BIIB094, caffeine, sarizotan, embryonic dopamine cell implantation, aducanumab (Aduhlem), memantine (Namenda), donepezil (Aricept), rivastigmine (Exelon), galantamine (razadyne), Namzeric, suvorexant (belsomra) ), lencanemab, olanzapine (Zyprexa), quetiapine (Seroquel), SSRIs (citalopram (Cipramil)), dapoxetine (Priligy), escitalopram (Cipralex), fluoxetine (Prozac or Oxactin), fluvoxamine (Faverin), paroxetine (Seroxat), sertraline (Lustral), vortioxetine (Brintellix), sodium valproate (Depakote), carbamazepine (Tegretol), medroxyprogesterone acetate, brivaracetam (br iviact), cannabidiol (epidiolex), carbamazepine (carbatrol, Tegretol), cenobamate (xcopri), diazepam (Valium), lorazepam (Ativan), clonazepam (klonopin), eslicarbazepine (aptiom), ethosuximide (zarontin), felbamate (felbatol), fenfluramine (fintepla), lacosamide (VIMPAT), lamotrigine (Lamictal), levetiracetam (Keppra), oxcarbazepine (oxtellar XR, Trileptal), perampanel (fycompa), phenobarbital, phenytoin (dilantin), pregabalin (lyrica), tiagabine (gabitril), topiramate (topamax), valproate (depakene, depakote), and zonisamide (zonegran).In various embodiments, the additional therapy can be a second antisense oligonucleotide. As an example, the second antisense oligonucleotide can target UNC13A transcripts (eg, UNC13A pre-mRNA, mature UNC13A mRNA) to modulate the expression level of full-length UNC13A protein.

[0384] Non-limiting examples of spinal cord injury therapies include bioactive scaffolds such as bioactive scaffolds with enhanced supramolecular motion. Further details of examples of bioactive scaffolds as spinal cord injury therapies are described in Alvarez et al., "Bioactive scaffolds with enhanced supramolecular motion promote recovery from spinal cord injury." Science, 374, 848-856 (2021), which is incorporated herein by reference in its entirety.

[0385] In various embodiments, disclosed oligonucleotide and one or more other therapies can be put together and provided in a conjugated form. Further description of the conjugate relating to disclosed oligonucleotide is as described below. In various embodiments, disclosed oligonucleotide and one or more other therapies are provided in parallel. In various embodiments, disclosed oligonucleotide and one or more other therapies are provided simultaneously. In various embodiments, disclosed oligonucleotide and one or more other therapies are provided successively. Conjugate

[0386] In certain embodiments, provided herein are oligomeric compounds comprising an oligonucleotide (e.g., a UNC13A oligonucleotide) and optionally one or more conjugate groups and / or terminal groups. The conjugate group includes one or more conjugate moieties and a conjugate linker that connects the conjugate moiety to the oligonucleotide. The conjugate group can be connected to one or both ends and / or any internal position of the oligonucleotide. In certain embodiments, the conjugate group is connected to the 2'-position of the nucleoside of the modified oligonucleotide. In certain embodiments, the conjugate connected to one or both ends of the oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is connected to the 3' and / or 5'-end of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is connected to the 3'-end of the oligonucleotide. In certain embodiments, the conjugate group is connected near the 3'-end of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is connected to the 5'-end of the oligonucleotide. In certain embodiments, the conjugate group is connected near the 5'-end of the oligonucleotide.

[0387] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more independently modified or unmodified nucleosides. Conjugate group

[0388] In certain embodiments, the UNC13A AON is covalently linked to one or more conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the linked oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In specific embodiments, the conjugate group modifies (e.g., increases) the circulation time of the oligonucleotide in the bloodstream, such that an increased concentration of the oligonucleotide is delivered to the brain. In specific embodiments, the conjugate group modifies (e.g., increases) the residence time of the oligonucleotide in the target organ (e.g., the brain), such that the increased residence time of the oligonucleotide improves their performance (e.g., efficacy). In specific embodiments, the conjugate group increases the delivery of the oligonucleotide to the brain across the blood-brain barrier and / or brain parenchyma (e.g., via receptor-mediated transcytosis). In specific embodiments, the conjugate group enables the oligonucleotide to target a specific organ (e.g., the brain). In certain embodiments, the conjugate group imparts new properties to the linked oligonucleotide, such as a fluorophore or reporter group that enables detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been previously described, for example: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556); bile acids (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060); thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770); sulfocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538); fatty chains, such as dodecanethiol (do-decan-diol) or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54); phospholipids, such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783); a polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973); or adamantaneacetic acid, a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237); an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937); a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740); or a GalNAc cluster (e.g., WO 2014 / 179620). . Conjugate part

[0389] Conjugate moieties include, but are not limited to, intercalating agents, reporters, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, bile acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, dyes, bile acids, and phenylbutyric acid. In specific embodiments, the conjugate moiety is selected from peptides, lipids, N-acetylgalactosamine (GalNAc), cholesterol, vitamin E, lipoic acid, pantothenic acid, polyethylene glycol, antibodies (e.g., antibodies for crossing the blood-brain barrier, such as anti-transferrin receptor antibodies), or cell penetrating peptides (e.g., transactivator of transcription (TAT) and penetratine).

[0390] In certain embodiments, the conjugate moiety comprises an active drug substance, e.g., aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazine, chlorothiazide, diazepine, indomethacin, a barbiturate, a cephalosporin, a sulfonamide, an antidiabetic agent, an antibacterial agent, or an antibiotic. Conjugate linker

[0391] The conjugate moiety is linked to the UNC13A AON via a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly linked to the oligonucleotide via a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbon chain, or an oligomer of repeating units, such as ethylene glycol, nucleoside, or amino acid units.

[0392] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino groups. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0393] In certain embodiments, conjugate linkers (including above-mentioned conjugate linkers) are bifunctional linking moieties, such as those known in the art that can be used for connecting conjugate groups to parent compounds (such as oligonucleotides provided herein). Generally, bifunctional linking moieties include at least two functional groups. One of the functional groups is selected to be combined with a specific site on the parent compound, and another functional group is selected to be combined with the conjugate group. Examples of functional groups for bifunctional linking moieties include, but are not limited to, electrophiles (electrophile) for reacting with nucleophilic groups and nucleophiles (nucleophile) for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties include one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl and alkynyl.

[0394] Examples of conjugated linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxooctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugated linkers include, but are not limited to, substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl or substituted or unsubstituted C2-C 10 Alkynyl, where a non-limiting list of preferred substituents includes hydroxy, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halo, alkyl, aryl, alkenyl, and alkynyl.

[0395] In certain embodiments, the conjugate linker comprises 1-10 linker-nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker-nucleosides. In certain embodiments, the conjugate linker comprises 3 linker-nucleosides.

[0396] In certain embodiments, this type of linker-nucleoside is a modified nucleoside. In certain embodiments, the linker-nucleoside comprises a modified sugar moiety. In certain embodiments, the linker-nucleoside is unmodified. In certain embodiments, the linker-nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is generally desired that the linker-nucleoside be cleaved from the oligomeric compound after reaching the target tissue. Therefore, the linker-nucleoside is usually connected to each other and to the remainder of the oligomeric compound through a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0397] In this article, linker-nucleosides are not considered to be part of an oligonucleotide. Therefore, in embodiments, wherein the oligomeric compound comprises an oligonucleotide having a specified number or range of linked nucleosides and / or a specified percentage complementarity to a reference nucleic acid, and the oligomeric compound further comprises a conjugated group comprising a conjugated linker, wherein the conjugated linker comprises linker nucleosides, those linker nucleosides are not counted in the length of the oligonucleotide and are not used to determine the percentage complementarity of the oligonucleotide to the reference nucleic acid.

[0398] In certain embodiments, it is desirable for the conjugate group to be cleaved from the UNC13A AON. For example, in certain cases, an oligomeric compound comprising a particular conjugate moiety is better taken up by a particular cell type, but once the oligomeric compound is taken up, it is desirable for the conjugate group to be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugated linkers may comprise one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, the cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved within a cell or subcellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0399] In certain embodiments, the cleavable bond is selected from: an amide, an ester, an ether, one or two esters of a phosphodiester, a phosphate, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or two esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between an oligonucleotide and a conjugate moiety or a conjugate group.

[0400] In certain embodiments, the cleavable moiety comprises one or more joints-nucleosides or is composed of one or more joints-nucleosides. In certain such embodiments, one or more joints-nucleosides are connected to each other and / or to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, such a cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside, which is connected to the 3' or 5'-terminal nucleoside bond of the oligonucleotide by a phosphate internucleoside bond, and is covalently linked to the remainder of the conjugate joint or conjugate portion by a phosphate or thiophosphate bond. In certain such embodiments, the cleavable moiety is a 2'-deoxyadenosine. terminal groups

[0401] In certain embodiments, the oligomeric compound comprises one or more end groups. In certain such embodiments, the oligomeric compound comprises a stable 5'-phosphate. Stable 5'-phosphates include but are not limited to 5'-phosphonates, including but not limited to 5'-vinylphosphonates. In certain embodiments, the end group comprises one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, the end group comprises one or more 2'-connected nucleosides. In certain such embodiments, the 2'-connected nucleosides are abasic nucleosides. In various embodiments, the end group comprises one or more spacers. Diagnostic methods

[0402] The present disclosure also provides methods for diagnosing a patient suffering from a neurological disease that rely on detecting the level of a UNC13A expression signal in one or more biological samples from the patient. As used herein, the term "UNC13A expression signal" can refer to any indication of UNC13A gene expression or gene or gene product activity. UNC13A gene products include RNA (e.g., mRNA), peptides, and proteins. UNC13A gene expression indices that can be assessed include, but are not limited to, UNC13A gene or chromatin state, interaction of the UNC13A gene with cellular components that regulate gene expression, expression level of a UNC13A gene product (e.g., expression level of a UNC13A transcript (e.g., UNC13A pre-mRNA) comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208), or interaction of a UNC13A RNA or protein with the transcriptional, translational, or post-translational processing machinery.

[0403] Detection of UNC13A expression signals can be accomplished by in vivo, in vitro, or ex vivo methods. In preferred embodiments, the methods of the present disclosure can be performed in vitro. Detection methods can include detecting blood, serum, fecal matter, tissue, cerebrospinal fluid, spinal fluid, urine, extracellular vesicles (e.g., CSF exosomes) or cells of a patient. Detection can be achieved by measuring the expression signal of a UNC13A transcript (e.g., UNC13A pre-mRNA) comprising a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208 in whole tissue, tissue explants, cell culture, dissociated cells, cell extracts, extracellular vesicles (e.g., CSF exosomes) or body fluids (including blood, spinal fluid, cerebrospinal fluid, urine, lymph, plasma, or serum). Detection methods include assays that measure the expression level of the UNC13A gene product, such as Western blot, FACS, ELISA, other quantitative binding assays, cell or tissue growth assays, Northern blot, quantitative or semi-quantitative polymerase chain reaction, medical imaging methods (e.g., MRI), or immunostaining methods (e.g., immunohistochemistry or immunocytochemistry). General Modification

[0404] Although certain compounds, compositions and methods described herein have been specifically described according to certain embodiments, the following examples are merely illustrative of the compounds described herein and are not intended to limit the present invention. Each reference, GenBank accession number, etc. cited in this application is incorporated herein by reference in its entirety.

[0405] Although the sequence table attached to the application identifies each sequence as "RNA" or "DNA" as needed, in fact, any combination of chemical modifications can be used to modify those sequences. It will be readily understood by those skilled in the art that, in some cases, it is arbitrary to use "RNA" or "DNA" to describe modified oligonucleotides. For example, an oligonucleotide comprising a nucleoside containing a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar (2'-OH replaces one 2'-H of DNA) or an RNA with a modified base (thymine (methylated uracil) replaces the uracil of RNA). Therefore, the nucleotide sequences provided herein (including but not limited to those in the sequence table) are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids with modified core bases. By way of further example and not limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" encompasses any oligomeric compound having such a nucleobase sequence, whether modified or unmodified, including but not limited to compounds containing RNA bases, such as those having the sequence "AUCGAUCG", and those having some DNA bases and some RNA bases, such as "AUCGATCG", as well as oligomeric compounds having other modified nucleobases, such as "ATCGATCG". m CGAUCG", where m C represents a cytosine base containing a methyl group at the 5-position.

[0406] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers and thus produce enantiomers, diastereomers, and other stereoisomeric configurations, which can be defined in terms of absolute stereochemistry as (R) or (S), α or β (e.g., for sugar anomers), or (D) or (L) (e.g., for amino acids), etc. The compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Unless otherwise indicated, compounds provided herein that contain stereocenters drawn or described with undefined stereochemistry include all such possible isomers, including their stereo-random and optically pure forms. Likewise, unless otherwise indicated, all tautomeric forms of the compounds herein are also included. Unless otherwise indicated, the compounds described herein are intended to include the corresponding salt forms.

[0407] The compounds described herein include variations in which one or more atoms are replaced by non-radioactive isotopes or radioactive isotopes of the specified element. For example, a compound herein containing a hydrogen atom encompasses each 1 All possible deuterium substitutions of H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include, but are not limited to: 2 H or 3 H instead 1 H, 13 C or 14 C instead 12 C, 15 N instead 14 N, 17 O or 18 O instead 16 O, and 33 S. 34 S. 35 S or 36 S instead 32 S. In certain embodiments, non-radioactive isotope substitutions can impart novel properties to oligomeric compounds that are beneficial for use as therapeutics or research tools. Example

[0408] The present disclosure is further illustrated by the following examples. These examples are provided for illustrative purposes only and should not be construed as limiting the scope or content of the present disclosure in any way. Example 1: Design and selection of UNC13A oligonucleotides

[0409] UNC13A AON oligonucleotides targeting UNC13A transcripts were designed and tested to identify UNC13A AONs that can reduce the amount of UNC13A transcripts (e.g., mis-spliced ​​UNC13A transcripts). Such UNC13A AONs include UNC13A parent oligonucleotides represented by any one of SEQ ID NOs: 1-1264 or UNC13A oligonucleotide variants represented by SEQ ID NOs: 2529-3792. The UNC13A parent oligonucleotides are 25 nucleosides in length. Each nucleoside of the UNC13A parent oligonucleotide is a modified nucleoside having a 2'MOE sugar moiety, and each "C" is substituted with 5-MeC. In addition, each internucleoside bond between nucleosides of the UNC13A oligonucleotide is a phosphorothioate internucleoside bond.

[0410] Typically, UNC13A antisense oligonucleotides are 25 oligonucleotide units in length. However, variants of UNC13A antisense oligonucleotides have also been designed to have different lengths (e.g., 23mer, 21mer, or 19mer). Examples of these variant UNC13A antisense oligonucleotides are designed to include a subset of SEQ ID NOs: 2529-3792 sequences.

[0411] Table 6A: Example UNC13A AONs (including UNC13A oligonucleotides with two spacers) *Unless otherwise indicated, each nucleoside of the antisense oligonucleotide shown is a modified nucleoside having a 2'-O-(2-methoxyethyl) (2'-MOE) sugar moiety, each "C" is replaced by 5-methylcytosine (5-MeC), and all internucleoside linkages are phosphorothioate linkages. The spacer represented by S is not a nucleoside. S represents a spacer of Formula (IIa') as disclosed herein.

[0412] Table 6B: Example UNC13A AONs (including UNC13A oligonucleotides with two spacers) *Unless otherwise indicated, each nucleoside of the antisense oligonucleotide is a modified nucleoside having a 2'-O-(2-methoxyethyl) (2'-MOE) sugar moiety, each "C" is replaced by 5-methylcytosine (5-MeC), and all internucleoside linkages are phosphorothioate linkages. The spacer represented by S is not a nucleoside. S represents a spacer of Formula (Iia') as disclosed herein. Example 2: Methods for evaluating UNC13A antisense oligonucleotides

[0413] UNC13A antisense oligonucleotides were evaluated in iPSC-derived human motor neurons (hMNs). Cells were seeded in 96-well plates at a density of 50,000 cells / well. Antisense oligonucleotides (AONs) directed against TDP43 were transfected using Endoporter (Gene Tools, Philomath, OR, USA) to reduce expression of the full-length UNC13a transcript. Vehicle controls consisted of motor neurons treated with Endoporter alone. Positive controls included cells treated with TDP43 AON alone ("AON TDP43" or "TDP43 AON").

[0414] TDP43AON is a gapmer oligonucleotide and has the following sequence and chemical structure: 5'A*A*G*G*C* T*T*C* A*T*A*T*T*G*T *A*C*T*T*T 3' (SEQ ID NO: 5167) wherein * = phosphorothioate, underscore = DNA, others = 2'MOE RNA; each "C" is 5-MeC.

[0415] To evaluate the ability of UNC13A AONs to restore full-length UNC13A (UNC13A FL) mRNA (also known as correctly spliced ​​UNC13A (UNC13A CS) mRNA), UNC13A antisense oligonucleotides were co-incubated with TDP43 AONs in Endoporter in culture medium and then added to cells. After 72 hours, the antisense oligonucleotides and Endoporter were washed out and replaced with fresh culture medium alone. After another 72 hours, RNA was collected from the 96-well plate for RT-qPCR. RNA was isolated, cDNA was generated, and multiplex RT-qPCR was performed for the full-length UNC13A transcript using TaqMan probes and quantified with reference to GAPDH.

[0416] Transcript levels (e.g., UNC13A full-length transcript or TDP43 transcript) were detected by RT-qPCR using Taqman. RT-qPCR was performed to detect GAPDH using TaqMan Gene Expression Assay Hs03929097_g1. TaqMan Gene Expression Assay Hs00392638_m1 was used for RT-qPCR to detect UNC13A-FL transcripts.

[0417] In Applied RT-qPCR was performed on a 7500 Real-time PCR system. One cycle of reverse transcription was performed at 50°C for 5 minutes. One cycle of RT inactivation / initial denaturation was performed at 95°C for 20 seconds. Amplification was performed for 45 cycles at 95°C for 1 second followed by 60°C for 20 seconds.

[0418] UNC13A-FL (Ct) was normalized to GAPDH (ΔCt). To visualize quantitative changes (e.g., % reduction of UNC13A-FL), the normalized UNC13A-FL signal was further normalized to vehicle (Endoporter treatment only, ΔΔCt). The equation RQ = 2 was used. -ΔΔCt The relative quantity (RQ) of transcript levels was calculated and used to describe treatment conditions compared to normal, healthy levels (1.0). The RQ values ​​for UNC13A FL were normalized using the following formula: (((RQAON-RQTDP43) / (RQendo-RQTDP43))*100

[0419] Table 7 shows the RT-qPCR results of UNC13A AONs with spacers and the performance of UNC13A AONs without spacers in human motor neurons. The ability of UNC13A AONs (e.g., UNC13A oligonucleotides without spacers or with one or two spacers) to increase or restore the level of full-length UNC13A mRNA (i.e., mRNA that translates full-length UNC13A protein) was tested. In some cases, UNC13A AONs with spacers increased full-length UNC13A mRNA ("UNC13A FL"), also referred to herein as correctly spliced ​​UNC13A (UNC13A CS). In some cases, UNC13A AONs without spacers increased full-length UNC13A mRNA or correctly spliced ​​UNC13A mRNA (UNC13ACS). Specific AON sequences are marked according to their corresponding SEQ ID NOs.

[0420] As shown in Table 7, a 500 nM dose of SEQ ID NO: 5153 (ACACAAASGGCCCAASCCTGAGT with two spacers) rescued full-length UNC13A mRNA to 55.69%. In contrast, a 500 nM dose of SEQ ID NO: 2788 (ACACAAACGGCCCAATCCTGAGT, without a spacer) rescued full-length UNC13A mRNA to 41.87%. This suggests that the addition of a spacer of SEQ ID NO: 5153 improves performance compared to a UNC13A AON counterpart without a spacer (e.g., SEQ ID NO: 2788).

[0421] As shown in Table 7, a 200 nM dose of SEQ ID NO: 5159 (GATCCGCSACTTAATSCACCTAC, with two spacers) rescued full-length UNC13A mRNA to 55.69%. A 500 nM dose of SEQ ID NO: 5159 (GATCCGCSACTTAATSCACCTAC, with two spacers) rescued full-length UNC13A mRNA to 66.62%. In contrast, a 200 nM dose of SEQ ID NO: 3547 (GATCCGCAACTTAATCCACCTAC, without a spacer) rescued full-length UNC13A mRNA to 43.88%. A 500 nM dose of SEQ ID NO: 3547 (GATCCGCAACTTAATCCACCTAC, without a spacer) rescued full-length UNC13A mRNA to 66.98%. This indicates that at doses of 200 nM and 500 nM, the performance of the AON with SEQ ID NO: 5159 (with a spacer) is similar to that of its UNC13A AON counterpart without a spacer (eg, SEQ ID NO: 3547).

[0422] As shown in Table 7, a 200 nM dose of SEQ ID NO: 5162 (CACCCACSCATCTAASTACCCCA, with two spacers) rescued full-length UNC13A mRNA to 47.94%. A 500 nM dose of SEQ ID NO: 5162 (CACCCACSCATCTAASTACCCCA, with two spacers) rescued full-length UNC13A mRNA to 83.19%. In contrast, a 200 nM dose of SEQ ID NO: 3652 (CACCCACCCATCTAACTACCCCA, without a spacer) rescued full-length UNC13A mRNA to 47.68%. A 500 nM dose of SEQ ID NO: 3652 (CACCCACCCATCTAACTACCCCA, without a spacer) rescued full-length UNC13A mRNA to 41.16%. This shows that at a dose of 200 nM, the performance of SEQ ID NO: 5162 (with a spacer) is similar to that of the UNC13A AON counterpart without a spacer (e.g., SEQ ID NO: 3652). However, at a dose of 500 nM, the addition of the spacer of SEQ ID NO: 5162 improved performance compared to the UNC13A AON counterpart without a spacer (SEQ ID NO: 3652).

[0423] As shown in Table 7, SEQ ID NO: 5161 (CCCACCCSTCTAACTSCCCCAAA, with two spacers) rescued full-length UNC13A mRNA to 43.10% at a 500 nM dose. In contrast, SEQ ID NO: 3650 (CCCACCCATCTAACTACCCCAAA, without a spacer) rescued full-length UNC13A mRNA to 23.37% at a 500 nM dose. This indicates that the addition of a spacer improves the performance of the AON having SEQ ID NO: 5161 compared to its UNC13A AON counterpart without a spacer (e.g., SEQ ID NO: 3650) at a 500 nM dose.

[0424] As shown in Table 7, a 200 nM dose of SEQ ID NO: 5164 (AAGTGTCSTGGAGAGSGCAAGGG, with two spacers) rescued full-length UNC13A mRNA to 35.39%. A 500 nM dose of SEQ ID NO: 5164 (AAGTGTCSTGGAGAGSGCAAGGG, with two spacers) rescued full-length UNC13A mRNA to 6.60%. In contrast, a 200 nM dose of SEQ ID NO: 3774 (AAGTGTCATGGAGAGTGCAAGGG, without a spacer) rescued full-length UNC13A mRNA to 19.04%. A 500 nM dose of SEQ ID NO: 3774 (AAGTGTCATGGAGAGTGCAAGGG, without a spacer) rescued full-length UNC13A mRNA to -34.58%. This demonstrates that the addition of a spacer improves the performance of the AON having SEQ ID NO: 5164 compared to its UNC13A AON counterpart without a spacer (eg, SEQ ID NO: 3774) at doses of 200 nM and 500 nM.

[0425] As shown in Table 7, a 200 nM dose of SEQ ID NO: 5142 (GAAAGTGTSATGGAGAGTSCAAGGG, with two spacers) rescued full-length UNC13A mRNA to 67.77%. A 500 nM dose of SEQ ID NO: 5142 (GAAAGTGTSATGGAGAGTSCAAGGG, with two spacers) rescued full-length UNC13A mRNA to 84.79%. In contrast, a 200 nM dose of SEQ ID NO: 1248 (GAAAGTGTCATGGAGAGTGCAAGGG, without a spacer) rescued full-length UNC13A mRNA to 22.48%. A 500 nM dose of SEQ ID NO: 1248 (GAAAGTGTCATGGAGAGTGCAAGGG, without a spacer) rescued full-length UNC13A mRNA to 24.84%. This demonstrates that the addition of a spacer improves the performance of the AON having SEQ ID NO: 5142 compared to its UNC13A AON counterpart without a spacer (eg, SEQ ID NO: 1248) at doses of 200 nM and 500 nM.

[0426] Together, these results demonstrate that distinct UNC13A AONs containing two spacers are able to increase the levels of UNC13A-FL mRNA to levels comparable to or exceeding those of its non-spacer counterpart. Example 3: Method for evaluating UNC13A antisense oligonucleotides

[0427] UNC13A antisense oligonucleotides were evaluated in iPSC-derived human motor neurons (hMNs). Cells were seeded in 96-well plates at a density of 40,000 cells / well. Antisense oligonucleotides (AONs) to TDP43 were transfected using Endoporter (Gene Tools, Philomath, OR, USA) to reduce the expression of full-length UNC13a transcripts and increase the expression of UNC13A cryptic exons. Vehicle controls consisted of motor neurons treated with Endoporter alone. Positive controls included cells treated with TDP43 AON alone ("AON TDP43" or "TDP43 AON").

[0428] TDP43AON is a gapmer oligonucleotide and has the following sequence and chemical structure: 5'A*A*G*G*C*T*T*C*A*T*A*T*T*G*T*A*C*T*T*T 3' (SEQ ID NO: 5167) wherein * = phosphorothioate, underscore = DNA, others = 2'MOE RNA; each "C" is 5-MeC.

[0429] To evaluate the ability of UNC13A AONs to reduce the levels of UNC13A cryptic exons, UNC13A antisense oligonucleotides were incubated with TDP43 AONs in endoporters in culture medium and then added to cells. After 72 hours, the antisense oligonucleotides and endoporters were washed out and replaced with fresh culture medium alone. Six days later, RNA was collected from 96-well plates for RT-qPCR. RNA was isolated, cDNA was generated, and multiplex RT-qPCR was performed using TaqMan probes targeting UNC13A cryptic exons and quantified with reference to GAPDH.

[0430] Transcript levels (e.g., UNC13A cryptic exon and TDP43 transcript) were detected by RT-qPCR using Taqman. TaqMan Gene Expression Assay Hs03929097_g1 was used for RT-qPCR detection of GAPDH. A custom sequence was used to detect UNC13a cryptic exons. UNC13a cryptic exons: Forward primer: ATTGTTCTGCACGTCGGT (SEQ ID NO: 5203) Reverse primer: GTCTGGGTATGTCTCTTCCAG (SEQ ID NO: 5204) Probe sequence: AGTTCTTTCCAGGAAACCCAGGCA (SEQ ID NO: 5203)

[0431] In Applied RT-qPCR was performed on a 7500 Real-time PCR system. One cycle of reverse transcription was performed at 50°C for 5 minutes. One cycle of RT inactivation / initial denaturation was performed at 95°C for 20 seconds. Amplification was performed for 45 cycles at 95°C for 1 second followed by 60°C for 20 seconds.

[0432] UNC13A-cryptic (Ct) was normalized to GAPDH (ΔCt). To visualize quantitative changes (e.g., % reduction in UNC13A-cryptic), the normalized UNC13A-cryptic signal was further normalized to vehicle (Endoporter treatment alone, ΔΔCt). The relative quantity (RQ) of transcript levels was calculated using the equation RQ = 2-ΔΔCt and used to describe the comparison of treatment conditions to normal, healthy levels (1.0). The RQ values ​​of UNC13A-cryptic were normalized using the following formula: ((RQAON-RQendo) / (RQTDP43-RQendo))*100

[0433] Table 8 shows the RT-qPCR results of UNC13A AONs with a spacer region and the performance of UNC13A AONs without a spacer region in human motor neurons.

[0434] As shown in Table 8, UNC13A AONs (e.g., UNC13A oligonucleotides without a spacer or with one or two spacers) were tested for their ability to reduce the levels of UNC13A transcripts with cryptic exons. In some cases, UNC13A AONs with a spacer reduced the levels of UNC13A cryptic exons. In some cases, UNC13A AONs without a spacer reduced the levels of UNC13A cryptic exons. Specific AON sequences are labeled according to their corresponding SEQ ID NOs.

[0435] As shown in Table 8, a 200 nM dose of SEQ ID NO: 273 (GAGACATACCCAGACACAAACGGCC, without a spacer) reduced the level of UNC13A cryptic exon to 4.4%. A 50 nM dose of SEQ ID NO: 273 (GAGACATACCCAGACACAAACGGCC, without a spacer) reduced the level of UNC13A cryptic exon to 20.3%.

[0436] As shown in Table 8, a 200 nM dose of SEQ ID NO: 2831 (GTTCTTTCCAGGAAACCCAGGCA, without a spacer) reduced the level of UNC13A cryptic exon to 5.1%. A 50 nM dose of SEQ ID NO: 2831 (GTTCTTTCCAGGAAACCCAGGCA, without a spacer) reduced the level of UNC13A cryptic exon to 26.0%.

[0437] As shown in Table 8, a 200 nM dose of SEQ ID NO: 5156 (GTTCTTTSCAGGAAASCCAGGCA, two spacers) reduced the level of UNC13A cryptic exon to 6.6%. A 50 nM dose of SEQ ID NO: 5156 (GTTCTTTSCAGGAAASCCAGGCA, two spacers) reduced the level of UNC13A cryptic exon to 41.2%.

[0438] As shown in Table 8, a 200 nM dose of SEQ ID NO: 5140 (GCAGCTGGSAGAGACATASCCAGAC, two spacers) reduced the UNC13A cryptic exon level to 8.3%. A 50 nM dose of SEQ ID NO: 5140 (GCAGCTGGSAGAGACATASCCAGAC, two spacers) reduced the UNC13A cryptic exon level to 31.0%.

[0439] As shown in Table 8, a 200 nM dose of SEQ ID NO: 303 (GTTCTTTCCAGGAAACCCAGGCAGC, without a spacer) reduced the level of UNC13A cryptic exon to 8.8%. A 50 nM dose of SEQ ID NO: 303 (GTTCTTTCCAGGAAACCCAGGCAGC, without a spacer) reduced the level of UNC13A cryptic exon to 35.4%.

[0440] As shown in Table 8, a 200 nM dose of SEQ ID NO: 5135 (GCAGCTSGAAGAGACATASCCAGAC, two spacers) reduced the UNC13A cryptic exon level to 11.8%. A 50 nM dose of SEQ ID NO: 5135 (GCAGCTSGAAGAGACATASCCAGAC, two spacers) reduced the UNC13A cryptic exon level to 30.6%.

[0441] As shown in Table 8, a 200 nM dose of SEQ ID NO: 283 (GCAGCTGGAAGAGACATACCCAGAC, without a spacer) reduced the level of UNC13A cryptic exon to 13.8%. A 50 nM dose of SEQ ID NO: 283 (GCAGCTGGAAGAGACATACCCAGAC, without a spacer) reduced the level of UNC13A cryptic exon to 66.0%.

[0442] As shown in Table 8, a 200 nM dose of SEQ ID NO: 2830 (TTCTTTCCAGGAAACCCAGGCAG, without a spacer) reduced the level of UNC13A cryptic exon to 15.2%. A 50 nM dose of SEQ ID NO: 2830 (TTCTTTCCAGGAAACCCAGGCAG, without a spacer) reduced the level of UNC13A cryptic exon to 34.4%.

[0443] As shown in Table 8, a 200 nM dose of SEQ ID NO: 3585 (ACATCCATCCATCCATCCATTCA, without a spacer) reduced the level of UNC13A cryptic exon to 15.8%. A 50 nM dose of SEQ ID NO: 3585 (ACATCCATCCATCCATCCATTCA, without a spacer) reduced the level of UNC13A cryptic exon to 45.4%.

[0444] As shown in Table 8, a 200 nM dose of SEQ ID NO: 5155 (TCTTTCCSGGAAACCSAGGCAGC, two spacers) reduced the UNC13A cryptic exon level to 18.2%. A 50 nM dose of SEQ ID NO: 5155 (TCTTTCCSGGAAACCSAGGCAGC, two spacers) reduced the UNC13A cryptic exon level to 41.9%.

[0445] As shown in Table 8, a 200 nM dose of SEQ ID NO: 5157 (TTCTTTCSAGGAAACSCAGGCAG, two spacers) reduced the level of UNC13A cryptic exon to 20.1%. A 50 nM dose of SEQ ID NO: 5157 (TTCTTTCSAGGAAACSCAGGCAG, two spacers) reduced the level of UNC13A cryptic exon to 42.8%.

[0446] As shown in Table 8, a 200 nM dose of SEQ ID NO: 1059 (ACACATCCATCCATCCATCCATCCATTCA, without a spacer) reduced the level of UNC13A cryptic exon to 23.1%. A 50 nM dose of SEQ ID NO: 1059 (ACACATCCATCCATCCATCCATTCA, without a spacer) reduced the level of UNC13A cryptic exon to 50.2%.

[0447] As shown in Table 8, a 200 nM dose of SEQ ID NO: 2829 (TCTTTCCAGGAAACCCAGGCAGC, without a spacer) reduced the level of UNC13A cryptic exon to 25%. A 50 nM dose of SEQ ID NO: 2829 (TCTTTCCAGGAAACCCAGGCAGC, without a spacer) reduced the level of UNC13A cryptic exon to 40.6%.

[0448] As show...

Claims

1. A compound comprising a modified oligonucleotide, the modified oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208, a sequence having 90% identity thereto, or a 15 to 50 consecutive nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside bond of the oligonucleotide is a non-natural bond.

2. The compound of claim 1, wherein the modified oligonucleotide comprises a spacer.

3. A compound comprising a modified oligonucleotide, the modified oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208, a sequence having 90% identity thereto, or a 15 to 50 consecutive nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside bond of the oligonucleotide is a non-natural bond, and wherein the oligonucleotide comprises a spacer.

4. An oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208, a sequence having 90% identity thereto, or a 15 to 50 consecutive nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside bond of the oligonucleotide is a non-natural bond.

5. The oligonucleotide of claim 4, further comprising a spacer.

6. An oligonucleotide comprising a sequence that is at least 85 98% complementary to a portion of equal length to any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208, a sequence having 90% identity thereto, or a 15 to 50 consecutive nucleobase portion thereof, wherein at least one (i.e. one or more) nucleoside bond of the oligonucleotide is a non-natural bond, and wherein the oligonucleotide comprises a spacer.

7. The compound of claims 1-3 or the oligonucleotide of claims 5-6, wherein the oligonucleotide comprises a segment having up to 11 linked nucleosides.

8. The compound of claim 1-3 or 7 or the oligonucleotide of claim 5-7, wherein the oligonucleotide comprises a segment having at most 10, 9 or 8 linked nucleosides.

9. The compound of any one of claims 1-3 or 7-8 or the oligonucleotide of any one of claims 4-8, wherein the oligonucleotide comprises a segment having up to 7 linked nucleosides.

10. The compound of any one of claims 1-3 or 7-9 or the oligonucleotide of any one of claims 5-9, wherein the oligonucleotide comprises a segment having at most 6, 5, 4, 3 or 2 linked nucleosides.

11. The compound of any one of claims 1-3 or 7-10 or the oligonucleotide of any one of claims 5-10, wherein each segment of the oligonucleotide comprises at most 7 linked nucleosides.

12. A compound or oligonucleotide as described in any one of claims 7-11, wherein the oligonucleotide comprises a sequence that is at least 85% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292.

13. A compound or oligonucleotide as described in any one of claims 7 to 12, wherein the oligonucleotide comprises a sequence that is at least 90% identical to SEQ ID NO: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NO: 5168-5202, SEQ ID NO: 5209-5221, or SEQ ID NO: 5235-5292, or an equal length portion of any one of them.

14. A compound or oligonucleotide as described in any one of claims 7-13, wherein the oligonucleotide comprises a sequence that is at least 95% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292.

15. The compound or oligonucleotide of any one of claims 7-13, wherein the oligonucleotide comprises a sequence that is 100% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292.

16. A compound or oligonucleotide as described in any one of claims 7-13, wherein the oligonucleotide comprises a segment of up to 11 linked nucleosides or up to 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence that is at least 85% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292.

17. A compound or oligonucleotide as described in any of claims 16, wherein the oligonucleotide comprises a segment of up to 6, 5, 4, 3 or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence that is at least 85% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292.

18. A compound or oligonucleotide as described in claim 16 or 17, wherein the oligonucleotide comprises a segment of up to 6, 5, 4, 3 or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence that is at least 90% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292.

19. The compound or oligonucleotide of any one of claims 1-18, wherein the oligonucleotide is at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units in length.

20. The compound or oligonucleotide of claim 19, wherein the oligonucleotide is at least 19 oligonucleotide units in length.

21. The compound or oligonucleotide of any one of claims 1-3 and 5-20, wherein the spacer is a nucleoside surrogate group comprising a non-sugar substituent that cannot be attached to a nucleotide base.

22. The compound or oligonucleotide of claim 21, wherein the spacer is located between positions 10 and 15 of the oligonucleotide.

23. The compound or oligonucleotide of claim 21, wherein the spacer is located between positions 7 and 11 of the oligonucleotide.

24. The compound or oligonucleotide of claim 21 or 23, wherein the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 14 and 22 of the oligonucleotide.

25. The compound or oligonucleotide of claim 24, wherein the spacer and the second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases.

26. The compound or oligonucleotide of claim 24 or 25, wherein the spacer is located between positions 7 and 9 of the oligonucleotide, and wherein the second spacer is located between positions 15 and 18 of the oligonucleotide.

27. The compound or oligonucleotide of any one of claims 24-26, wherein the spacer is located at position 8 of the oligonucleotide, and wherein the second spacer is located at position 16 of the oligonucleotide.

28. The compound or oligonucleotide of any one of claims 24-27, wherein the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 21 and 24 of the oligonucleotide.

29. The compound or oligonucleotide of claim 21, wherein the spacer is located between positions 2 and 5 of the oligonucleotide.

30. The compound or oligonucleotide of claim 29, wherein the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 8 and 12 of the oligonucleotide.

31. The compound or oligonucleotide of claim 30, wherein the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 18 and 22 of the oligonucleotide.

32. The compound or oligonucleotide of claim 21, wherein the oligonucleotide further comprises a second spacer and a third spacer, wherein the three spacers are located in the oligonucleotide at positions such that each segment of the oligonucleotide has at most 7 linked nucleosides.

33. The compound or oligonucleotide of claim 32, wherein at least two of the three spacers are adjacent to a guanine nucleobase.

34. The compound or oligonucleotide of claim 33, wherein each of at least two of the three spacers is immediately preceded by a guanine nucleobase.

35. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is a nucleoside surrogate group comprising a non-sugar substituent, wherein the non-sugar substituent does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal or hemiaminal moiety and is incapable of forming a covalent bond with a nucleotide base.

36. The compound or oligonucleotide of any one of claims 21 to 34, wherein the first spacer, the second spacer or the third spacer are each independently represented by formula (X), wherein: Ring A is an optionally substituted 4-8 membered monocyclic cycloalkyl or 4-8 membered monocyclic heterocyclyl, wherein the heterocyclyl contains 1 or 2 heteroatoms selected from O, S and N, provided that A cannot form a covalent bond with a nucleobase; and The symbol indicates the point of attachment to the internucleoside bond.

37. The compound or oligonucleotide of claim 36, wherein the first spacer, the second spacer or the third spacer are each independently represented by formula (Xa), wherein:

38. The compound or nucleotide of claim 36 or 37, wherein Ring A is an optionally substituted 4-8 membered monocyclic cycloalkyl selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl; or a 4-8 membered monocyclic heterocyclyl selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl and azepanyl.

39. The compound or nucleotide of claim 38, wherein Ring A is tetrahydrofuranyl.

40. The compound or nucleotide of claim 38, wherein Ring A is tetrahydropyranyl.

41. The compound or oligonucleotide of any one of claims 21-34, wherein the first spacer, the second spacer, or the third spacer are each independently represented by Formula I, wherein: X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.

42. The compound or oligonucleotide of any one of claims 21-34, wherein the first spacer, the second spacer or the third spacer are each independently represented by Formula I', wherein: X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.

43. The compound or oligonucleotide of any one of claims 21-34, wherein the first spacer, the second spacer or the third spacer are each independently represented by formula (Ia), wherein: as well as n is 0, 1, 2 or 3.

44. The compound or oligonucleotide of any one of claims 21-34, wherein the first spacer, the second spacer or the third spacer are each independently represented by formula (Ia'), wherein: as well as n is 0, 1, 2 or 3.

45. The compound or oligonucleotide of any one of claims 21-34, wherein the first spacer, the second spacer, or the third spacer are each independently represented by Formula II, wherein: as well as X is selected from -CH2- and -O-.

46. ​​The compound or oligonucleotide of any one of claims 21-34, wherein the first spacer, the second spacer or the third spacer are each independently represented by Formula II', wherein: as well as X is selected from -CH2- and -O-.

47. The compound or oligonucleotide of any one of claims 21-34, wherein the first spacer, the second spacer or the third spacer are each independently represented by formula (Iia)), wherein:

48. The compound or oligonucleotide of any one of claims 21-34, wherein the first spacer, the second spacer or the third spacer are each independently represented by formula (Iia'), wherein:

49. The compound or oligonucleotide of any one of claims 21-34, wherein the first spacer, the second spacer or the third spacer are each independently represented by formula (IIi), wherein: X is selected from -CH2- and -O-.

50. The compound or oligonucleotide of any one of claims 21-34, wherein the first spacer, the second spacer or the third spacer are each independently represented by formula (III'), wherein: X is selected from -CH2- and -O-.

51. The compound or oligonucleotide of any one of claims 21-34, wherein the first spacer, the second spacer or the third spacer are each independently represented by formula (IIIb), wherein:

52. The compound or oligonucleotide of any one of claims 21 to 34, wherein the first spacer, the second spacer or the third spacer are each independently represented by formula (IIIb'), wherein:

53. (Original) A compound or oligonucleotide as described in any one of claims 21-34, wherein the first spacer, the second spacer or the third spacer are each independently represented by formula III, wherein: as well as X is selected from -CH2- and -O-.

54. The compound or oligonucleotide of any one of claims 21-34, wherein the first spacer, the second spacer or the third spacer are each independently represented by Formula III', wherein: as well as X is selected from -CH2- and -O-.

55. The compound or oligonucleotide of any one of claims 21-34, wherein the first spacer, the second spacer or the third spacer are each independently represented by formula (IIIa), wherein:

56. The compound or oligonucleotide of any one of claims 21-34, wherein the first spacer, the second spacer or the third spacer are each independently represented by formula (IIIa'), wherein:

57. The compound or oligonucleotide of any one of the above claims, wherein the oligonucleotide further comprises a locked nucleic acid (LNA).

58. The compound or oligonucleotide of claim 57, wherein the locked nucleic acid (LNA) is located at one of positions 4, 7, 9, 12, 15 or 20 of the oligonucleotide.

59. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprising a spacer has a GC content of at least 10%.

60. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprising a spacer has a GC content of at least 20%.

61. The compound or oligonucleotide of any of the above claims, wherein the oligonucleotide comprising a spacer has a GC content of at least 25%.

62. The compound or oligonucleotide of any of the above claims, wherein the oligonucleotide comprising a spacer has a GC content of at least 30%.

63. The compound or oligonucleotide of any of the above claims, wherein the oligonucleotide comprising a spacer has a GC content of at least 40%.

64. The compound or oligonucleotide of any of the above claims, wherein the oligonucleotide comprising a spacer has a GC content of at least 50%.

65. A compound or oligonucleotide as claimed in any one of the preceding claims, wherein the oligonucleotide is 12 to 40 oligonucleotide units in length.

66. A compound or oligonucleotide as claimed in any of the above claims, wherein at least one (i.e. one or more) nucleoside linkage of the oligonucleotide is independently selected from a phosphodiester linkage, a phosphorothioate linkage, an alkylphosphoester linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropylphosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylenephosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a thiophosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoamidate linkage, a thiophosphoramidate linkage, an alkylthiophosphonate linkage, an alkylthiophosphotriester linkage, a phosphorothioate linkage, a selenophosphate linkage and a boranophosphate linkage.

67. A compound or oligonucleotide as described in any one of claims 1-66, wherein the one or more nucleoside bonds connecting the base at position 3 or position 4 of the oligonucleotide are phosphodiester bonds.

68. The compound or oligonucleotide of claim 67, wherein only one of the nucleoside bonds linking the base at position 3 or position 4 of the oligonucleotide is a phosphodiester bond.

69. A compound or oligonucleotide as described in any one of claims 1-66, wherein the nucleoside bonds connecting the bases at position 3 and position 4 of the oligonucleotide are both phosphodiester bonds.

70. The compound or oligonucleotide of any one of claims 1-66, wherein one or more bases immediately preceding the spacer in the oligonucleotide are linked by a phosphodiester bond.

71. The compound or oligonucleotide of claim 70, wherein only the base immediately preceding the spacer in the oligonucleotide is linked to the spacer via a phosphodiester bond.

72. The compound or oligonucleotide of claim 71, wherein the base immediately preceding the spacer in the oligonucleotide is further linked to another preceding base via a phosphodiester bond.

73. The compound or oligonucleotide of claim 71, wherein the oligonucleotide comprises a second spacer, wherein the base immediately preceding the second spacer is linked to another preceding base via a phosphodiester bond.

74. The compound or oligonucleotide of any one of claims 1-66, wherein one or more bases immediately following the spacer in the oligonucleotide are linked by a phosphodiester bond.

75. The compound or oligonucleotide of claim 74, wherein only the base immediately following the spacer in the oligonucleotide is linked to the spacer via a phosphodiester bond.

76. The compound or oligonucleotide of claim 70, wherein the two bases immediately preceding the spacer in the oligonucleotide are linked by a phosphodiester bond.

77. A compound or oligonucleotide as described in any one of claims 1-66, wherein one or more bases in the oligonucleotide immediately before the spacer are linked by a phosphodiester bond, and wherein one or more bases in the oligonucleotide immediately after the spacer are linked by a phosphodiester bond.

78. The compound or oligonucleotide of claim 77, wherein the base immediately before the spacer and the base immediately after the spacer are linked by a phosphodiester bond.

79. A compound or oligonucleotide as described in claim 77 or 78, wherein the oligonucleotide includes a second spacer, and wherein the one or more bases immediately before the second spacer in the oligonucleotide are linked by a phosphodiester bond, and wherein the one or more bases immediately after the second spacer in the oligonucleotide are linked by a phosphodiester bond.

80. The compound or oligonucleotide of claim 79, wherein the base immediately before the second spacer and the base immediately after the second spacer are linked by a phosphodiester bond.

81. The compound or oligonucleotide of any one of claims 1-66, wherein the oligonucleotide comprises a series of bases linked by phosphodiester bonds, the series of bases comprising at least two bases.

82. The compound or oligonucleotide of any one of claims 1-66, wherein the oligonucleotide comprises a series of bases linked by phosphodiester bonds, the series of bases comprising at least five bases.

83. The compound or oligonucleotide of claim 81 or 82, wherein the oligonucleotide comprises two or more spacers, and wherein the series of bases is located between the at least two spacers.

84. A compound comprising an oligonucleotide comprising a nucleobase sequence at least 90% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292.

85. An oligonucleotide comprising a nucleobase sequence at least 90% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs; 5066-5166, or SEQ ID NOs: 5168-5202.

86. A compound as described in claim 84 or an oligonucleotide as described in claim 84 or 85, wherein the nucleobase sequence is at least 95% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292.

87. A compound as described in claim 84 or an oligonucleotide as described in claim 84 or 85, wherein the nucleobase sequence is at least 100% identical to an equal length portion of any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292.

88. The compound or oligonucleotide of any one of claims 67-87, wherein the oligonucleotide is any one of a 19mer, a 21mer, a 23mer, or a 25mer.

89. A compound or oligonucleotide as described in any one of the above claims, wherein one or more internucleoside bonds of the oligonucleotide are modified internucleoside bonds.

90. The compound or oligonucleotide of claim 89, wherein the modified internucleoside bond of the oligonucleotide is a phosphorothioate bond.

91. A compound or oligonucleotide as described in claim 89 or 90, wherein all internucleoside bonds of the oligonucleotide are phosphorothioate bonds.

92. The compound or oligonucleotide of claim 90, wherein the phosphorothioate bond is in one of the Rp configuration or the Sp configuration.

93. A compound or oligonucleotide as described in any one of the preceding claims, wherein the oligonucleotide comprises at least one modified sugar moiety.

94. compounds or oligonucleotides as described in claim 93, wherein the modified sugar moiety is one of the following: a 2'-OMe modified sugar moiety, a bicyclic sugar moiety, 2'-O-(2-methoxyethyl) (2'-MOE), 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabinoside, locked nucleic acid (LNA), restricted ethyl 2'-4'-bridged nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acid (HNA) and a tricyclic analog (e.g., tcDNA).

95. The compound or oligonucleotide of any of the above claims, wherein the oligonucleotide exhibits at least a 30%, 40%, 50%, 60%, 70%, 80% or 90% increase of full-length UNC13A protein.

96. The compound or oligonucleotide of any of the above claims, wherein the oligonucleotide exhibits at least a 100% increase in full-length UNC13A protein.

97. The compound or oligonucleotide of any of the above claims, wherein the oligonucleotide exhibits at least a 200% increase in full-length UNC13A protein.

98. The compound or oligonucleotide of any of the above claims, wherein the oligonucleotide exhibits at least a 300% increase in full-length UNC13A protein.

99. The compound or oligonucleotide of any of the above claims, wherein the oligonucleotide exhibits at least a 400% increase in full-length UNC13A protein.

100. The compound or oligonucleotide of any one of claims 95-99, wherein the increase in full length UNC13A protein is measured as compared to the reduced level of full length UNC13A protein achieved using a TDP43 antisense oligonucleotide.

101. The compound or oligonucleotide of any of the above claims, wherein the oligonucleotide exhibits at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% rescue of full-length UNC13A protein.

102. The compound or oligonucleotide of any of the above claims, wherein the oligonucleotide exhibits at least a 50%, 60%, 70%, 80% or 90% reduction in mis-spliced ​​UNC13A transcripts.

103. A method of treating a neurological disease and / or neuropathy in a patient in need thereof, the method comprising administering to the patient a compound or oligonucleotide of any one of claims 1-102.

104. The method of claim 103, wherein the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injury (e.g., brachial plexus injury), neuropathy (e.g., chemotherapy-induced neuropathy), TDP43 proteinopathy (e.g., chronic traumatic encephalopathy, Perry syndrome, Lewy body dementia associated with Alzheimer's disease, Parkinson's disease with or without dementia, age-related TDP-43 encephalopathy predominantly limbic (LATE)), epilepsy, brain age-related TDP-43 with sclerosis (CARTS), facial onset sensory motor neuronopathy, Guam Parkinson's dementia syndrome, multisystem proteinopathy, CTE, and synaptic diseases such as autism.

105. The method of claim 104, wherein the neurological disease is ALS.

106. The method of claim 104, wherein the neurological disease is FTD.

107. The method of claim 104, wherein the neurological disease is ALS with FTD.

108. The method of claim 104, wherein the neurological disease is AD.

109. The method of claim 104, wherein the neurological disease is PD.

110. The method of claim 103, wherein the neuropathy is chemotherapy-induced neuropathy.

111. A method for restoring axonal growth and / or regeneration in neurons, the method comprising exposing the neurons to a compound or oligonucleotide as described in any one of claims 1-102.

112. A method for increasing, promoting, stabilizing or maintaining UNC13A expression and / or function in neurons, the method comprising exposing the cells to a compound or oligonucleotide according to any one of claims 1-102.

113. The method of claim 111 or 112, wherein the neuron is a motor neuron.

114. The method of claim 111 or 112, wherein the neurons are spinal cord neurons.

115. The method of any one of claims 111-114, wherein the neuron is a neuron of a patient in need of treatment for a neurological disease and / or neuropathy.

116. The method of claim 115, wherein the neuropathy is chemotherapy-induced neuropathy.

117. The method of any one of claims 111-116, wherein the exposing is performed in vivo or ex vivo.

118. The method of any one of claims 111-116, wherein the exposing comprises administering the oligonucleotide to a patient in need thereof.

119. The method of any one of claims 111-118, wherein the oligonucleotide is administered topically, parenterally, intrathecally, intrathalamically, intracisternal, orally, rectally, buccally, sublingually, vaginally, pulmonary, intratracheally, intranasally, transdermally, intraduodenally, or intracerebroventricularly.

120. The method of claim 119, wherein the oligonucleotide is administered orally.

121. The method of any one of claims 111-119, wherein a therapeutically effective amount of the oligonucleotide is administered intrathecally, intrathalamus, or intracisternal.

122. The method of any one of claims 111-121, wherein the patient is a human.

123. A pharmaceutical composition comprising the oligonucleotide of any one of claims 1-102 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient.

124. The pharmaceutical composition of claim 123, wherein the pharmaceutical composition is suitable for topical, intrathecal, intrathalamic, intracisternal, intraventricular, parenteral, oral, pulmonary, intratracheal, intranasal, transdermal, rectal, buccal, sublingual, vaginal or intraduodenal administration.

125. A method of treating a nervous system disease or neuropathy in a patient in need thereof, the method comprising administering to the patient in need thereof a therapeutically effective amount of the pharmaceutical composition of claim 123 or 124.

126. The method of claim 125, wherein the neurological disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer's disease (AD), Parkinson's disease (PD), Parkinson's disease with dementia, dementia with Lewy bodies, synucleinopathy, Huntington's disease, brachial plexus injury, peripheral nerve injury, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, tuberous sclerosis, Pick's disease, tauopathy, primary age-related tauopathy, Down syndrome, epilepsy / seizures, depression, traumatic brain injury (TBI), chronic traumatic encephalopathy (CTE), HIV-associated neurocognitive disorder (HAND), multiple system atrophy, amnestic mild cognitive impairment, corticobasal degeneration (CBD), and / or a neuropathy such as chemotherapy-induced neuropathy, spinocerebellar ataxia (SCA), SCA Type 2, spinal muscular atrophy (SMA), Parkinson's disease, Niemann-Pick disease type C (NPC), Charcot-Marie-Tooth disease (CMT), mucopolysaccharidosis type II (MPSIIA), mucolipidosis type IV, GM1 gangliosidosis, sporadic inclusion body myositis (sIBM), Henoch-Schonlein purpura (HSP), limbic-predominant age-related TDP-43 encephalopathy (LATE), cerebral age-related TDP-43 with sclerosis (CARTS), Gaucher disease, facial-onset sensory motor neuronopathy, Guam parkinsonism and dementia syndrome, multisystem proteinopathy, Perry disease, and synaptic diseases such as autism.

127. The method of claim 126, wherein the neurological disease is ALS.

128. The method of claim 126, wherein the neurological disease is FTD.

129. The method of claim 126, wherein the neurological disease is ALS with FTD.

130. The method of claim 126, wherein the neurological disease is AD.

131. The method of claim 126, wherein the neurological disease is PD.

132. The method of claim 125, wherein the neuropathy is chemotherapy-induced neuropathy.

133. The method of any one of claims 125-132, wherein the pharmaceutical composition is administered topically, parenterally, orally, pulmonary, rectal, buccal, sublingual, vaginally, intratracheally, intranasally, intracisternal, intrathecal, intrathalamic, transdermally, intraduodenally, or intracerebroventricularly.

134. The method of any one of claims 125-132, wherein the pharmaceutical composition is administered intrathecally, intrathalamus, or intracisternal.

135. The method of any one of claims 125-134, wherein a therapeutically effective amount of the oligonucleotide is administered intrathecally, intrathalamus, or intracisternal.

136. The method of any one of claims 125-135, wherein the patient is a human.

137. A method for treating a neurological disease in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide has at least 85% identity to any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292; wherein at least one (i.e. one or more) nucleoside bonds of the oligonucleotide are independently selected from phosphodiester bonds, phosphorothioate bonds, alkyl phosphate bonds, phosphorodithioate bonds, phosphotriester bonds, alkyl phosphonate bonds, 3-methoxypropylphosphonate bonds, methylphosphonate bonds, aminoalkylphosphotriester bonds, alkylenephosphonate bonds, phosphinate bonds, phosphoramidate bonds, thiophosphoramidate bonds, thiophosphordiamidate bonds, phosphordiamidate bonds, aminoalkylphosphoramidate bonds, thiophosphoramidate bonds, thioalkylphosphonate bonds, thioalkylphosphotriester bonds, phosphorothioate bonds, selenophosphate bonds and boranophosphate bonds, and / or wherein at least one (i.e., one or more) nucleosides are substituted with a component selected from the group consisting of 2'-O-(2-methoxyethyl) nucleosides, 2'-O-methyl nucleosides, 2'-O-(N-methylacetamide) nucleosides, 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabinoside, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET), and peptide nucleic acids (PNA), Optionally, wherein the oligonucleotide further comprises a spacer.

138. A method for treating amyotrophic lateral sclerosis (ALS) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide has at least 85% identity to any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292; wherein at least one (i.e. one or more) nucleoside bonds of the oligonucleotide are independently selected from the group consisting of phosphodiester, phosphorothioate, alkylphosphoester, phosphorodithioate, phosphotriester, alkylphosphonate, 3-methoxypropylphosphonate, methylphosphonate, aminoalkylphosphotriester, alkylenephosphonate, phosphinate, phosphoramidate, thiophosphoramidate, thiophosphordiamidate, phosphorodiamidate, aminoalkylphosphoamidate, thiophosphoramidate, thioalkylphosphonate, thioalkylphosphotriester, phosphorothioate, selenophosphate and boranophosphate, and / or wherein at least one (i.e., one or more) nucleosides are substituted with a component selected from the group consisting of 2'-O-(2-methoxyethyl) nucleosides, 2'-O-methyl nucleosides, 2'-O-(N-methylacetamide) nucleosides, 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabinoside, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET), and peptide nucleic acids (PNA), Optionally, wherein the oligonucleotide further comprises a spacer.

139. A method for treating Alzheimer's disease (AD) with frontotemporal dementia (FTD) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide has at least 85% identity to any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292; wherein at least one (i.e. one or more) nucleoside bonds of the oligonucleotide are independently selected from the group consisting of phosphodiester, phosphorothioate, alkylphosphoester, phosphorodithioate, phosphotriester, alkylphosphonate, 3-methoxypropylphosphonate, methylphosphonate, aminoalkylphosphotriester, alkylenephosphonate, phosphinate, phosphoramidate, thiophosphoramidate, thiophosphordiamidate, phosphorodiamidate, aminoalkylphosphoamidate, thiophosphoramidate, thioalkylphosphonate, thioalkylphosphotriester, phosphorothioate, selenophosphate and boranophosphate, and / or wherein at least one (i.e. one or more) nucleosides are substituted with a component selected from 2'-O-(2-methoxyethyl) nucleosides, 2'-O-methyl nucleosides, 2'-O-(N-methylacetamide) nucleosides, 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabino nucleosides, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET) and peptide nucleic acids (PNA), and optionally, wherein the oligonucleotide further comprises a spacer.

140. A method for treating frontotemporal dementia (FTD) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide has at least 85% identity to any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292; wherein at least one (i.e. one or more) nucleoside bonds of the oligonucleotide are independently selected from the group consisting of phosphodiester, phosphorothioate, alkylphosphoester, phosphorodithioate, phosphotriester, alkylphosphonate, 3-methoxypropylphosphonate, methylphosphonate, aminoalkylphosphotriester, alkylenephosphonate, phosphinate, phosphoramidate, thiophosphoramidate, thiophosphordiamidate, phosphorodiamidate, aminoalkylphosphoamidate, thiophosphoramidate, thioalkylphosphonate, thioalkylphosphotriester, phosphorothioate, selenophosphate and boranophosphate, and / or wherein at least one (i.e., one or more) nucleosides are substituted with a component selected from the group consisting of 2'-O-(2-methoxyethyl) nucleosides, 2'-O-methyl nucleosides, 2'-O-(N-methylacetamide) nucleosides, 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabinoside, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET), and peptide nucleic acids (PNA), Optionally, wherein the oligonucleotide further comprises a spacer.

141. A method for treating amyotrophic lateral sclerosis (ALS) with frontotemporal dementia (FTD) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide has at least 85% identity to any one of SEQ ID NOs: 1-1264, SEQ ID NOs: 2529-3792, SEQ ID NOs: 5066-5166, SEQ ID NOs: 5168-5202, SEQ ID NOs: 5209-5221, or SEQ ID NOs: 5235-5292; wherein at least one (i.e. one or more) nucleoside bonds of the oligonucleotide are independently selected from the group consisting of phosphodiester, phosphorothioate, alkylphosphoester, phosphorodithioate, phosphotriester, alkylphosphonate, 3-methoxypropylphosphonate, methylphosphonate, aminoalkylphosphotriester, alkylenephosphonate, phosphinate, phosphoramidate, thiophosphoramidate, thiophosphordiamidate, phosphorodiamidate, aminoalkylphosphoamidate, thiophosphoramidate, thioalkylphosphonate, thioalkylphosphotriester, phosphorothioate, selenophosphate and boranophosphate, and / or wherein at least one (i.e., one or more) nucleosides are substituted with a component selected from the group consisting of 2'-O-(2-methoxyethyl) nucleosides, 2'-O-methyl nucleosides, 2'-O-(N-methylacetamide) nucleosides, 2'-deoxy-2'-fluoro nucleosides, 2'-fluoro-β-D-arabinoside, locked nucleic acids (LNA), tricyclic nucleic acids, constrained methoxyethyl (cMOE), constrained ethyl (cET), and peptide nucleic acids (PNA), Optionally, wherein the oligonucleotide further comprises a spacer.

142. The method of any one of claims 137-141, wherein the nucleoside bond linking the base at position 3 or position 4 of the oligonucleotide is a phosphodiester bond.

143. The method of claim 142, wherein only one nucleoside bond linking the base at position 3 or position 4 of the oligonucleotide is a phosphodiester bond.

144. The method of any one of claims 137-141, wherein the nucleoside bonds linking the bases at position 3 and position 4 of the oligonucleotide are both phosphodiester bonds.

145. The method of any one of claims 137-141, wherein one or more bases immediately preceding the spacer in the oligonucleotide are linked by a phosphodiester bond.

146. The method of claim 145, wherein only the base immediately preceding the spacer in the oligonucleotide is linked to the spacer via a phosphodiester bond.

147. The method of claim 146, wherein the base immediately preceding the spacer in the oligonucleotide is further linked to another preceding base via a phosphodiester bond.

148. The method of claim 146, wherein the oligonucleotide comprises a second spacer, wherein the base immediately preceding the second spacer is linked to another preceding base via a phosphodiester bond.

149. The method of any one of claims 137-141, wherein one or more bases immediately following the spacer in the oligonucleotide are linked by a phosphodiester bond.

150. The method of claim 149, wherein only the base immediately following the spacer in the oligonucleotide is linked to the spacer via a phosphodiester bond.

151. The method of any one of claims 137-141, wherein the two bases immediately preceding the spacer in the oligonucleotide are linked by a phosphodiester bond.

152. The method of any one of claims 137-141, wherein one or more bases immediately preceding the spacer in the oligonucleotide are linked by a phosphodiester bond, and wherein one or more bases immediately following the spacer in the oligonucleotide are linked by a phosphodiester bond.

153. The method of claim 152, wherein a base immediately before the spacer and a base immediately after the spacer are linked by a phosphodiester bond.

154. A method as claimed in claim 152 or 153, wherein the oligonucleotide includes a second spacer region, and wherein one or more bases in the oligonucleotide immediately before the second spacer region are linked by a phosphodiester bond, and wherein one or more bases in the oligonucleotide immediately after the second spacer region are linked by a phosphodiester bond.

155. The method of claim 154, wherein a base immediately before the second spacer and a base immediately after the second spacer are linked by a phosphodiester bond.

156. The method of any one of claims 137-141, wherein the oligonucleotide comprises a series of bases linked by phosphodiester bonds, the series of bases comprising at least two bases.

157. The method of any one of claims 137-141, wherein the oligonucleotide comprises a series of bases linked by phosphodiester bonds, the series of bases comprising at least five bases.

158. The method of claim 156 or 157, wherein the oligonucleotide comprises two or more spacers, and wherein the series of bases is located between the at least two spacers.

159. The method of any one of claims 142-158, wherein the oligonucleotide is any of a 19mer, a 21mer, a 23mer, or a 25mer.

160. The method of any one of claims 137-141, wherein at least one (ie, one or more) internucleoside linkage of the oligonucleotide is a phosphorothioate linkage.

161. The method of any one of claims 137-141, wherein all internucleoside bonds of the oligonucleotide are phosphorothioate bonds.

162. An oligonucleotide and a pharmaceutically acceptable excipient, the oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NOs: 5057-5065 or SEQ ID NOs: 5206-5208, a sequence having 90% identity thereto, or a 15 to 50 contiguous nucleobase portion thereof, optionally wherein the oligonucleotide comprises a spacer, and wherein the oligonucleotide is capable of increasing, restoring or stabilizing expression of UNC13A mRNA capable of translating functional UNC13A and / or activity and / or function of UNC13A protein in cells or human patients with immune-mediated demyelinating diseases, and wherein the level of increase, restoration or stabilization of expression and / or activity and / or function is sufficient for the oligonucleotide to be used as a drug for treating immune-mediated demyelinating diseases.

163. The method of any one of claims 103-122 or 125-161, the pharmaceutical composition of claim 123 or 124, or the oligonucleotide of any one of claims 1-102 or 162, wherein the oligonucleotide comprises one or more chiral centers and / or double bonds.

164. The method of any one of claims 103-122, 125-161 or 163, the pharmaceutical composition of claim 123, 124 or 163, the oligonucleotide of any one of claims 1-102 or 162-163, wherein the oligonucleotide exists as a stereoisomer selected from geometric isomers, enantiomers and diastereomers.

165. A method of treating a neurological disease and / or neuropathy in a patient in need thereof, the method comprising administering to the patient in need thereof a therapeutically effective amount of the pharmaceutical composition of claim 123 or 124 in combination with a second therapeutic agent.

166. The method of claim 165, wherein the second therapeutic agent is selected from riluzole (Rilutek), PrimeC, edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AMX0035 (ELYBRIO), ZILUCOPLAN (RA101495), pridopidine, dual AON intrathecal administration (e.g., BIIB067, BIIB078, and BIIB105), BIIB100, levodopa / carbidopa, dopaminergic agents (e.g., ropinirole, pramipexole, rotigotine), medroxyprogesterone, KCNQ2 / KCNQ3 openers (e.g., retigabine, XEN1101, or QRL-101), bioactive scaffolds, anticonvulsants and psychostimulants, therapies (e.g.,Selected from respiratory care, physical therapy, occupational therapy, speech therapy, nutritional support), deep brain stimulation, levodopa and carbidopa (duopa, rytary, Sinemet, inbrija), istradefylline (nourianz), safinamide (xadago), pramipexole (mirapex), rotigotine (neupro), ropinirole (requip), amantadine (gocovri, symmetrel, osmolex), benztropine (Cogentin), trihexyphenidyl (artane), selegiline (eldepryl, ze lapar), rasagiline, entacapone (comtan), opicapone (ongentys), tolcapone (tasmar), apomorphine (apokyn, kynmobi), exenatide, ganoderma lucidum, BIIB054, BIIB094, caffeine, sarizoltan, embryonic dopamine cell implantation, aducanumab (Aduhlem), memantine (Namenda), donepezil (Aricept), rivastigmine (Exelon), galantamine (razadyne), Namzeric, suvorexant (belsomr a)), lencanemab, olanzapine (Zyprexa), quetiapine (Seroquel), SSRIs (citalopram (Cipramil)), dapoxetine (Priligy), escitalopram (Cipralex), fluoxetine (Prozac or Oxactin), fluvoxamine (Faverin), paroxetine (Seroxat), sertraline (Lustral), vortioxetine (Brintellix), sodium valproate (Depakote), carbamazepine (Tegretol), medroxyprogesterone, brivaracetam (b) riviact), cannabidiol (epidiolex), carbamazepine (carbatrol, Tegretol), cenobamate (xcopri), diazepam (Valium), lorazepam (Ativan), clonazepam (klonopin), eslicarbazepine (aptiom), ethosuximide (zarontin), felbamate (felbatol), fenfluramine (fintepla), lacosamide (vimpat), lamotrigine (Lamictal), levetiracetam (Keppra), oxcarbazepine (oxtellar xr, Trileptal), perampanel (fycompa), phenobarbital, phenytoin (dilantin), pregabalin (lyrica), tiagabine (gabitril), topiramate (topamax), valproate (depakene, depakote), and zonisamide (zonegran),For the treatment of neurological diseases.

167. A method for treating a neurological disease and / or a neuropathy in a patient in need thereof, the method comprising administering to a patient in need thereof a therapeutically effective amount of the pharmaceutical composition of claim 123 or 124, wherein at least one nucleoside bond of the oligonucleotide is a non-natural bond, optionally wherein the oligonucleotide comprises a spacer, and wherein the oligonucleotide further comprises a targeting or conjugation moiety selected from cholesterol, lipoic acid, pantothenic acid, polyethylene glycol, and an antibody for crossing the blood-brain barrier.

168. The method of any one of claims 103-122, 125-161, or 163-167, wherein the spacer is a nucleoside surrogate group comprising a non-sugar substituent that is incapable of attaching to a nucleotide base.

169. The method of claim 168, wherein the spacer is located between positions 10 and 15 of the oligonucleotide.

170. The method of claim 168, wherein the spacer is located between positions 7 and 11 of the oligonucleotide.

171. The method of claim 168 or 170, wherein the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 14 and 22 of the oligonucleotide.

172. The method of claim 171, wherein the spacer and the second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases.

173. The method of claim 171 or 172, wherein the spacer is located between positions 7 and 9 of the oligonucleotide, and wherein the second spacer is located between positions 15 and 18 of the oligonucleotide.

174. The method of any one of claims 171-173, wherein the spacer is located at position 8 of the oligonucleotide, and wherein the second spacer is located at position 16 of the oligonucleotide.

175. The method of any one of claims 171-174, wherein the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 21 and 24 of the oligonucleotide.

176. The method of claim 168, wherein the spacer is located between positions 2 and 5 of the oligonucleotide.

177. The method of claim 176, wherein the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 8 and 12 of the oligonucleotide.

178. The method of claim 177, wherein the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 18 and 22 of the oligonucleotide.

179. The method of claim 168, wherein the oligonucleotide further comprises a second spacer and a third spacer, wherein the three spacers are located in the oligonucleotide at positions such that each segment of the oligonucleotide has at most 7 linked nucleosides.

180. The method of claim 179, wherein at least two of the three spacers are adjacent to a guanine nucleobase.

181. The method of claim 180, wherein each of at least two of the three spacers is immediately preceded by a guanine nucleobase.

182. The method of any one of claims 168-181, wherein each of the first, second, or third spacers is a nucleoside surrogate group comprising a non-sugar substituent, wherein the non-sugar substituent does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal, or hemiaminal moiety and is incapable of forming a covalent bond with a nucleotide base.

183. The method of any one of claims 168-181, wherein each of the first spacer, the second spacer, or the third spacer is independently represented by formula (X), wherein: Ring A is an optionally substituted 4-8 membered monocyclic cycloalkyl or 4-8 membered monocyclic heterocyclyl, wherein the heterocyclyl contains 1 or 2 heteroatoms selected from O, S and N, provided that A cannot form a covalent bond with a nucleobase; and The symbol indicates the point of attachment to the internucleoside bond.

184. The method of claim 183, wherein the first spacer, the second spacer, or the third spacer are each independently represented by formula (Xa), wherein:

185. The method of claim 183 or 184, wherein Ring A is an optionally substituted 4-8 membered monocyclic cycloalkyl selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl; or a 4-8 membered monocyclic heterocyclyl selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxane, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl and azepanyl.

186. The method of claim 185, wherein Ring A is tetrahydrofuranyl.

187. The method of claim 185, wherein Ring A is tetrahydropyranyl.

188. The method of any one of claims 168-181, wherein the first spacer, the second spacer, or the third spacer are each independently represented by formula (I), wherein: X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.

189. The method of any one of claims 168-181, wherein the first spacer, the second spacer, or the third spacer are each independently represented by formula (I'), wherein:

190. The method of any one of claims 168-181, wherein the first spacer, the second spacer, or the third spacer are each independently represented by formula (Ia), wherein:

191. The method of any one of claims 168-181, wherein the first spacer, the second spacer, or the third spacer are each independently represented by formula (Ia'), wherein:

192. The method of any one of claims 168-181, wherein the first spacer, the second spacer, or the third spacer are each independently represented by Formula II, wherein: as well as X is selected from -CH2- and -O-.

193. The method of any one of claims 168-181, wherein the first spacer, the second spacer, or the third spacer are each independently represented by Formula II', wherein: as well as X is selected from -CH2- and -O-.

194. The method of any one of claims 168-181, wherein the first spacer, the second spacer, or the third spacer are each independently represented by formula (Iia), wherein:

195. The method of any one of claims 168-181, wherein the first spacer, the second spacer, or the third spacer are each independently represented by formula (Iia'), wherein:

196. The method of any one of claims 168-181, wherein the first spacer, the second spacer, or the third spacer are each independently represented by formula (IIi), wherein: X is selected from -CH2- and -O-.

197. The method of any one of claims 168-181, wherein the first spacer, the second spacer, or the third spacer are each independently represented by formula (III'), wherein: X is selected from -CH2- and -O-.

198. The method of any one of claims 168 to 181, wherein the first spacer, the second spacer, or the third spacer are each independently represented by formula (IIIb), wherein:

199. The method of any one of claims 168-181, wherein the first spacer, the second spacer, or the third spacer are each independently represented by formula (IIIb'), wherein: The method of any one of claims 168 to 181, wherein the first spacer, the second spacer or the third spacer are each independently represented by formula III, wherein: as well as X is selected from -CH2- and -O-.

200. The method of any one of claims 168-181, wherein the first spacer, the second spacer, or the third spacer are each independently represented by Formula III', wherein: as well as X is selected from -CH2- and -O-.

201. The method of any one of claims 168-181, wherein the first spacer, the second spacer, or the third spacer are each independently represented by formula (IIIa), wherein:

202. The method of any one of claims 168-181, wherein the first spacer, the second spacer, or the third spacer are each independently represented by formula (IIIa'), wherein:

203. The method of any one of claims 168-202, wherein the oligonucleotide comprising a spacer has a GC content of at least 10%.

204. The method of any one of claims 168-203, wherein the oligonucleotide comprising a spacer has a GC content of at least 20%.

205. The method of any one of claims 168-204, wherein the oligonucleotide comprising a spacer has a GC content of at least 25%.

206. The method of any one of claims 168-205, wherein the oligonucleotide comprising a spacer has a GC content of at least 30%.

207. The method of any one of claims 168-206, wherein the oligonucleotide comprising a spacer has a GC content of at least 40%.

208. The method of any one of claims 168-207, wherein the oligonucleotide comprising a spacer has a GC content of at least 50%.

209. The compound or oligonucleotide of any of the above claims, wherein the oligonucleotide exhibits at least a 30%, 40%, 50%, 60%, 70%, 80% or 90% reduction in UNC13A transcripts having cryptic exons.

210. The compound or oligonucleotide of any of the above claims, wherein the oligonucleotide exhibits at least a 100% reduction in UNC13A transcripts having cryptic exons.

211. The compound or oligonucleotide of any one of claims 200-201, wherein the reduction in UNC13A transcripts with cryptic exons is measured compared to the level of UNC13A transcripts with cryptic exons detected using a TDP43 antisense oligonucleotide.

212. The compound or oligonucleotide of any of the above claims, wherein the oligonucleotide exhibits at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% reduction in UNC13A transcripts having cryptic exons.

Images