PAPD5 inhibitors and methods of use thereof

Abstract

Provided herein are compounds that are PAPD5 inhibitors and are useful in the treatment of a variety of conditions, such as cancer, telomere disease, and aging-related disorders, as well as other degenerative disorders.

Description

[0001] This application is a divisional application of the Chinese invention patent application with an application date of April 23, 2020, application number 202080044298.X, and invention name “PAPD5 inhibitors and methods of use thereof”.

[0002] Federally funded research and development

[0003] This invention was made with government support from the National Institutes of Health (NIH) under Grant No. DK107716. The government has certain rights in this invention. Technical Field

[0004] The present disclosure relates to compounds that inhibit PAP-associated domain-containing 5 (PAPD5), and methods of using these compounds to treat conditions such as telomere diseases and aging-related and other degenerative disorders. Background Art

[0005] Telomeres are regions of repetitive nucleotide sequences at each end of chromosomes that protect them from degradation or fusion with adjacent chromosomes. Telomere length is a key determinant of a cell's ability to self-renew. The telomerase ribonucleoprotein maintains telomere length in tissue stem cells, and its function is crucial for human health and longevity.

[0006] Due to genetic or acquired damage, short telomeres can lead to a loss of cell self-renewal and cause life-threatening diseases for which there are few effective medical therapies. There is an unmet clinical need for new treatments in diseases involving short telomeres, such as aplastic anemia, pulmonary fibrosis, cirrhosis, and bone marrow failure. Summary of the Invention

[0007] Mutations in poly(A) ribonuclease (PARN) can lead to the accumulation of nascent telomerase RNA component (TERC) RNA transcripts in a 3' oligoadenylated form, which are targeted for destruction, leading to telomerase deficiency and telomere diseases. Disruption of the non-canonical poly(A) polymerase PAP-associated domain 5 (PAPD5; also known as topoisomerase-related function protein 4-2 (TRF4-2)) can restore TERC levels, telomerase activity, and telomere lengthening in cells from patients with PARN mutations. The present disclosure relates, at least in part, to PAPD5 inhibitors and methods of using such inhibitors.

[0008] In one general aspect, the present disclosure provides compounds of formula (I):

[0009]

[0010] or a pharmaceutically acceptable salt thereof, wherein X 1 、R 2 、R3 、R 4 、R 5 、R 6 、R 7 and R 8 As described in this article.

[0011] In another general aspect, the present disclosure provides compounds of formula (II):

[0012]

[0013] or a pharmaceutically acceptable salt thereof, wherein X 1 、R 2 、R 3 、R 4 、R 5 、R 6 、R 7 and R Cy As described herein, W is a carboxylic acid bioisostere, eg, as described herein.

[0014] In yet another general aspect, the present disclosure provides compounds of formula (III):

[0015]

[0016] or a pharmaceutically acceptable salt thereof, wherein X 1 、R 2 、R 3 、R 4 、R 6 、R 7 , W and R Cy As described in this article, R 5 Selected from C(O)NR c1 R d1 、S(O) 2 NR c1 R d1 and Cy 1 , and R c1 、R d1 and Cy 1 As described in this article.

[0017] In yet another general aspect, the present disclosure provides compounds of formula (IV):

[0018]

[0019] or a pharmaceutically acceptable salt thereof, wherein X 1 、R 2 、R 3 、R 4 、R 6 、R 7 , W, Ra1 and R Cy As described in this article.

[0020] In yet another general aspect, the present disclosure provides compounds of formula (V):

[0021]

[0022] or a pharmaceutically acceptable salt thereof, wherein X 1 、R 2 、R 3 、R 4 、R 6 、R 7 , W and R Cy .

[0023] In another general aspect, the present disclosure provides a pharmaceutical composition comprising a compound of Formula (I), Formula (II), Formula (III), Formula (IV) or Formula (V) as described herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

[0024] In yet another general aspect, the present disclosure provides a method selected from the group consisting of:

[0025] (a) treating a condition associated with telomere or telomerase dysfunction in a subject;

[0026] (b) treating an aging-related disorder in a subject;

[0027] (c) treating a preleukemic or precancerous condition in a subject;

[0028] (d) treating or preventing HBV infection in a subject;

[0029] (e) treating or preventing a neurodevelopmental disorder in a subject;

[0030] (f) treating a subject for an acquired or inherited disease or condition associated with RNA alterations;

[0031] (g) reducing PAPD5 activity in a subject;

[0032] (h) inhibiting HBsAg production or secretion in a subject;

[0033] (i) inhibiting HBV DNA production in a subject;

[0034] (j) reducing PAPD5 activity in cells;

[0035] (k) inhibiting HBsAg production or secretion in cells;

[0036] (1) inhibiting HBV DNA production in cells;

[0037] (m) regulating non-coding RNA in cells; and

[0038] (n) regulating the ex vivo expansion of stem cells,

[0039] The method comprises contacting the cell with an effective amount of a compound of Formula (I), (II), (III), (IV) or (V) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the same, or administering to a subject in need thereof a therapeutically effective amount of a compound of Formula (I), (II), (III), (IV) or (V) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the same.

[0040] In yet another general aspect, the present disclosure provides a method of expanding cells, comprising culturing the cells in the presence of an effective amount of a compound as described herein (e.g., a compound of Formula (I)-(II), (III)-(IV), or (V)-(V)), or a pharmaceutically acceptable salt thereof.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Methods and materials for use in this application are described herein; other suitable methods and materials known in the art may also be used. The materials, methods, and examples are illustrative only and are not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In the event of a conflict, the present specification (including definitions) shall prevail.

[0042] Other features and advantages of the invention will be apparent from the following detailed description, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 is a schematic diagram showing an exemplary model for TERC 3′ end maturation by PARN.

[0044] Figure 2 is a schematic diagram showing an exemplary model for the reciprocal regulation of TERC maturation by PARN and PAPD5.

[0045] Figure 3 Results of RNA oligoadenylation assays containing compounds 15A, 13A, 12A, 10A, and 1A.

[0046] Figure 4 Results of RNA oligoadenylation assays containing compounds 26A, 29A, 18A, and 27A.

[0047] Figure 5Results of RNA oligoadenylation assays containing compounds 25A, 14A, 23A, and 28A.

[0048] Figure 6 Results of RNA oligoadenylation assays containing compounds 33A, 17A, 30A, and 31A.

[0049] Figure 7 Contains images showing the results of RNA oligoadenylation assays with compounds 1 and 34A.

[0050] Figure 8 Contains images showing the results of RNA oligoadenylation assays with compounds 1 and 16A.

[0051] Figure 9 Contains images showing the results of RNA oligoadenylation assays with compounds 1 and 19A.

[0052] Figure 10 Contains images showing the results of RNA oligoadenylation assays for compounds 1, 5A, 57A, and 51A.

[0053] Figure 11 Contains images showing the results of RNA oligoadenylation assays for compounds 1, 53A, 56A, and 54A.

[0054] Figure 12 Contains images showing the results of RNA oligoadenylation assays for compounds 1, 26A, 16A, 61A, 63A, and 70A.

[0055] Figure 13 Contains images showing the results of RNA oligoadenylation assays for compounds 1, 17A, 16A, 58A, 15A, 55A, and 51A.

[0056] Figure 14 Contains images showing the results of RNA oligoadenylation assays for compounds 1, 78A, 78A-INT, and 82A.

[0057] Figure 15 Contains images showing the effects of compounds 1, 26A, 16A, 61A, 63A, 64A, 70A, 57A, 17A, 58A, 15A, 55A, and 54A on the rapid amplification of TERC cDNA ends.

[0058] Figure 16 Contains images showing the effects of compounds 1, 78A, 80A, 82A, and 85A-BP on the rapid amplification of TERC cDNA ends.

[0059] Figure 17Contains northern blot images showing the effects of compounds 1, 26A, 16A, and 61A on steady-state levels of TERC RNA.

[0060] Figure 18 Contains images of northern blots showing the effects of compounds 1, 26A, 70A, 63A, 64A, 15A, 55A, 17A, 58A, and 57A on steady-state levels of TERC RNA.

[0061] Figure 19 Contains images showing results for the effects of compounds 1, 26A, 70A, 61A, 16A, 63A, 64A, 15A, 54A, 55A, 17A, 58A, and 57A on telomere length.

[0062] Figure 20 Contains images showing results for the effects of compounds 1, 78A, 80A, 82A, 85A-BP, 79A, and 93A on telomere length. DETAILED DESCRIPTION

[0063] Telomeres are regions of repetitive nucleotide sequences at each end of chromosomes. In vertebrates, the nucleotide sequence in telomeres is TTAGGG. In humans, this TTAGGG sequence is repeated hundreds to thousands of times. Telomerase is a ribonucleoprotein that adds telomeric repeats to the 3' end of telomeres. Cells with impaired telomerase function often have limited self-renewal capacity, an abnormal state or condition characterized by an inability of cells (such as stem cells) to divide sufficiently. This defect in cells can lead to various diseases and conditions, for example.

[0064] The telomerase RNA component (TERC) serves at least two functions: (1) it encodes the template sequence used by telomerase reverse transcriptase (TERT) to add a hexanucleotide repeat sequence to telomeres, and (2) it serves as a scaffold that nucleates the multiple proteins that target telomerase to the Cajal bodies where telomeres extend.

[0065] The present disclosure provides compounds and methods for modulating TERC levels, for example, by using compounds that target TERC, or compounds that modulate the level or activity of PAP-associated domain 5 (PAPD5) and / or poly(A)-specific ribonuclease (PARN), both of which are involved in 3'-terminal maturation of TERC. Various embodiments of these compounds and methods are described herein.

[0066] Therapeutic compounds

[0067] In some embodiments, the present disclosure provides compounds of formula (I):

[0068]

[0069] or a pharmaceutically acceptable salt thereof, wherein:

[0070] X 1 Selected from N and CR 1 ;

[0071] R 1 、R 2 、R 3 、R 4 、R 5 and R 6 Each independently selected from H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)R b1 、S(O)2R b1 and S(O)2NR c1 R d1 wherein said C 1-6 Alkyl, C 2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)2R b1 and S(O)2NR c1 R d1 ;

[0072] Each Cy 1Independently selected from C 6-10 Aryl, 5-10 membered heteroaryl and 4-7 membered heterocycloalkyl, each of which is optionally substituted with 1, 2 or 3 substituents independently selected from R Cy ;

[0073] R 7 Selected from H, C 1-3 Alkyl, C(O)C 1-6 Alkyl, C(O)OR a1 、S(O)2NR c1 R d1 and phenyl, wherein the phenyl is optionally replaced by R Cy 、Halogen、CN、OR a1 SR a1 or NR c1 R d1 replace;

[0074] R 8 Selected from 4-7 membered heterocycloalkyl, C 3-10 Cycloalkyl and 5-10 membered heteroaryl, substituted by W, and optionally substituted by 1, 2 or 3 substituents independently selected from R Cy ;

[0075] W is selected from C(O)OR a2 and carboxylic acid bioisosteres;

[0076] R Cy Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a2 、C(O)R b2 、C(O)NR c2 R d2 NR c2 R d2 NR c2 C(O)R b2 NR c2 C(O)OR a2 NR c2 S(O)2R b2 、S(O)2R b2 and S(O)2NR c2 R d2 wherein said C 1-6 Alkyl, C 2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a2 、C(O)Rb2 、C(O)NR c2 R d2 、C(O)OR a2 NR c2 R d2 NR c2 C(O)R b2 NR c2 C(O)OR a2 NR c2 S(O)2R b2 、S(O)2R b2 and S(O)2NR c2 R d2 ;

[0077] or R 5 and R 8 Together with the atoms to which they are attached, they form a 5-10 membered heteroaryl ring or a 4-7 membered heterocycloalkyl ring, each of which is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from R Cy1 ;

[0078] or R 4 and R 8 Together with the atoms to which they are attached, they form a 5-10 membered heteroaryl ring or a 4-10 membered heterocycloalkyl ring, each of which is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from R Cy1 ;

[0079] R Cy1 Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a3 、C(O)R b3 、C(O)NR c3 R d3 、C(O)OR a3 NR c3 R d3 NR c3 C(O)R b3 NR c3 C(O)OR a3 NR c3 S(O)2R b3 、S(O)2R b3 and S(O)2NR c3 R d3 ; wherein said C 1-6 Alkyl, C 2-6 Alkenyl and C 2-6Each alkynyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a3 、C(O)R b3 、C(O)NR c3 R d3 、C(O)OR a3 NR c3 R d3 NR c3 C(O)R b3 NR c3 C(O)OR a3 NR c3 S(O)2R b3 、S(O)2R b3 and S(O)2NR c3 R d3 ;

[0080] Or any two R Cy1 Together with the atoms to which they are attached, they form a 5-10 membered heteroaryl ring or a 4-7 membered heterocycloalkyl ring, each of which is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from R Cy2 ;

[0081] or R 7 and R Cy1 Together with the atoms to which they are attached, they form a 5-10 membered heteroaryl ring or a 4-7 membered heterocycloalkyl ring, each of which is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from R Cy2 ;

[0082] R Cy2 Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a4 、C(O)R b4 、C(O)NR c4 R d4 、C(O)OR a4 NR c4 R d4 NR c4 C(O)R b4 NR c4 C(O)OR a4 NR c4 S(O)2R b4 、S(O)2R b4 and S(O)2NR c4 R d4 ; wherein said C 1-6 Alkyl, C2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a4 、C(O)R b4 、C(O)NR c4 R d4 、C(O)OR a4 NR c4 R d4 NR c4 C(O)R b4 NR c4 C(O)OR a4 NR c4 S(O)2R b4 、S(O)2R b4 and S(O)2NR c4 R d4 ;

[0083] R a1 、R b1 、R c1 、R d1 、R a2 、R b2 、R c2 、R d2 、R a3 、R b3 、R c3 、R d3 、R a4 、R b4 、R c4 and R d4 Each independently selected from H, C 1-6 Alkyl, C 1-4 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene and (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene and (4-10 membered heterocycloalkyl)-C 1-4 Each alkylene group is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from R g ;

[0084] Or any R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally substituted by 1, 2 or 3 substituents independently selected from R g ;

[0085] Or any R c2 and R d2 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally substituted by 1, 2 or 3 substituents independently selected from R g ;

[0086] Or any R c3 and R d3 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally substituted by 1, 2 or 3 substituents independently selected from R g ;as well as

[0087] Or any R c4 and R d4 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally substituted by 1, 2 or 3 substituents independently selected from R g ;as well as

[0088] Each R g Independently selected from OH, NO2, CN, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Halogenated alkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, cyano-C 1-3 Alkylene, HO-C 1-3 Alkylene, C 6-10 Aryl, C 6-10 Aryloxy, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, amino, C 1-6 Alkylamino, di(C 1-6 alkyl)amino, mercapto, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkylsulfonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 alkyl)carbamoyl, carboxyl, C 1-6 Alkylcarbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkylsulfonylamino, aminosulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino and di(C 1-6 alkyl)aminocarbonylamino.

[0089] In some embodiments:

[0090] X 1 Selected from N and CR 1 ;

[0091] R 1 、R 2 、R 3 、R 4 、R 5 and R 6 Each independently selected from H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)Rb1 、S(O)2R b1 and S(O)2NR c1 R d1 wherein said C 1-6 Alkyl, C 2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)2R b1 and S(O)2NR c1 R d1 ;

[0092] Each Cy 1 Independently selected from C 6-10 Aryl, 5-10 membered heteroaryl and 4-7 membered heterocycloalkyl, each of which is optionally substituted with 1, 2 or 3 substituents independently selected from R Cy ;

[0093] R 7 Selected from H, C 1-3 Alkyl, C(O)C 1-6 Alkyl, C(O)OR a1 、S(O)2NR c1 R d1 and phenyl, wherein the phenyl is optionally substituted by halogen, CN, OR a1 SR a1 or NR c1 R d1 replace;

[0094] R 8 is selected from 4-7 membered heterocycloalkyl and 5-10 membered heteroaryl, substituted by W, and optionally substituted by 1, 2 or 3 substituents independently selected from R Cy ;

[0095] W is selected from C(O)OR a2 and carboxylic acid bioisosteres;

[0096] R CySelected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a2 、C(O)R b2 、C(O)NR c2 R d2 NR c2 R d2 NR c2 C(O)R b2 NR c2 C(O)OR a2 NR c2 S(O)2R b2 、S(O)2R b2 and S(O)2NR c2 R d2 ; wherein said C 1-6 Alkyl, C 2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a2 、C(O)R b2 、C(O)NR c2 R d2 、C(O)OR a2 NR c2 R d2 NR c2 C(O)R b2 NR c2 C(O)OR a2 NR c2 S(O)2R b2 、S(O)2R b2 and S(O)2NR c2 R d2 ;

[0097] or R 5 and R 8 Together with the atoms to which they are attached, they form a 5-10 membered heteroaryl ring or a 4-7 membered heterocycloalkyl ring, each of which is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from R Cy1 ;

[0098] R Cy1 Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a3 、C(O)R b3、C(O)NR c3 R d3 、C(O)OR a3 NR c3 R d3 NR c3 C(O)R b3 NR c3 C(O)OR a3 NR c3 S(O)2R b3 、S(O)2R b3 and S(O)2NR c3 R d3 wherein said C 1-6 Alkyl, C 2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a3 、C(O)R b3 、C(O)NR c3 R d3 、C(O)OR a3 NR c3 R d3 NR c3 C(O)R b3 NR c3 C(O)OR a3 NR c3 S(O)2R b3 、S(O)2R b3 and S(O)2NR c3 R d3 ;

[0099] Or any two R Cy1 Together with the atoms to which they are attached, they form a 5-10 membered heteroaryl ring or a 4-7 membered heterocycloalkyl ring, each of which is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from R Cy2 ;

[0100] or R 7 and R Cy1 Together with the atoms to which they are attached, they form a 5-10 membered heteroaryl ring or a 4-7 membered heterocycloalkyl ring, each of which is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from R Cy2 ;

[0101] R Cy2 Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, ORa4 、C(O)R b4 、C(O)NR c4 R d4 、C(O)OR a4 NR c4 R d4 NR c4 C(O)R b4 NR c4 C(O)OR a4 NR c4 S(O)2R b4 、S(O)2R b4 and S(O)2NR c4 R d4 ; wherein said C 1-6 Alkyl, C 2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a4 、C(O)R b4 、C(O)NR c4 R d4 、C(O)OR a4 NR c4 R d4 NR c4 C(O)R b4 NR c4 C(O)OR a4 NR c4 S(O)2R b4 、S(O)2R b4 and S(O)2NR c4 R d4 ;

[0102] R a1 、R b1 、R c1 、R d1 、R a2 、R b2 、R c2 、R d2 、R a3 、R b3 、R c3 、R d3 、R a4 、R b4 、R c4 and R d4 Each independently selected from H, C 1-6 Alkyl, C 1-4 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene and (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene and (4-10 membered heterocycloalkyl)-C 1-4 Each alkylene group is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from R g ;

[0103] Or any R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally substituted by 1, 2 or 3 substituents independently selected from R g ;

[0104] Or any R c2 and R d2 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally substituted by 1, 2 or 3 substituents independently selected from R g ;

[0105] Or any R c3 and R d3 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally substituted by 1, 2 or 3 substituents independently selected from R g ;as well as

[0106] Or any R c4 and R d4 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally substituted by 1, 2 or 3 substituents independently selected from R g ;as well as

[0107] Each R gIndependently selected from OH, NO2, CN, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Halogenated alkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, cyano-C 1-3 Alkylene, HO-C 1-3 Alkylene, C 6-10 Aryl, C 6-10 Aryloxy, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, amino, C 1-6 Alkylamino, di(C 1-6 alkyl)amino, mercapto, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkylsulfonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 alkyl)carbamoyl, carboxyl, C 1-6 Alkylcarbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkylsulfonylamino, aminosulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino and di(C 1-6 alkyl)aminocarbonylamino.

[0108] In some embodiments:

[0109] R 1 、R 2 、R 3 、R 4 、R 5 and R 6 Each independently selected from H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C1-4 Haloalkyl, Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)2R b1 and S(O)2NR c1 R d1 wherein said C 1-6 Alkyl, C 2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)2R b1 and S(O)2NR c1 R d1 ;and

[0110] R 7 Selected from H and C 1-3 alkyl.

[0111] In some embodiments, X 1 It's N.

[0112] In some embodiments, X 1 It's CR 1 .

[0113] In some embodiments, R 1 、R 2 、R 3 、R 4 、R 5 and R 6 Each independently selected from H, Cy 1、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 .

[0114] In some embodiments, R 1 、R 2 、R 3 、R 4 、R 5 and R 6 At least one, at least two, or at least three of are H. In some embodiments, R 1 、R 2 、R 3 、R 4 、R 5 and R 6 At least one of them is Cy 1 In some embodiments, R 1 、R 2 、R 3 、R 4 、R 5 and R 6 In some embodiments, at least one of R 1 、R 2 、R 3 、R 4 、R 5 and R 6 In some embodiments, at least one of R 1 、R 2 、R 3 、R 4 、R 5 and R 6 At least one of them is OR a1 In some embodiments, R 1 、R 2 、R 3 、R 4 、R 5 and R 6 At least one of them is C(O)NR c1 R d1 In some embodiments, R 1 、R 2 、R 3 、R 4 、R 5 and R 6 At least one of them is C(O)OR a1 In some embodiments, R 1 、R2 、R 3 、R 4 、R 5 and R 6 At least one of them is S(O)2NR c1 R d1 .

[0115] In some embodiments:

[0116] R 1 、R 2 、R 4 and R 6 Each is H, and

[0117] R 3 and R 5 Each independently selected from Cy 1 、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 .

[0118] In some embodiments:

[0119] R 1 、R 4 and R 6 Each is H,

[0120] R 2 Selected from H, Cy 1 , OR a1 、C(O)NR c1 R d1 and halogens,

[0121] R 3 Selected from Cy 1 , OR a1 、C(O)NR c1 R d1 and halogens, and

[0122] R 5 Selected from Cy 1 、C(O)OR a1 、C(O)NR c1 R d1 、S(O)2NR c1 R d1 and CN.

[0123] In some embodiments:

[0124] R 1 、R 2、R 4 and R 6 Each is H,

[0125] R 3 Selected from Cy 1 , OR a1 、C(O)NR c1 R d1 and halogens, and

[0126] R 5 Selected from Cy 1 、C(O)OR a1 、C(O)NR c1 R d1 、S(O)2NR c1 R d1 and CN.

[0127] In some embodiments, R 3 In some embodiments, R 3 It's Cy 1 In some embodiments, R 3 is OR a1 In some embodiments, R 3 It is C(O)NR c1 R d1 In some embodiments, R 5 It's Cy 1 In some embodiments, R 5 It is C(O)OR a1 In some embodiments, R 5 It is C(O)NR c1 R d1 In some embodiments, R 5 It is S(O)2NR c1 R d1 In some embodiments, R 5 It is CN.

[0128] In some embodiments, R 3 is OR a1 , R 5 It is C(O)OR a1 In some embodiments, R 3 is OR a1 , R 5 It is C(O)NR c1 R d1 In some embodiments, R 3 It is C 1-6 Haloalkoxy, R 5 It is C(O)OR a1 In some embodiments, R 3 It is C1-6 Haloalkoxy, R 5 It is C(O)NR c1 R d1 .

[0129] In some embodiments:

[0130] R 2 Selected from H and OR a1 ;

[0131] R 3 Selected from C 1-6 Alkoxy and C 1-6 haloalkoxy; and

[0132] R 5 It is C(O)OR a1 .

[0133] In some embodiments, Cy 1 Selected from C 6-10 Aryl and 5-10 membered heteroaryl, each of which is optionally substituted with 1 or 2 substituents independently selected from R Cy .

[0134] In some embodiments, Cy 1 Selected from R Cy Substituted C 6-10 In some embodiments, Cy 1 Is optional R Cy In some embodiments, Cy 1 is selected from indolyl and isoxazolyl, each of which is optionally substituted by R Cy replace.

[0135] In some embodiments, R a1 Selected from H, C 1-6 Alkyl, C 1-4 haloalkyl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl.

[0136] In some embodiments, R a1 is H. In some embodiments, R a1 It is C 1-6 In some embodiments, R a1 It is C 1-4 In some embodiments, R a1 is a 5-10 membered heteroaryl group (e.g., an indolyl group, such as indol-5-yl or indol-4-yl). In some embodiments, R a1 is a 4-10 membered heterocycloalkyl group (eg, piperidinyl).

[0137] In some embodiments, Rc1 and R d1 Each independently selected from H and C 1-6 In some embodiments, R c1 and R d1 are H. In some embodiments, R c1 and R d1 At least one of is not H. In some embodiments, R c1 It is H and R d1 It is C 1-6 In some embodiments, R c1 and R d1 All C 1-6 alkyl.

[0138] In some embodiments, R c1 and R d1 Together with the N atom to which they are attached, they form an optionally R g In some embodiments, R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a piperazinyl or morpholinyl group, each of which is optionally substituted by R g replace.

[0139] In some embodiments, R 7 is H. In some embodiments, R 7 It is C 1-3 alkyl.

[0140] In some embodiments, R 8 Is optional R Cy In some embodiments, R 8 Is optional R Cy In some embodiments, R 8 is selected from pyridyl, imidazolyl, thiazolyl, pyrazinyl, pyrimidinyl, oxazolyl, isoxazolyl, isothiazolyl and pyrazolyl, each of which is optionally replaced by R Cy In some embodiments, R 8 In some embodiments, R 8 Not phenylthio, pyrrolidinyl or pyrrolyl.

[0141] In some embodiments:

[0142] R 1 、R 2 、R 3 、R 4 、R 5 and R 6 Each independently selected from H, Cy 1、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 ;

[0143] Cy 1 Selected from C 6-10 Aryl and 5-10 membered heteroaryl, each of which is optionally substituted with 1 or 2 substituents independently selected from R Cy ;

[0144] R a1 Selected from H, C 1-6 Alkyl, C 1-4 haloalkyl, 5-10 membered heteroaryl, and 4-10 membered heterocycloalkyl;

[0145] R c1 and R d1 Each independently selected from H and C 1-6 Alkyl; or

[0146] R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally replaced by R g replace;

[0147] R 7 is H; and

[0148] R 8 is a 4-7 membered heterocycloalkyl or a 5-10 membered heteroaryl, each of which is optionally replaced by R Cy replace.

[0149] In some embodiments:

[0150] R 1 、R 2 、R 4 and R 6 Each is H;

[0151] R 3 and R 5 Each independently selected from Cy 1 、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 ;

[0152] Cy 1 Is optional R Cysubstituted 5-10 membered heteroaryl;

[0153] R a1 Selected from H, C 1-6 Alkyl, C 1-4 haloalkyl, 5-10 membered heteroaryl, and 4-10 membered heterocycloalkyl;

[0154] R c1 and R d1 Each independently selected from H and C 1-6 Alkyl; or

[0155] R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally replaced by R g replace;

[0156] R 7 is H; and

[0157] R 8 Is optional R Cy Substituted 5-10 membered heteroaryl.

[0158] In some embodiments:

[0159] R 1 、R 2 、R 4 and R 6 Each is H,

[0160] R 3 It is C 1-6 Haloalkoxy,

[0161] R 5 It is C(O)OR a1 ,

[0162] R a1 Selected from H and C 1-6 alkyl;

[0163] R 7 is H; and

[0164] R 8 is selected from pyridyl, imidazolyl, thiazolyl, pyrazinyl, pyrimidinyl, oxazolyl, isoxazolyl, isothiazolyl and pyrazolyl, each of which is optionally replaced by R Cy replace.

[0165] In some embodiments, the compound of formula (I) has the following formula:

[0166]

[0167] or a pharmaceutically acceptable salt thereof.

[0168] In some embodiments, the compound of formula (I) has the following formula:

[0169]

[0170] or a pharmaceutically acceptable salt thereof.

[0171] In some embodiments, the compound of formula (I) has the following formula:

[0172]

[0173] or a pharmaceutically acceptable salt thereof.

[0174] In some embodiments, the compound of formula (I) has the following formula:

[0175]

[0176] or a pharmaceutically acceptable salt thereof.

[0177] In some embodiments, the compound of formula (I) has the following formula:

[0178]

[0179] or a pharmaceutically acceptable salt thereof.

[0180] In some embodiments, the compound of formula (I) has the following formula:

[0181]

[0182] or a pharmaceutically acceptable salt thereof.

[0183] In some embodiments, the compound of formula (I) has the following formula:

[0184]

[0185] or a pharmaceutically acceptable salt thereof.

[0186] In some embodiments, the compound of formula (I) has the following formula:

[0187]

[0188] or a pharmaceutically acceptable salt thereof.

[0189] In some embodiments, the compound of formula (I) has the following formula:

[0190]

[0191] or a pharmaceutically acceptable salt thereof.

[0192] In some embodiments, the compound of formula (I) has the following formula:

[0193]

[0194] or a pharmaceutically acceptable salt thereof.

[0195] In some embodiments:

[0196] R 3 and R 5 Each independently selected from Cy 1 、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 ;

[0197] Cy 1 Is optional R Cy substituted 5-10 membered heteroaryl;

[0198] R a1 Selected from H, C 1-6 Alkyl, C 1-4 haloalkyl, 5-10 membered heteroaryl, and 4-10 membered heterocycloalkyl; and

[0199] R c1 and R d1 Each independently selected from H and C 1-6 Alkyl; or

[0200] R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally replaced by R g replace.

[0201] In some embodiments:

[0202] R 3 It is C 1-6 Haloalkoxy,

[0203] R 5 It is C(O)OR a1 ,and

[0204] R a1 Selected from H and C 1-6 alkyl.

[0205] In some embodiments, R Cy Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, ORa2 、C(O)R b2 、C(O)NR c2 R d2 、C(O)OR a2 and NR c2 R d2 , wherein the C 1-6 The alkyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a2 、C(O)R b2 、C(O)NR c2 R d2 、C(O)OR a2 and NR c2 R d2 .

[0206] In some embodiments, R Cy Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 1-6 Alkoxy and C 1-6 Halogenated alkoxy.

[0207] In some embodiments, R a2 Selected from H, C 1-6 Alkyl and C 1-4 Halogenated alkyl.

[0208] In some embodiments, W is C(O)OR a2 .

[0209] In some embodiments, W is C(O)OH.

[0210] In some embodiments, W is C(O)OR a2 and R a2 It is C 1-6 alkyl.

[0211] In some embodiments, W is a carboxylic acid bioisostere.

[0212] In some embodiments, the carboxylic acid bioisostere is selected from a moiety of any of the following formulae:

[0213]

[0214] In some embodiments, the carboxylic acid bioisostere is selected from C(O)NHC 6-10 Aryl, NHC(O)C 1-3 Hydroxyalkyl, CH2CN, CH2C 6-10 Aryl, C(O)CH2CN, NHS(O)2C 6-10 Aryl, S(O)2C1-6 Alkyl, C(O)C 1-3 Alkyl, CH2C(O)NH2, OCH2C 6-10 Aryl, NHC(O)C 6-10 Aryl and NHC(O)OC 1-6 In some embodiments, the carboxylic acid bioisostere is not any of the following groups: C(O)NHC 6-10 Aryl, NHC(O)C 1-3 Hydroxyalkyl, CH2CN, CH2C 6-10 Aryl, C(O)CH2CN, NHS(O)2C 6-10 Aryl, S(O)2C 1-6 Alkyl, C(O)C 1-3 Alkyl, CH2C(O)NH2, OCH2C 6-10 Aryl, NHC(O)C 6-10 Aryl and NHC(O)OC 1-6 alkyl.

[0215] In some embodiments, the compound of formula (I) is selected from any one of the following compounds:

[0216]

[0217] or a pharmaceutically acceptable salt thereof.

[0218] In some embodiments, the compound of formula (I) is selected from any one of the following compounds:

[0219]

[0220] or a pharmaceutically acceptable salt thereof.

[0221] In some embodiments, the compound of formula (I) is selected from any one of the following compounds:

[0222]

[0223] or a pharmaceutically acceptable salt thereof.

[0224] In some embodiments, R 5 and R 8 Together with the atoms to which they are attached, they form a 5-10 membered heteroaryl ring, which is substituted by 1, 2 or 3 substituents independently selected from R Cy1 .

[0225] In some embodiments, R 5 and R 8Together with the atoms to which they are attached, they form a 4-7 membered heterocycloalkyl ring, which is substituted by 1, 2 or 3 substituents independently selected from R Cy1 .

[0226] In some embodiments, R Cy1 Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, OR a3 、C(O)R b3 、C(O)NR c3 R d3 、C(O)OR a3 and NR c3 R d3 wherein said C 1-6 The alkyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a3 、C(O)R b3 、C(O)NR c3 R d3 、C(O)OR a3 and NR c3 R d3 .

[0227] In some embodiments, R Cy1 Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy and C(O)OH.

[0228] In some embodiments, any two R Cy1 Together with the atoms to which they are attached, they form a 5-10 membered heteroaryl ring, which is substituted by 1, 2 or 3 substituents independently selected from R Cy2 .

[0229] In some embodiments, any two R Cy1 Together with the atoms to which they are attached, they form a 4-7 membered heterocycloalkyl ring, which is optionally substituted with 1, 2 or 3 substituents independently selected from R Cy2 .

[0230] In some embodiments, R 7 and R Cy1 Together with the atoms to which they are attached, they form a 5-10 membered heteroaryl ring, which is optionally substituted with 1, 2 or 3 substituents independently selected from R Cy2 .

[0231] In some embodiments, R 7 and RCy1 Together with the atoms to which they are attached, they form a 4-7 membered heterocycloalkyl ring, which is optionally substituted with 1, 2 or 3 substituents independently selected from R Cy2 .

[0232] In some embodiments, R Cy2 Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, OR a4 、C(O)NR c4 R d4 、C(O)OR a4 and NR c4 R d4 , wherein the C 1-6 The alkyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a4 、C(O)NR c4 R d4 、C(O)OR a4 and NR c4 R d4 .

[0233] In some embodiments, R Cy2 It is C(O)OR a4 In some embodiments, R a4 Selected from H, C 1-6 Alkyl and C 1-4 In some embodiments, R a4 Selected from H and C 1-6 In some embodiments, R Cy2 It is C(O)OH.

[0234] In some embodiments, R 1 、R 2 、R 3 、R 4 and R 6 Each independently selected from H, Cy 1 、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 .

[0235] In some embodiments:

[0236] R 1 、R 2 、R 4 and R 6 Each is H; and

[0237] R 3 Selected from Cy 1 、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 In some embodiments, R 3 Selected from Cy 1 , OR a1 、C(O)NR c1 R d1 In some embodiments, R 3 It is C 1-6 Halogenated alkoxy.

[0238] In some embodiments, the compound of formula (I) has the following formula:

[0239]

[0240] or a pharmaceutically acceptable salt thereof.

[0241] In some embodiments, the compound of formula (I) has the following formula:

[0242]

[0243] or a pharmaceutically acceptable salt thereof.

[0244] In some embodiments, the compound of formula (I) has the following formula:

[0245]

[0246] or a pharmaceutically acceptable salt thereof.

[0247] In some embodiments, the compound of formula (I) has the following formula:

[0248]

[0249] or a pharmaceutically acceptable salt thereof.

[0250] In some embodiments:

[0251] R 3 Selected from Cy 1 、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 ;

[0252] R Cy2 Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, OR a4 、C(O)NR c4 R d4 、C(O)OR a4 and NR c4 R d4 , wherein the C 1-6 The alkyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a4 、C(O)NR c4 R d4 、C(O)OR a4 and NR c4 R d4 ;and

[0253] R a4 Selected from H and C 1-6 alkyl.

[0254] In some embodiments:

[0255] R 3 Selected from Cy 1 , OR a1 、C(O)NR c1 R d1 and halogens;

[0256] R Cy2 It is C(O)OR a4 ;and

[0257] R a4 Selected from H and C 1-6 alkyl.

[0258] In some embodiments:

[0259] R 3 It is C 1-6 haloalkoxy;

[0260] R Cy2 It is C(O)OR a4 ;and

[0261] R a4 Selected from H and C 1-6 alkyl.

[0262] In some embodiments, the compound of formula (I) is selected from any one of the following compounds:

[0263]

[0264] or a pharmaceutically acceptable salt thereof.

[0265] In some embodiments, the compound of formula (I) is selected from any one of the following compounds:

[0266]

[0267] or a pharmaceutically acceptable salt thereof.

[0268] In some embodiments, the present disclosure provides compounds of formula (II):

[0269]

[0270] or a pharmaceutically acceptable salt thereof, wherein:

[0271] X 1 Selected from N and CR 1 ;

[0272] R 1 、R 2 、R 3 、R 4 、R 5 and R 6 Each independently selected from H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)R b1 、S(O)2R b1 and S(O)2NR c1 R d1 ; wherein said C 1-6 Alkyl, C 2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)2R b1 and S(O)2NR c1 R d1 ;

[0273] Each Cy 1 Independently selected from C 6-10 Aryl, 5-10 membered heteroaryl and 4-7 membered heterocycloalkyl, each of which is optionally substituted with 1, 2 or 3 substituents independently selected from R Cy ;

[0274] R 7 Selected from H, C 1-3 Alkyl, C(O)C 1-6 Alkyl, C(O)OR a1 、S(O)2NR c1 R d1 and phenyl, wherein the phenyl is optionally substituted by halogen, CN, OR a1 SR a1 or NR c1 R d1 replace;

[0275] W is a carboxylic acid bioisostere;

[0276] R Cy Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a2 、C(O)R b2 、C(O)NR c2 R d2 NR c2 R d2 NR c2 C(O)R b2 NR c2 C(O)OR a2 NR c2 S(O)2R b2 、S(O)2R b2 and S(O)2NR c2 R d2 wherein said C 1-6 Alkyl, C2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a2 、C(O)R b2 、C(O)NR c2 R d2 、C(O)OR a2 NR c2 R d2 NR c2 C(O)R b2 NR c2 C(O)OR a2 NR c2 S(O)2R b2 、S(O)2R b2 and S(O)2NR c2 R d2 ;

[0277] R a1 、R b1 、R c1 、R d1 、R a2 、R b2 、R c2 and R d2 Each independently selected from H, C 1-6 Alkyl, C 1-4 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene and (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene and (4-10 membered heterocycloalkyl)-C 1-4Each alkylene group is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from R g ;

[0278] Or any R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally substituted by 1, 2 or 3 substituents independently selected from R g ;

[0279] Or any R c2 and R d2 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally substituted by 1, 2 or 3 substituents independently selected from R g ;as well as

[0280] Each R g Independently selected from OH, NO2, CN, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Halogenated alkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, cyano-C 1-3 Alkylene, HO-C 1-3 Alkylene, C 6-10 Aryl, C 6-10 Aryloxy, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, amino, C 1-6 Alkylamino, di(C 1-6 alkyl)amino, mercapto, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkylsulfonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 alkyl)carbamoyl, carboxyl, C 1-6 Alkylcarbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkylsulfonylamino, aminosulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino and di(C 1-6 alkyl)aminocarbonylamino.

[0281] In some embodiments:

[0282] R 1 、R 2 、R 3 、R 4 、R 5 and R 6 Each independently selected from H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)2R b1 and S(O)2NR c1 R d1 ; wherein said C 1-6 Alkyl, C 2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)2R b1 and S(O)2NR c1 Rd1 ;and

[0283] R 7 Selected from H and C 1-3 alkyl.

[0284] In some embodiments, X 1 It's N.

[0285] In some embodiments, X 1 It's CR 1 .

[0286] In some embodiments, R 1 、R 2 、R 3 、R 4 、R 5 and R 6 Each independently selected from H, Cy 1 、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 .

[0287] In some embodiments, R 1 、R 2 、R 3 、R 4 、R 5 and R 6 At least one, at least two, or at least three of are H. In some embodiments, R 1 、R 2 、R 3 、R 4 、R 5 and R 6 At least one of them is Cy 1 In some embodiments, R 1 、R 2 、R 3 、R 4 、R 5 and R 6 In some embodiments, at least one of R 1 、R 2 、R 3 、R 4 、R 5 and R 6 In some embodiments, at least one of R 1 、R 2 、R 3 、R 4 、R5 and R 6 At least one of them is OR a1 In some embodiments, R 1 、R 2 、R 3 、R 4 、R 5 and R 6 At least one of them is C(O)NR c1 R d1 In some embodiments, R 1 、R 2 、R 3 、R 4 、R 5 and R 6 At least one of them is C(O)OR a1 In some embodiments, R 1 、R 2 、R 3 、R 4 、R 5 and R 6 At least one of them is S(O)2NR c1 R d1 .

[0288] In some embodiments:

[0289] R 1 、R 2 、R 4 and R 6 Each is H, and

[0290] R 3 and R 5 Each independently selected from Cy 1 、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 .

[0291] In some embodiments:

[0292] R 1 、R 4 and R 6 Each is H,

[0293] R 2 Selected from H, Cy 1 , OR a1 、C(O)NR c1 R d1 and halogens,

[0294] R 3 Selected from Cy 1 , OR a1 、C(O)NR c1 R d1 and halogens, and

[0295] R 5 Selected from Cy 1 、C(O)OR a1 、C(O)NR c1 R d1 、S(O)2NR c1 R d1 and CN.

[0296] In some embodiments:

[0297] R 1 、R 2 、R 4 and R 6 Each is H,

[0298] R 3 Selected from Cy 1 , OR a1 、C(O)NR c1 R d1 and halogens, and

[0299] R 5 Selected from Cy 1 、C(O)OR a1 、C(O)NR c1 R d1 、S(O)2NR c1 R d1 and CN.

[0300] In some embodiments, R 3 In some embodiments, R 3 It's Cy 1 In some embodiments, R 3 is OR a1 In some embodiments, R 3 It is C(O)NR c1 R d1 In some embodiments, R 5 It's Cy 1 In some embodiments, R 5 It is C(O)OR a1 In some embodiments, R 5 It is C(O)NR c1 R d1 In some embodiments, R 5 It is S(O)2NRc1 R d1 In some embodiments, R 5 It is CN.

[0301] In some embodiments, R 3 is OR a1 , R 5 It is C(O)OR a1 In some embodiments, R 3 is OR a1 , R 5 It is C(O)NR c1 R d1 In some embodiments, R 3 It is C 1-6 Haloalkoxy, R 5 It is C(O)OR a1 In some embodiments, R 3 It is C 1-6 Haloalkoxy, R 5 It is C(O)NR c1 R d1 .

[0302] In some embodiments:

[0303] R 2 Selected from H and OR a1 ;

[0304] R 3 Selected from C 1-6 Alkoxy and C 1-6 haloalkoxy; and

[0305] R 5 It is C(O)OR a1 .

[0306] In some embodiments, Cy 1 Selected from C 6-10 Aryl and 5-10 membered heteroaryl, each of which is optionally substituted with 1 or 2 substituents independently selected from R Cy .

[0307] In some embodiments, Cy 1 Is optional R Cy Substituted C 6-10 In some embodiments, Cy 1 Is optional R Cy In some embodiments, Cy 1 is selected from indolyl and isoxazolyl, each of which is optionally substituted by R Cy replace.

[0308] In some embodiments, Ra1 Selected from H, C 1-6 Alkyl, C 1-4 haloalkyl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl.

[0309] In some embodiments, R a1 is H. In some embodiments, R a1 It is C 1-6 In some embodiments, R a1 It is C 1-4 In some embodiments, R a1 is a 5-10 membered heteroaryl group (e.g., an indolyl group, such as indol-5-yl or indol-4-yl). In some embodiments, R a1 is a 4-10 membered heterocycloalkyl group (eg, piperidinyl).

[0310] In some embodiments, R c1 and R d1 Each independently selected from H and C 1-6 In some embodiments, R c1 and R d1 are H. In some embodiments, R c1 and R d1 At least one of is not H. In some embodiments, R c1 It is H and R d1 It is C 1-6 In some embodiments, R c1 and R d1 All C 1-6 alkyl.

[0311] In some embodiments, R c1 and R d1 Together with the N atom to which they are attached, they form an optionally R g In some embodiments, R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a piperazinyl or morpholinyl group, each of which is optionally substituted by R g replace.

[0312] In some embodiments, R 7 is H. In some embodiments, R 7 It is C 1-3 alkyl.

[0313] In some embodiments, R Cy Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, OR a2 、C(O)R b2、C(O)NR c2 R d2 、C(O)OR a2 and NR c2 R d2 , wherein the C 1-6 The alkyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a2 、C(O)R b2 、C(O)NR c2 R d2 、C(O)OR a2 and NR c2 R d2 .

[0314] In some embodiments, R Cy Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 1-6 Alkoxy and C 1-6 Halogenated alkoxy.

[0315] In some embodiments, R a2 Selected from H, C 1-6 Alkyl and C 1-4 Halogenated alkyl.

[0316] In some embodiments:

[0317] R 1 、R 2 、R 3 、R 4 、R 5 and R 6 Each independently selected from H, Cy 1 、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 ;

[0318] Cy 1 Selected from C 6-10 Aryl and 5-10 membered heteroaryl, each of which is optionally substituted with 1 or 2 substituents independently selected from R Cy ;

[0319] R a1 Selected from H, C 1-6 Alkyl, C 1-4 haloalkyl, 5-10 membered heteroaryl, and 4-10 membered heterocycloalkyl;

[0320] R c1 and R d1 Each independently selected from H and C 1-6 Alkyl; or

[0321] R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally replaced by R g replace; and

[0322] R 7 It’s H.

[0323] In some embodiments:

[0324] R 1 、R 2 、R 4 and R 6 Each is H;

[0325] R 3 and R 5 Each independently selected from Cy 1 、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 ;

[0326] Cy 1 Is optional R Cy substituted 5-10 membered heteroaryl;

[0327] R a1 Selected from H, C 1-6 Alkyl, C 1-4 haloalkyl, 5-10 membered heteroaryl, and 4-10 membered heterocycloalkyl;

[0328] R c1 and R d1 Each independently selected from H and C 1-6 Alkyl; or

[0329] R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally replaced by R g replace; and

[0330] R 7 It’s H.

[0331] In some embodiments:

[0332] R 1 、R 2、R 4 and R 6 Each is H,

[0333] R 3 It is C 1-6 Haloalkoxy,

[0334] R 5 It is C(O)OR a1 ,

[0335] R a1 Selected from H and C 1-6 alkyl; and

[0336] R 7 It’s H.

[0337] In some embodiments, W is selected from any one of the following:

[0338]

[0339]

[0340] In some embodiments, the compound of formula (II) is selected from any one of the following compounds:

[0341]

[0342] or a pharmaceutically acceptable salt thereof.

[0343] In some embodiments, the compound of formula (II) is selected from any one of the following compounds:

[0344]

[0345] or a pharmaceutically acceptable salt thereof.

[0346] In some embodiments, the present disclosure provides compounds of formula (III):

[0347]

[0348] or a pharmaceutically acceptable salt thereof, wherein:

[0349] X 1 Selected from N and CR 1 ;

[0350] R 1 、R 2 、R 3 、R 4 and R 6 Each independently selected from H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6Alkynyl, C 1-4 Haloalkyl, Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)R b1 、S(O)2R b1 and S(O)2NR c1 R d1 ; wherein said C 1-6 Alkyl, C 2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)2R b1 and S(O)2NR c1 R d1 ;

[0351] R 5 Selected from C(O)NR c1 R d1 、S(O)2NR c1 R d1 and Cy 1 ;

[0352] Each Cy 1 Independently selected from C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl and 4-7 membered heterocycloalkyl, each of which is optionally substituted with 1, 2 or 3 substituents independently selected from R Cy ;

[0353] R7 Selected from H, C 1-3 Alkyl, C(O)C 1-6 Alkyl, C(O)OR a1 、S(O)2NR c1 R d1 and phenyl, wherein the phenyl is optionally substituted by halogen, CN, OR a1 SR a1 or NR c1 R d1 replace;

[0354] W is selected from C(O)OR a2 and carboxylic acid bioisosteres;

[0355] R Cy Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-6 membered heterocycloalkyl, OR a2 、C(O)R b2 、C(O)OR a2 、C(O)NR c2 R d2 、C(O)NR c1 S(O)2R b2 NR c2 R d2 NR c2 C(O)R b2 NR c2 C(O)OR a2 NR c2 S(O)2R b2 、OC(O)R b1 、S(O)2R b2 and S(O)2NR c2 R d2 ; wherein said C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-10 Cycloalkyl and 4-6 membered heterocycloalkyl are each optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a2 、C(O)R b2 、C(O)NR c2 R d2 、C(O)OR a2 NR c2 R d2 NR c2 C(O)Rb2 NR c2 C(O)OR a2 NR c2 S(O)2R b2 、S(O)2R b2 and S(O)2NR c2 R d2 ;

[0356] R a1 、R b1 、R c1 、R d1 、R a2 、R b2 、R c2 and R d2 Each independently selected from H, C 1-6 Alkyl, C 1-4 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene and (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene and (4-10 membered heterocycloalkyl)-C 1-4 Each alkylene group is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from R g ;

[0357] Or any R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a 4-10 membered heterocycloalkyl or a 5-10 membered heteroaryl, each of which is optionally substituted with 1, 2 or 3 substituents independently selected from R g ;

[0358] Or any Rc2 and R d2 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally substituted by 1, 2 or 3 substituents independently selected from R g ;as well as

[0359] Each R g Independently selected from OH, NO2, CN, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Halogenated alkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, cyano-C 1-3 Alkylene, HO-C 1-3 Alkylene, C 6-10 Aryl, C 6-10 Aryloxy, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, amino, C 1-6 Alkylamino, di(C 1-6 alkyl)amino, mercapto, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkylsulfonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 alkyl)carbamoyl, carboxyl, C 1-6 Alkylcarbonyl, C 6-10 Aryl-C 1-6 Alkoxycarbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkylsulfonylamino, aminosulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino and di(C 1-6 alkyl)aminocarbonylamino.

[0360] In some embodiments:

[0361] Each Cy 1 Independently selected from C 6-10 Aryl, 5-10 membered heteroaryl and 4-7 membered heterocycloalkyl, each of which is optionally substituted with 1, 2 or 3 substituents independently selected from R Cy ;

[0362] R Cy Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a2 、C(O)R b2 、C(O)OR a2 、C(O)NR c2 R d2 NR c2 R d2 NR c2 C(O)R b2 NR c2 C(O)OR a2 NR c2 S(O)2R b2 、S(O)2R b2 and S(O)2NR c2 R d2 ; wherein said C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Each alkynyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a2 、C(O)R b2 、C(O)NR c2 R d2 、C(O)OR a2 NR c2 R d2 NR c2 C(O)R b2 NR c2 C(O)OR a2 NR c2 S(O)2R b2 、S(O)2R b2 and S(O)2NR c2 R d2 ;

[0363] Or any R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally substituted by 1, 2 or 3 substituents independently selected from R g;as well as

[0364] Each R g Independently selected from OH, NO2, CN, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Halogenated alkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, cyano-C 1-3 Alkylene, HO-C 1-3 Alkylene, C 6-10 Aryl, C 6-10 Aryloxy, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, amino, C 1-6 Alkylamino, di(C 1-6 alkyl)amino, mercapto, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkylsulfonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 alkyl)carbamoyl, carboxyl, C 1-6 Alkylcarbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkylsulfonylamino, aminosulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino and di(C 1-6 alkyl)aminocarbonylamino.

[0365] In some embodiments:

[0366] R 1 、R 2 、R 3 、R 4 and R 6 Each independently selected from H, C 1-6 Alkyl, C 2-6Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)2R b1 and S(O)2NR c1 R d1 ; wherein said C 1-6 Alkyl, C 2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)2R b1 and S(O)2NR c1 R d1 ;and

[0367] R 7 Selected from H and C 1-3 alkyl.

[0368] In some embodiments, X 1 It's N.

[0369] In some embodiments, X 1 It's CR 1 .

[0370] In some embodiments, R 1 、R 2 、R 3 、R 4 and R 6 Each independently selected from H, Cy1 、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 .

[0371] In some embodiments:

[0372] R 1 、R 4 and R 6 Each is H,

[0373] R 2 Selected from H, Cy 1 、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 ,and

[0374] R 3 Selected from Cy 1 、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 .

[0375] In some embodiments:

[0376] R 1 、R 4 and R 6 Each is H;

[0377] R 2 Selected from H and OR a1 ;and

[0378] R 3 Selected from Cy 1 , OR a1 and halogens.

[0379] In some embodiments, R 1 、R 2 、R 3 、R 4 and R 6 At least one, at least two, or at least three of are H. In some embodiments, R 1 、R 2 、R 3、R 4 and R 6 At least one of them is Cy 1 In some embodiments, R 1 、R 2 、R 3 、R 4 and R 6 In some embodiments, at least one of R 1 、R 2 、R 3 、R 4 and R 6 In some embodiments, at least one of R 1 、R 2 、R 3 、R 4 and R 6 At least one of them is OR a1 In some embodiments, R 1 、R 2 、R 3 、R 4 and R 6 At least one of them is C(O)NR c1 R d1 In some embodiments, R 1 、R 2 、R 3 、R 4 and R 6 At least one of them is C(O)OR a1 In some embodiments, R 1 、R 2 、R 3 、R 4 and R 6 At least one of them is S(O)2NR c1 R d1 .

[0380] In some embodiments:

[0381] R 1 、R 2 、R 4 and R 6 Each is H, and

[0382] R 3 Selected from Cy 1 、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 .

[0383] In some embodiments, R 3 Selected from Cy 1 , OR a1 、C(O)NR c1 R d1 and halogens.

[0384] In some embodiments:

[0385] R 2 Selected from H and OR a1 ;and

[0386] R 3 Selected from C 1-6 Alkoxy and C 1-6 Halogenated alkoxy.

[0387] In some embodiments, R 3 It is C 1-6 In some embodiments, R 3 In some embodiments, R 3 It's Cy 1 In some embodiments, R 3 is OR a1 In some embodiments, R 3 It is C(O)NR c1 R d1 .

[0388] In some embodiments, R 5 It's Cy 1 In some embodiments, R 5 It is C(O)NR c1 R d1 In some embodiments, R 5 It is S(O)2NR c1 R d1 .

[0389] In some embodiments, R 3 is OR a1 and R 5 It is C(O)NR c1 R d1 In some embodiments, R 3 is OR a1 and R 5 It's Cy 1 In some embodiments, R 3 is OR a1 and R 5 It is S(O)2NR c1 R d1 .

[0390] In some embodiments, R 3 It is C 1-6 Haloalkoxy and R 5 It is C(O)NR c1 R d1 In some embodiments, R 3 It is C 1-6 Haloalkoxy and R 5 It's Cy 1 In some embodiments, R 3 It is C 1-6 Haloalkoxy and R 5 It is S(O)2NR c1 R d1 .

[0391] In some embodiments, Cy 1 Selected from C 6-10 Aryl and 5-10 membered heteroaryl, each of which is optionally substituted with 1 or 2 substituents independently selected from R Cy .

[0392] In some embodiments, Cy 1 Selected from R Cy Substituted C 6-10 In some embodiments, Cy 1 Is optional R Cy In some embodiments, Cy 1 is selected from indolyl and isoxazolyl, each of which is optionally substituted by R Cy replace.

[0393] In some embodiments, R a1 Selected from H, C 1-6 Alkyl, C 1-4 haloalkyl, 5-10 membered heteroaryl and 4-10 membered heterocycloalkyl.

[0394] In some embodiments, R a1 is H. In some embodiments, R a1 It is C 1-6 In some embodiments, R a1 It is C 1-4 In some embodiments, R a1 is a 5-10 membered heteroaryl group (e.g., an indolyl group, such as indol-5-yl or indol-4-yl). In some embodiments, R a1 is a 4-10 membered heterocycloalkyl group (eg, piperidinyl).

[0395] In some embodiments, R c1 and R d1 Each independently selected from H and C 1-6In some embodiments, R c1 and R d1 are H. In some embodiments, R c1 and R d1 At least one of is not H. In some embodiments, R c1 It is H and R d1 It is C 1-6 In some embodiments, R c1 and R d1 All C 1-6 alkyl.

[0396] In some embodiments, R c1 and R d1 Together with the N atom to which they are attached, they form an optionally R g In some embodiments, R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a piperazinyl or morpholinyl group, each of which is optionally substituted by R g replace.

[0397] In some embodiments, R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a 4-10 membered heterocycloalkyl group. c1 and R d1 Together with the nitrogen atom to which they are attached, they form a 5-10 membered heteroaryl group.

[0398] In some embodiments, R 7 is H. In some embodiments, R 7 It is C 1-3 alkyl.

[0399] In some embodiments, R Cy Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, OR a2 、C(O)R b2 、C(O)NR c2 R d2 、C(O)OR a2 and NR c2 R d2 , wherein the C 1-6 The alkyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a2 、C(O)R b2 、C(O)NR c2 R d2 、C(O)OR a2 and NRc2 R d2 .

[0400] In some embodiments, R Cy Selected from halogen, CN, C 1-6 Alkyl, C 1-6 Halogenated alkyl, 5-10 membered heteroaryl, 4-6 membered heterocycloalkyl, OR a2 、C(O)OR a2 、C(O)NR c2 R d2 、C(O)NR c1 S(O)2R b2 NR c2 R d2 NR c2 C(O)R b2 、OC(O)R b1 and S(O)2R b2 ; wherein said C 1-6 The alkyl group is optionally replaced by OR a2 or NR c2 R d2 replace.

[0401] In some embodiments, R Cy Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 1-6 Alkoxy and C 1-6 Halogenated alkoxy.

[0402] In some embodiments, R a2 Selected from H, C 1-6 Alkyl and C 1-4 Halogenated alkyl.

[0403] In some embodiments, R a2 Selected from H and C 1-6 alkyl.

[0404] In some embodiments, W is C(O)OR a2 .

[0405] In some embodiments, W is selected from any one of the following:

[0406]

[0407]

[0408] In some embodiments, the compound of formula (III) is selected from any one of the following compounds:

[0409]

[0410]

[0411]

[0412] In some embodiments, the compound of formula (III) is selected from any one of the following compounds:

[0413]

[0414] or a pharmaceutically acceptable salt thereof.

[0415] In some embodiments, the compound of formula (III) is selected from any one of the following compounds:

[0416]

[0417]

[0418]

[0419] or a pharmaceutically acceptable salt thereof.

[0420] In some embodiments, the present disclosure provides compounds of formula (IV):

[0421]

[0422] or a pharmaceutically acceptable salt thereof, wherein:

[0423] X 1 Selected from N and CR 1 ;

[0424] R 1 、R 2 、R 4 and R 6 Each independently selected from H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)2Rb1 and S(O)2NR c1 R d1 ; wherein said C 1-6 Alkyl, C 2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)2R b1 and S(O)2NR c1 R d1 ;

[0425] R 3 Selected from C(O)Cy 1 、OCy 1 and Cy 1 ;

[0426] Each Cy 1 independently selected from 5-10 membered heteroaryl and 4-7 membered heterocycloalkyl, each of which is optionally substituted with 1, 2 or 3 substituents independently selected from R Cy ;

[0427] R 7 Selected from H and C 1-3 alkyl;

[0428] W is selected from C(O)OR a2 and carboxylic acid bioisosteres;

[0429] R Cy Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a2 、C(O)R b2 、C(O)OR a2 、C(O)NR c2 R d2 NR c2 R d2 NR c2C(O)R b2 NR c2 C(O)OR a2 NR c2 S(O)2R b2 、S(O)2R b2 and S(O)2NR c2 R d2 ; wherein said C 1-6 Alkyl, C 2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a2 、C(O)R b2 、C(O)NR c2 R d2 、C(O)OR a2 NR c2 R d2 NR c2 C(O)R b2 NR c2 C(O)OR a2 NR c2 S(O)2R b2 、S(O)2R b2 and S(O)2NR c2 R d2 ;

[0430] R a1 、R b1 、R c1 、R d1 、R a2 、R b2 、R c2 and R d2 Each independently selected from H, C 1-6 Alkyl, C 1-4 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene and (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene and (4-10 membered heterocycloalkyl)-C 1-4 Each alkylene group is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from R g ;

[0431] Or any R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally substituted by 1, 2 or 3 substituents independently selected from R g ;

[0432] Or any R c2 and R d2 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally substituted by 1, 2 or 3 substituents independently selected from R g ;

[0433] Each R g Independently selected from OH, NO2, CN, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Halogenated alkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, cyano-C 1-3 Alkylene, HO-C 1-3 Alkylene, C 6-10 Aryl, C 6-10 Aryloxy, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, amino, C 1-6 Alkylamino, di(C 1-6 alkyl)amino, mercapto, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkylsulfonyl, carbamoyl, C 1-6Alkylcarbamoyl, di(C 1-6 alkyl)carbamoyl, carboxyl, C 1-6 Alkylcarbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkylsulfonylamino, aminosulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino and di(C 1-6 alkyl)aminocarbonylamino.

[0434] In some embodiments, X 1 It's N.

[0435] In some embodiments, X 1 It's CR 1 .

[0436] In some embodiments, R 1 、R 2 、R 4 and R 6 Each independently selected from H, Cy 1 、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 .

[0437] In some embodiments, R 1 、R 2 、R 4 and R 6 At least one, at least two, or at least three of are H. In some embodiments, R 1 、R 2 、R 4 and R 6 At least one of them is Cy 1 In some embodiments, R 1 、R 2 、R 4 and R 6 In some embodiments, at least one of R 1 、R 2 、R 4 and R 6 In some embodiments, at least one of R1 、R 2 、R 4 and R 6 At least one of them is OR a1 In some embodiments, R 1 、R 2 、R 4 and R 6 At least one of them is C(O)NR c1 R d1 In some embodiments, R 1 、R 2 、R 4 and R 6 At least one of them is C(O)OR a1 In some embodiments, R 1 、R 2 、R 4 and R 6 At least one of them is S(O)2NR c1 R d1 In some embodiments, R 1 、R 2 、R 4 and R 6 Each is H.

[0438] In some embodiments, R 3 is C(O)Cy 1 In some embodiments, R 3 It's OCy 1 In some embodiments, R 3 It's Cy 1 .

[0439] In some embodiments, Cy 1 Is optional R Cy In some embodiments, Cy 1 Is optional R Cy Substituted indolyl.

[0440] In some embodiments, Cy 1 Is optional R Cy In some embodiments, Cy 1 selected from piperidine and piperazine, each of which is optionally replaced by R Cy replace.

[0441] In some embodiments, R a1 Selected from H, C 1-6 Alkyl, C 1-4 In some embodiments, R a1Selected from H and C 1-6 In some embodiments, R a1 is H. In some embodiments, R a1 It is C 1-6 In some embodiments, R a1 It is C 1-4 In some embodiments, R a1 is a 5-10 membered heteroaryl group (e.g., an indolyl group, such as indol-5-yl or indol-4-yl). In some embodiments, R a1 is a 4-10 membered heterocycloalkyl group (eg, piperidinyl).

[0442] In some embodiments, R c1 and R d1 Each independently selected from H and C 1-6 In some embodiments, R c1 and R d1 are H. In some embodiments, R c1 and R d1 At least one of is not H. In some embodiments, R c1 It is H and R d1 It is C 1-6 In some embodiments, R c1 and R d1 All C 1-6 alkyl.

[0443] In some embodiments, R c1 and R d1 Together with the N atom to which they are attached, they form an optionally R g In some embodiments, R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a piperazinyl or morpholinyl group, each of which is optionally substituted by R g replace.

[0444] In some embodiments, R Cy Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, OR a2 、C(O)R b2 、C(O)NR c2 R d2 、C(O)OR a2 and NR c2 R d2 , wherein the C 1-6 The alkyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a2 、C(O)Rb2 、C(O)NR c2 R d2 、C(O)OR a2 and NR c2 R d2 In some embodiments, R Cy Selected from halogen, OH, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 1-6 Alkoxy and C 1-6 In some embodiments, R Cy is OR a2 In some embodiments, R Cy It's OH.

[0445] In some embodiments, R 7 is H. In some embodiments, R 7 It is C 1-3 In some embodiments, W is C(O)OR a2 In some embodiments, R a2 Selected from H and C 1-6 In some embodiments, W is C(O)OH. In some embodiments, W is selected from any one of the following moieties:

[0446]

[0447] In some embodiments, the compound of formula (IV) is selected from any one of the following compounds:

[0448]

[0449]

[0450] or a pharmaceutically acceptable salt thereof.

[0451] In some embodiments, the present disclosure provides a compound selected from any one of the following compounds:

[0452]

[0453] or a pharmaceutically acceptable salt thereof.

[0454] In some embodiments, the present disclosure provides a compound selected from any one of the following compounds:

[0455]

[0456]

[0457] or a pharmaceutically acceptable salt thereof.

[0458] In some embodiments, the present disclosure provides compounds of Formula (V):

[0459]

[0460] or a pharmaceutically acceptable salt thereof, wherein:

[0461] X 1 Selected from N and CR 1 ;

[0462] R 1 、R 2 、R 3 、R 4 and R 6 Each independently selected from H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C(O)Cy 1 、OCy 1 、Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)2R b1 、S(O)2NR c1 R d1 ; wherein said C 1-6 Alkyl, C 2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from Cy 1 、Halogen、CN、NO2、OR a1 SR a1 、C(O)R b1 、C(O)NR c1 R d1 、C(O)OR a1 NR c1 R d1 NR c1 C(O)R b1 NR c1 S(O)2R b1 、S(O)2Rb1 and S(O)2NR c1 R d1 ;

[0463] Each Cy 1 independently selected from 5-10 membered heteroaryl and 4-7 membered heterocycloalkyl, each of which is optionally substituted with 1, 2 or 3 substituents independently selected from R Cy ;

[0464] R 7 Selected from H and C 1-3 alkyl;

[0465] or R 7 and the phenyl group together with the nitrogen atom to which they are attached form a 5-10 membered heteroaryl ring or a 4-7 membered heterocycloalkyl ring, each of which is optionally substituted with 1, 2 or 3 substituents independently selected from W and R Cy ;

[0466] W is selected from C(O)OR a2 and carboxylic acid bioisosteres;

[0467] R Cy Selected from halogen, CN, NO2, C 1-6 Alkyl, C 1-6 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a2 、C(O)R b2 、C(O)OR a2 、C(O)NR c2 R d2 NR c2 R d2 NR c2 C(O)R b2 NR c2 C(O)OR a2 NR c2 S(O)2R b2 、S(O)2R b2 and S(O)2NR c2 R d2 ; wherein said C 1-6 Alkyl, C 2-6 Alkenyl and C 2-6 Each alkynyl group is optionally substituted with 1, 2 or 3 substituents independently selected from halogen, CN, NO2, OR a2 、C(O)R b2 、C(O)NR c2 R d2 、C(O)OR a2 NR c2 Rd2 NR c2 C(O)R b2 NR c2 C(O)OR a2 NR c2 S(O)2R b2 、S(O)2R b2 and S(O)2NR c2 R d2 ;

[0468] R a1 、R b1 、R c1 、R d1 、R a2 、R b2 、R c2 and R d2 Each independently selected from H, C 1-6 Alkyl, C 1-4 Halogenated alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene and (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, wherein the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene and (4-10 membered heterocycloalkyl)-C 1-4 Each alkylene group is optionally substituted with 1, 2, 3, 4 or 5 substituents independently selected from R g ;

[0469] Or any R c1 and R d1 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally substituted by 1, 2 or 3 substituents independently selected from R g ;

[0470] Or any R c2 and R d2 Together with the nitrogen atom to which they are attached, they form a 4-7 membered heterocycloalkyl group, which is optionally substituted by 1, 2 or 3 substituents independently selected from R g ;

[0471] Each R g Independently selected from OH, NO2, CN, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Halogenated alkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, cyano-C 1-3 Alkylene, HO-C 1-3 Alkylene, C 6-10 Aryl, C 6-10 Aryloxy, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, amino, C 1-6 Alkylamino, di(C 1-6 alkyl)amino, mercapto, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkylsulfonyl, carbamoyl, C 1-6 Alkylcarbamoyl, di(C 1-6 alkyl)carbamoyl, carboxyl, C 1-6 Alkylcarbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkylsulfonylamino, aminosulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino and di(C 1-6 alkyl)aminocarbonylamino.

[0472] In some embodiments, R 1 、R 2 、R3 、R 4 and R 6 Each independently selected from H, Cy 1 、Halogen、CN、OR a1 、C(O)NR c1 R d1 、C(O)OR a1 and S(O)2NR c1 R d1 .

[0473] In some embodiments:

[0474] R 1 、R 4 and R 6 Each is H;

[0475] R 2 Selected from H and OR a1 ;and

[0476] R 3 Selected from Cy 1 and OR a1 .

[0477] In some embodiments, R a1 Selected from C 1-6 Alkyl and C 1-6 Halogenated alkyl.

[0478] In some embodiments, R 7 It’s H.

[0479] In some embodiments, W is C(O)OR a2 .

[0480] In some embodiments, R a2 Selected from H and C 1-6 alkyl.

[0481] In some embodiments, W is a carboxylic acid bioisostere selected from any one of the following moieties:

[0482] or a pharmaceutically acceptable salt thereof.

[0483] In some embodiments, the compound of formula (V) is selected from any one of the following compounds:

[0484]

[0485]

[0486] or a pharmaceutically acceptable salt thereof.

[0487] As used herein, the term "pharmaceutically acceptable salt" refers to a salt formed between an acid and a basic group of a compound, such as an amino group, or a salt formed between a base and an acidic group of a compound, such as a carboxyl group. In some embodiments, the compound is a pharmaceutically acceptable acid addition salt. In some embodiments, acids commonly used to form pharmaceutically acceptable salts of the therapeutic compounds described herein include inorganic acids such as hydrogen bisulfide, hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, and phosphoric acid, and organic acids such as p-toluenesulfonic acid, salicylic acid, tartaric acid, bitartaric acid, ascorbic acid, maleic acid, benzenesulfonic acid, fumaric acid, gluconic acid, glucuronic acid, formic acid, glutamic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, lactic acid, oxalic acid, p-bromobenzenesulfonic acid, carbonic acid, succinic acid, citric acid, benzoic acid, and acetic acid, as well as related inorganic and organic acids. Such pharmaceutically acceptable salts thus include sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, phosphates, monohydrogenphosphates, dihydrogenphosphates, metaphosphates, pyrophosphates, chlorides, bromides, iodides, acetates, propionates, decanoates, octanoates, acrylates, formates, isobutyrates, decanoates, heptanoates, propiolates, oxalates, malonates, succinates, suberates, sebacates, fumarates, maleates, butyne-1,4-dioic acid, Pharmaceutically acceptable acid addition salts include, but are not limited to, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, phthalate, terephthalate, sulfonate, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, β-hydroxybutyrate, glycolate, maleate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, mandelate and other salts. In one embodiment, pharmaceutically acceptable acid addition salts include those formed with inorganic acids such as hydrochloric acid and hydrobromic acid, especially with organic acids such as maleic acid.

[0488] In some embodiments, bases commonly used to form pharmaceutically acceptable salts of the therapeutic compounds described herein include alkali metal hydroxides including sodium, potassium, and lithium; alkaline earth metal hydroxides such as calcium and magnesium; hydroxides of other metals such as aluminum and zinc; ammonia, organic amines such as unsubstituted or hydroxy-substituted mono-, di-, or tri-alkylamines, dicyclohexylamine; tributylamine; pyridine; N-methyl, N-ethylamine; diethylamine; triethylamine; mono-, di-, or tri-(2-OH-(C1-C6)-alkylamines), such as N,N-dimethyl-N-(2-hydroxyethyl)amine or tris-(2-hydroxyethyl)amine; N-methyl-D-glucamine; morpholine; thiomorpholine; piperidine; pyrrolidine; and amino acids such as arginine, lysine, and the like.

[0489] In some embodiments, the compounds of Formula (I)-(IV), or pharmaceutically acceptable salts thereof, are substantially isolated.

[0490] Preparation method

[0491] Compounds of any formula disclosed herein, including salts thereof, can be prepared using known organic synthesis techniques and can be synthesized according to any of a variety of possible synthetic routes. Those skilled in the art will know how to select and implement suitable synthetic schemes and will appreciate that a wide range of synthetic organic reaction libraries can be potentially applied to synthesize compounds provided herein.

[0492] Suitable synthetic methods for starting materials, intermediates, and products can be determined from the literature, including reference sources such as: Advances in Heterocyclic Chemistry, Vols. 1-107 (Elsevier, 1963-2012); Journal of Heterocyclic Chemistry, Vols. 1-49 (Journal of Heterocyclic Chemistry, 1964-2012); Carreira et al. (Ed.) Science of Synthesis, Vols. 1-48 (2001-2010) and Knowledge Update KU 2010 / 1-4; 2011 / 1-4; 2012 / 1-2 (Thieme, 2001-2012); Katritzky et al. (Ed.) Comprehensive Organic Functional Group Transformations, (Pergamon) Press, 1996); Katritzky et al. (Ed.), Comprehensive Organic Functional Group Transformations II (Elsevier, 2nd ed., 2004); Katritzky et al. (Ed.), Comprehensive Heterocyclic Chemistry (Pergamon Press, 1984); Katritzky et al., Comprehensive Heterocyclic Chemistry II (Pergamon Press, 1996); Smith et al., March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 6th ed. (Wiley, 2007); Trost et al. (Ed.), Comprehensive Organic Synthesis (Pergamon Press, 1991).

[0493] The reaction for preparing the compound provided herein can be carried out in a suitable solvent that can be easily selected by those skilled in the art of organic synthesis. Suitable solvents can be substantially free from reaction with starting material (reactant), intermediate or product at the temperature at which the reaction is carried out, for example, in a temperature range from the solidification temperature of the solvent to the boiling point of the solvent. A given reaction can be carried out in a solvent or a mixture of more than one solvent. Depending on the specific reaction steps, the technician can select a suitable solvent for a specific reaction step.

[0494] The preparation of the compounds provided herein may involve the protection and deprotection of various chemical groups. Those skilled in the art can readily determine the need for protection and deprotection and the selection of appropriate protecting groups. The chemistry of protecting groups can be found in, for example, PGM Wuts and TW Greene, Protective Groups in Organic Synthesis, 4th edition, Wiley & Sons, Inc., New York (2006).

[0495] How to use

[0496] Regulation of the telomerase RNA component (TERC)

[0497] Telomerase has been a therapeutic target of interest for over two decades, based on its activity in various cancers. The telomerase RNA component (TERC) contains a box H / ACA domain at its 3′ end, a motif that is functionally separable from the template domain and dispensable for telomerase activity in vitro. In vivo, the H / ACA motif is bound by the heterotrimer of dyskeratin, NOP10, and NHP2, which stabilizes TERC, and by TCAB1, which is responsible for localizing the telomerase complex to Cajal bodies (I-Venteicher, AS et al., Human telomerase holoenzyme protein required for Cajal body localization and telomere synthesis. Science, 323, 644-8 (2009)). Disruption of any of these interactions can also impair telomere maintenance and lead to telomere diseases (Mitchell, JR, Wood, E. & Collins, K. Telomerase components are defective in the human disease dyskeratosis congenita. Nature 402, 551-5 (1999); Vulliamy, T. et al. Mutations in the telomerase component NHP2 cause the progeroid syndrome dyskeratosis congenita. Proceedings of the National Academy of Sciences of the United States of America 105, 8073-8 (2008); Walne, AJ et al. Genetic heterogeneity in autosomal recessive dyskeratosis congenita with one subtype due to mutations in the telomerase-associated protein NOP10. Human molecular genetics 16, 1619-29 (2007)). The H / ACA motif serves as a guide for pseudouridylation of other RNAs by dyskeratin (Kiss, T., Fayet-Lebaron, E. & Jady, BE box H / ACA small nuclear ribonucleoprotein. Molecular Cell 37, 597-606 (2010)).

[0498] Increasing telomerase activity may be beneficial for several degenerative and age-related conditions. Conversely, inhibiting telomerase activity has important applications in treating cancers and conditions in which hyperproliferative cells rely on telomerase for self-renewal.

[0499] Regulation of poly(A)-specific ribonuclease (PARN)

[0500] PARN is known as a 3'-5' exoribonuclease responsible for degrading the poly(A) tail of eukaryotic mRNAs, a rate-limiting step in mRNA turnover (Korner, C.G. & Wahle, E., Shortening of the poly(A) tail by a mammalian poly(A)-specific 3'-exoribonuclease. The Journal of biological chemistry 272, 10448-56 (1997)). PARN is stimulated by the presence of the m7G cap and requires minimal adenosine di- or trinucleotide substrates—in other words, oligo(A) rather than strictly poly(A). PARN is a ubiquitously expressed cap-dependent poly(A) adenylase with a canonical role in regulating global mRNA levels during development, as well as other more specific functions, including end-trimming of the Dicer-independent microRNA (miR)-451 and deadenylation of small nucleolar (sno)RNAs. Loss-of-function mutations in PARN are associated with idiopathic pulmonary fibrosis and dyskeratosis congenita. The present disclosure provides methods and agents for regulating the level or activity of human PARN. The nucleotide sequence of human PARN is NM_002582, and the amino acid sequence of PARN is O95453 (Table 1). Variants of the nucleotide sequence and amino acid sequence are also shown in Table 1.

[0501] Table 1. Accession numbers of genes, RNAs, and proteins

[0502]

[0503]

[0504] PAP-associated domain 5 (PAPD5)

[0505] PAPD5, also known as topoisomerase-related functional protein 4-2 (TRF4-2), TUT3, GLD4, and TENT4B, is one of seven members of the noncanonical poly(A) polymerase family in human cells. PAPD5 has been shown to act as a polyadenylase on aberrant pre-ribosomal RNA in vivo, in a manner similar to the degradation-mediated polyadenylation performed by the noncanonical poly(A) polymerase Trf4p in yeast. PAPD5 is also involved in the uridylation-dependent degradation of histone mRNA.

[0506] Both PARN and PAPD5 are involved in the 3' end maturation of the telomerase RNA component (TERC). Patient cells, fibroblasts, and transformed fibroblasts (I-IPS cells) in which PARN is disrupted show reduced TERC levels, which can be restored by reducing the level or activity of PAPD5. Deep sequencing of the 3' end or ends of TERC RNA revealed that PARN and PAPD5 are essential for the processing of the oligo(A) tail obtained after transcription, which targets nuclear RNA for degradation. The reduced TERC levels and increased TERC oligo(A) forms are normalized by restoring PARN or inhibiting PAPD5. The present disclosure reveals PARN and PAPD5 as important players in the regulation and biogenesis of TERC ( Figure 1 ). Figure 1 The 3′ end of the nascent TERC RNA is shown to undergo PAPD5-mediated oligoadenylation, which targets the transcript for degradation by exosomes. PARN counteracts the degradation pathway by removing the oligo(A) tail and / or trimming the genomic encoded bases (green) of the nascent TERC to produce the mature 3′ end. Mature TERC is likely protected from further oligoadenylation and exonucleolytic processing by the dyskeratin / NOP10 / NHP2 / GAR1 complex and assembled into the telomerase holoenzyme to maintain telomeres. PARN deficiency tilts the balance towards degradation, leading to reduced TERC levels and telomere dysfunction. Therefore, the present disclosure also provides compounds and methods for regulating the level or activity of human PAPD5. The nucleotide sequence of the human PAPD5 used is FR872509.1, and the amino acid sequence is CCB84642.1 (Table 1). Variants of the nucleotide sequence and amino acid sequence are also shown in Table 1. The amino acid sequence of the PAPD5 used is shown below:

[0507] PAPD5(TRF4-2)(CCB84642.1)(SEQ ID NO:1)

[0508] MYRSGERLLG SHALPAEQRD FLPLETTNNN NNHHQPGAWA RRAGSSASSP

[0509] PSASSSPHPS

[0510] AAVPAADPAD SASGSSNKRK RDNKASTYGL NYSLLQPSGG RAAGGGRADG

[0511] GGVVYSGTPW

[0512] KRRNYNQGVV GLHEEISDFY EYMSPRPEEE KMRMEVVNRI ESVIKELWPS

[0513] ADVQIFGSFK

[0514] TGLYLPTSDIDLVVFGKWEN LPLWTLEEAL RKHKVADEDS VKVLDKATVP

[0515] IIKLTDSFTE

[0516] VKVDISFNVQ NGVRAADLIK DFTKKYPVLP YLVLVLKQFL LQRDLNEVFT

[0517] GGIGSYSLFL MAVSFLQLHP REDACIPNTN YGVLLIEFFE LYGRHFNYLK

[0518] TGIRIKDGGS YVAKDEVQKN

[0519] MLDGYRPSML YIEDPLQPGN DVGRSSYGAM QVKQAFDYAY VVLSHAVSPI

[0520] AKYYPNNETE

[0521] SILGRIIRVT DEVATYRDWI SKQWGLKNRP EPSCNGNGVT LIVDTQQLDK

[0522] CNNNLSEENE

[0523] ALGKCRSKTS ESLSKHSSNS SSGPVSSSSA TQSSSSDVDS DATPCKTPKQ

[0524] LLCRPSTGNR

[0525] VGSQDVSLES SQAVGKMQST QTTNTSNSTN KSQHGSARLF RSSSKGFQGT

[0526] TQTSHGSLMT

[0527] NKQHQGKSNN QYYHGKKRKH KRDAPLSDLC R

[0528] Figure 2 Figure 2 is a diagram showing the reciprocal regulation of TERC levels by PAPD5 and PARN and the potential for therapeutic manipulation of telomerase in degenerative or malignant conditions. Figure 2As shown, PAPD5 inhibitors can inhibit PAPD5-mediated oligoadenylation, which targets nascent TERC RNA for degradation by exosomes, thereby increasing the level or activity of TERC. Conversely, because PARN counteracts the degradation pathway by removing the oligo(A) tail and / or trimming the genomic bases of nascent TERC to generate the mature 3' end, PARN inhibitors will reduce the level or activity of TERC. Furthermore, increasing the level or activity of PARN can increase the level or activity of TERC, and increasing the level or activity of PAPD5 can reduce the level or activity of TERC.

[0529] In one aspect, the present disclosure provides compounds and related methods for regulating TERC levels in cells. The cells can be, for example, primary human cells, stem cells, induced pluripotent cells, fibroblasts, etc. In some embodiments, the cells are in a subject (e.g., a human subject). Therefore, the present disclosure provides methods for regulating TERC levels in cells in vivo. In some embodiments, cells can be isolated from a sample obtained from a subject, for example, the cells can be derived from any part of the body, including but not limited to skin, blood, and bone marrow. Cells can also be cultured in vitro using commercially available cell reagents (e.g., cell culture media) using conventional methods. In some embodiments, the cells are obtained from a subject suffering from, at risk of developing, or suspected of suffering from a telomere disease. In some embodiments, the subject has no obvious symptoms.

[0530] The level or activity of TERC can be determined in various ways, such as by determining the size of telomeres in a cell, by determining the stability of TERC, by determining the amount of RNA, by measuring the activity of telomerase function and / or by measuring the oligoadenylated (oligo(A)) form of TERC. For example, TERC stability can be assessed by measuring the decay rate of TERC. For example, the oligoadenylated (oligo(A)) form of TERC can be measured using rapid amplification of cDNA ends (RACE) combined with targeted deep sequencing (e.g., at the 3′ end of TERC) to detect the oligoadenylated (oligo(A)) form of TERC. For example, the size of telomeres can be measured using flow fluorescence in situ hybridization (Flow-FISH) technology.

[0531] In some embodiments, endogenous TERC is regulated. Such methods may include, for example, altering telomerase activity, such as increasing or decreasing telomerase activity. The method may involve reducing RNA expression in a cell, such as non-coding RNA in TERC. Telomerase activity can be regulated, for example, by contacting the cell with a test compound known to regulate protein synthesis to regulate TERC levels. The method may involve post-processing activity targeting the endogenous TERC locus. These methods involve manipulating TERC, including identifying a subject with a genetic mutation (e.g., a mutation in PARN), isolating cells (e.g., fibroblasts), and treating the cells with an agent that regulates TERC levels. The method may also involve manipulating TERC, including identifying a subject with a genetic mutation (e.g., a mutation in PARN) and treating the subject with an agent that regulates TERC levels. Subjects with genetic mutations (e.g., PARN mutations) can be identified by any diagnostic means commonly known in the art for this purpose.

[0532] The present disclosure shows that TERC levels are regulated at the post-transcriptional level. Thus, in one aspect, a method of modulating the level or activity of TERC involves modulating the level or activity of PARN and PAPD5.

[0533] In some embodiments, the method involves an agent that modulates the level or activity of PARN, thereby altering the level or activity of TERC. In some cases, the agent increases the level or activity of PARN. Alternatively, the agent decreases the level or activity of PARN. In some embodiments, the method involves an agent that modulates the level or activity of PAPD5, thereby altering the level or activity of TERC. In some embodiments, the agent increases the level or activity of PAPD5. Alternatively, the agent decreases the level or activity of PAPD5 (e.g., a PAPD5 inhibitor). In some embodiments, the agent is any of the compounds described herein.

[0534] Thus, the present application provides compounds that modulate TERC levels and are therefore useful for treating a wide range of telomere diseases or conditions associated with telomerase dysfunction, such as dyskeratosis congenita, aplastic anemia, pulmonary fibrosis, idiopathic pulmonary fibrosis, blood disorders, liver diseases (e.g., chronic liver disease), and cancers, such as blood cancers and liver cancers.

[0535] In some embodiments, in order to successfully treat telomere diseases, the therapeutic agent must selectively inhibit PAPD5 without inhibiting PARN or other polynucleotide polymerases. PAPD5 inhibitors that are not selective and also inhibit other polymerases may not be useful for treating telomere diseases; that is, the fact that a compound is a PAPD5 inhibitor (e.g., a non-selective inhibitor) does not mean that it is useful in preventing and treating telomere diseases. In contrast to other polymerases, selectivity for PAPD5 is required for efficacy. In some embodiments, the compounds of the present application are selective and specific inhibitors of PAPD5 and do not inhibit PARN or other polymerases.

[0536] In some embodiments, it was surprisingly discovered that in order to successfully treat telomere diseases, the therapeutic agent must be a selective inhibitor of PAPD5. In other words, a successful therapeutic agent must inhibit PAPD5 without substantially inhibiting PARN and / or other polynucleotide polymerases. In some embodiments, a PAPD5 inhibitor that is not selective for PAPD5 and simultaneously inhibits other polymerases may not be useful for treating telomere diseases; that is, the fact that a compound is a PAPD5 inhibitor (e.g., a non-selective inhibitor) does not indicate that it is useful in preventing and treating telomere diseases. Selectivity for PAPD5 compared to other polymerases is required for efficacy. In some embodiments, the compounds of the present application are selective and specific inhibitors of PAPD5 and do not substantially inhibit PARN or other polymerases.

[0537] Telomere diseases

[0538] Telomere diseases or disorders associated with telomerase dysfunction are often associated with changes in telomere size. Many proteins and RNA components are involved in the telomere regulatory pathway, including TERC, PARN, and PAPD5 (also known as TRF4-2). Figure 1 and 2 They show how these protein or RNA components play a role in regulatory pathways and how they are associated with telomere diseases.

[0539] Among these telomere disorders is dyskeratosis congenita (DC), a rare, progressive bone marrow failure syndrome characterized by three features: reticular skin hyperpigmentation, nail dystrophy, and oral leukoplakia. Early death is often related to bone marrow failure, infection, fatal pulmonary complications, or malignancy. Short-term treatment options for patients with bone marrow failure include anabolic steroids (such as oxymetholone), granulocyte macrophage colony-stimulating factor, granulocyte colony-stimulating factor, and erythropoietin. Other treatments include hematopoietic stem cell transplantation (SCT).

[0540] Idiopathic pulmonary fibrosis is a chronic and ultimately fatal disease characterized by a progressive decline in lung function. In some appropriate cases, the following agents are used to treat idiopathic pulmonary fibrosis: nintedanib, a tyrosine kinase inhibitor that targets multiple tyrosine kinases including vascular endothelial growth factor, fibroblast growth factor, and PDGF receptors; and pirfenidone. Other treatments include lung transplantation. In some cases, lung transplantation for idiopathic pulmonary fibrosis (I-IPF) has been shown to confer a survival benefit over drug therapy.

[0541] Generally, methods of treating telomere disorders comprise administering to a subject in need or identified as being in need of such treatment a therapeutically effective amount of a compound described herein.

[0542] cancer

[0543] The present disclosure also provides compounds, compositions, and methods for treating preleukemic conditions, precancerous conditions, dysplasias, and / or cancers. Preleukemic conditions include, for example, myelodysplastic syndromes and occult leukemias. Dysplasias refer to abnormalities of development or growth and differentiation of epithelial cells, including, for example, hip dysplasia, fibrodysplasia, and renal dysplasia, myelodysplastic syndromes, and hematopoietic cell dysplasias.

[0544] Precancerous or premalignant conditions are morphological disturbances of cells that are associated with an increased risk of cancer. If left untreated, these conditions may lead to cancer. Such conditions may include dysplasia or benign neoplasia.

[0545] As used herein, the term "cancer" refers to cells with the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is intended to include all types of cancerous growths or oncogenic processes, metastatic tissues, or malignantly transformed cells, tissues, or organs, regardless of histopathological type or stage of invasiveness. As used herein, the term "tumor" refers to a cancerous cell, e.g., a cluster of cancer cells.

[0546] Many cancer cells have abnormal telomeres. Therefore, the treatment described herein (e.g., PAPD5 inhibitors) can also be used to treat cancer. Cancers that can be treated or diagnosed using the methods described herein include malignancies of various organ systems, such as those affecting the lungs, breasts, thyroids, lymph nodes, gastrointestinal tracts, and urogenital tracts, as well as adenocarcinomas including malignancies, such as most colon cancers, renal cell carcinomas, prostate cancers, and / or testicular tumors, non-small cell lung cancers, small intestinal cancers, and esophageal cancers.

[0547] In some embodiments, the methods described herein are used to treat or diagnose cancer in a subject. The term "cancer" is art-recognized and refers to a malignant tumor of epithelial or endocrine tissue, including respiratory cancer, gastrointestinal cancer, genitourinary cancer, testicular cancer, breast cancer, prostate cancer, endocrine cancer, and melanoma. In some embodiments, the cancer is renal cancer or melanoma. Exemplary cancers include those formed by tissues of the cervix, lung, prostate, breast, head and neck, colon, and ovary. The term also includes carcinosarcoma, for example, which includes malignant tumors composed of cancerous and sarcomatous tissues. "Adenocarcinoma" refers to a cancer that originates from glandular tissue or in which tumor cells form recognizable glandular structures. The term "sarcoma" is art-recognized and refers to a malignant tumor of mesenchymal origin. Cancers that can be treated using the methods described herein are cancers that have increased TERC levels, increased expression of genes such as TERC and / or TERT, or increased telomerase activity relative to normal tissue or other cancers of the same tissue.

[0548] In some embodiments, tumor cells isolated from subjects diagnosed with cancer can be used to screen for test compounds that alter TERC levels. In some embodiments, tumor cells can be used to screen for test compounds that alter the expression or activity of PARN or PAPD5. The cancer cells used in this method can be, for example, cancer stem cells. Such methods can be used to screen a library of test compounds, such as compounds that alter or modify the expression of protein or RNA of telomere-related genes (e.g., TERC, PARN, PAPD5 / PAPD5).

[0549] In some embodiments, agents that reduce TERC levels or activity (e.g., PANR inhibitors) are used to treat cancer. In some embodiments, these agents are used in combination with other cancer treatments such as chemotherapy, surgery, or radiation therapy.

[0550] aging

[0551] Telomeres shorten as human life span passes. In studies based on large populations, short or shortened telomeres are associated with many diseases. Therefore, telomeres play an important role in the aging process and may lead to various diseases. For example, the role of telomeres as contributing and interacting factors in aging, disease risk and protection is described, for example, in Blackburn, Elizabeth H., Elissa S. Epel and Jue Lin, "Human Telomere Biology: Contributing and Interacting Factors in Aging, Disease Risk and Protection," Science 350.6265 (2015): 1193-1198, which is incorporated by reference in its entirety.

[0552] Telomere attrition is also a major driver of aging-related responses. In proliferating human cells, progressive telomere erosion ultimately exposes uncapped, free double-stranded chromosome ends, triggering a permanent DNA damage response (DDR). The permanent DNA damage response has profound consequences for cellular function. For example, the damage sensor ataxia telangiectasia mutated (ATM) is recruited to uncapped telomeres, leading to stabilization of the tumor suppressor protein 53 (p53) and upregulation of the p53 transcriptional target p21. In turn, p21 prevents cyclin-dependent kinase 2 (CDK2)-mediated inactivation of RB, subsequently arresting entry into the S phase of the cell cycle. Cellular senescence contributes to a variety of age-related diseases, such as glaucoma, cataracts, diabetic pancreas, type 2 diabetes, atherosclerosis, osteoarthritis, inflammation, atherosclerosis, diabetic fat, cancer, pulmonary fibrosis, and liver fibrosis. Permanent DNA damage and age-related diseases are described, for example, in Childs, Bennett G. et al., "Cellular senescence in aging and age-related diseases: from mechanisms to therapies." Nature Medicine 21.12 (2015): 1424, which is incorporated herein by reference in its entirety.

[0553] As used herein, the term "aging" refers to the degeneration of organs and tissues over time, in part due to insufficient replication capacity in stem cells that regenerate tissues over time. Aging can be due to natural disease processes that occur over time, or those driven by intrinsic or extrinsic stresses on the cells that accelerate cell replication and repair. Such stresses include natural chemical, mechanical, and radiation exposures; biological agents, such as bacteria, viruses, fungi, and toxins; autoimmunity, drugs, chemotherapy, therapeutic radiation, cell therapy. Because telomeres are an important factor in aging and disease development, the methods described herein can be used to treat, reduce, or minimize the risk of an aging-related disorder (and / or one or more symptoms of an aging-related disorder) in a subject. The method includes the steps of identifying a subject having an aging-related disorder or at risk of having an aging-related disorder; and administering a pharmaceutical composition to the subject. In some embodiments, the pharmaceutical composition includes an agent that alters the level or activity of TERC, such as increasing the level or activity of TERC.

[0554] As used herein, the term "aging-related condition" or "age-related disease" refers to a condition associated with the aging process. Exemplary conditions include, for example, macular degeneration, diabetes (e.g., type 2 diabetes), osteoarthritis, rheumatoid arthritis, sarcopenia, cardiovascular diseases such as hypertension, atherosclerosis, coronary artery disease, ischemia / reperfusion injury, cancer, premature death, and age-related decline in cognitive function, cardiopulmonary function, muscle strength, vision, and hearing.

[0555] Aging-related conditions may also be degenerative conditions, such as neurodegenerative conditions. Degenerative conditions that can be treated or diagnosed using the methods described herein include degenerative conditions of various organ systems, such as those affecting the brain, heart, lungs, liver, muscles, bones, blood, gastrointestinal tract, and urogenital tract. In certain embodiments, degenerative conditions are those with shortened telomeres, reduced TERC levels, and / or reduced telomerase levels relative to normal tissues. In certain embodiments, degenerative conditions are neurodegenerative conditions. Exemplary neurodegenerative conditions include motor neuron disease, Creutzfeldt-Jakob disease, Machado-Joseph disease, spinocerebellar ataxia, multiple sclerosis (MS), Parkinson's disease, Alzheimer's disease, Huntington's disease, hearing and balance disorders, ataxia, epilepsy, mood disorders such as schizophrenia, bipolar disorder and depression, dementia, Pick's disease, stroke, central nervous system hypoxia, brain aging, and nerve damage such as head trauma. Recent studies have shown the relationship between shorter telomeres and Alzheimer's disease. The relationship between shortened telomere length and Alzheimer's disease is described, for example, in Zhan, Yiqiang et al., "Shortened telomere length and Alzheimer's disease—a Mendelian randomization study," JAMA Neurology 72.10 (2015): 1202-1203, which is incorporated by reference in its entirety. In some embodiments, the neurodegenerative disorder is dementia, such as Alzheimer's disease.

[0556] It has also been determined that there is a negative correlation between leukocyte telomere length and the risk of coronary heart disease. This relationship is described, for example, in Haycock, Philip C. et al., "Leukocyte telomere length and cardiovascular disease risk: a systematic review and meta-analysis." (2014): g4227; and Codd, Veryan et al., "Determination of seven sites affecting average telomere length and their association with disease." Nature genetics 45.4 (2013): 422-427; each of which is incorporated by reference in its entirety. Therefore, there is strong evidence for the causal role of telomere length variation in cardiovascular disease (CVD) or coronary artery disease (CAD). In some embodiments, the disease is cardiovascular disease (CVD) and / or coronary artery disease (CAD), and the present disclosure provides methods for treating, alleviating or minimizing the risk of these diseases. In some cases, the disease is atherosclerotic cardiovascular disease.

[0557] In addition, a meta-analysis of 5759 cases and 6518 controls showed that shortened telomere length was significantly associated with the risk of type 2 diabetes. The relationship between telomere length and type 2 diabetes is described, for example, in Zhao, Jinzhao et al., "The relationship between telomere length and type 2 diabetes: a meta-analysis." PLoS One 8.11 (2013): e79993, which is incorporated by reference in its entirety. In some embodiments, the disorder is a metabolic disorder, such as type 2 diabetes.

[0558] In some embodiments, aging cells can be used to screen for test compounds that change the expression or activity of PARN or PAPD5. The aging cells used in the method can be, for example, those with genetic damage in telomere biology genes, those isolated from elderly subjects, or those that have undergone multiple rounds of replication in the laboratory. Such methods can be used to screen a library of test compounds, such as compounds that change or alter the expression of proteins or RNA of telomere-related genes (e.g., TERC, PARN, PAPD5 / PAPD5). Exemplary methods of screening and screening techniques are described herein.

[0559] In some embodiments, agents that increase the level or activity of TERC (eg, PAPD5 / PAPD5 inhibitors) are used to treat age-related degenerative disorders due to natural or environmental causes. In some embodiments, these agents are used in combination with other treatments.

[0560] Viral infection

[0561] Hepatitis B virus (HBV) is an enveloped, partially double-stranded DNA virus. The compact 3.2 kb HBV genome consists of four overlapping open reading frames (ORFs), which encode the core, polymerase (Pol), envelope, and X proteins. The Pol ORF is the longest and contains the envelope ORF, while the X and core ORFs overlap with the Pol ORF. The HBV life cycle consists of two major events: 1) the generation of closed circular DNA (cccDNA) from relaxed circular DNA (RC DNA), and 2) reverse transcription of pregenomic RNA (pgRNA) to generate RC DNA. Prior to infecting host cells, the HBV genome exists as RC DNA within the virion. It has been determined that HBV virions can enter host cells by nonspecific binding to negatively charged proteoglycans present on the surface of human hepatocytes (Schulze, A., P. Gripon & S. Urban. Hepatology, 46 (2007). 1759-68) and by specific binding of HBV surface antigen (HBsAg) to hepatocyte sodium-taurocholate cotransporting polypeptide (NTCP) receptors (Yan, H. et al. J Virol, 87 (2013), 7977-91). Once the virion enters the cell, the viral core and the encapsulated RC DNA are transported into the nucleus by host factors via nuclear localization signals through the lmpβ / lmpa nuclear transport receptors. Within the nucleus, host DNA repair enzymes convert RC DNA into cccDNA. cccDNA serves as a template for all viral mRNAs and is therefore responsible for the persistence of HBV in infected individuals. Transcripts produced by cccDNA are divided into two categories: pregenomic RNA (pgRNA) and subgenomic RNA. Subgenomic transcripts encode three envelopes (L, M, and S) and the X protein, and pgRNA encodes Pre-Core, Core, and Pol proteins (Quasdorff, M. & U. Protzcr. J Viral Hepatitis, 1 7, (2010), 527-36). Inhibition of HBV gene expression or HBV RNA synthesis leads to inhibition of HBV viral replication and antigen production (Mao, R. et al. PLoS Pathog, 9, (2013), e1003494; Mao, R. et al. J Virol, 85, (2011), 1048-57). For example, IFN-a has been shown to inhibit HBV replication and viral HBsAg production by reducing transcription of pgRNA and subgenomic RNA from the HBV covalently closed circular DNA (cccDNA) minichromosome.(Belloni, L. et al., J Clin Invest, 122, (2012), 529-37; Mao, R. et al., J Virol, 85, (2011), 1048-57). All HBV viral mRNAs are capped and polyadenylated before being exported to the cytoplasm for translation. In the cytoplasm, assembly of new virions begins, and the nascent pgRNA is packaged with the viral Pol, allowing reverse transcription of the pgRNA into rcDNA via a single-stranded DNA intermediate to begin. The mature nucleocapsid containing the rcDNA is encapsidated with cellular lipids and viral L, M, and S proteins, and then infectious HBV particles are released by budding on intracellular membranes (Locarnini, S., Semin Liver Dis, (2005), 25 Suppl 1, 9-19). Interestingly, non-infectious particles are also produced, far exceeding the number of infectious virions. These empty, enveloped particles (L, M, and S) are called subviral particles. Importantly, because subviral particles share the same envelope proteins as infectious particles, they are hypothesized to act as bait for the host immune system and have been used in HBV vaccines. The S, M, and L envelope proteins are expressed from a single ORF containing three different start codons. All three proteins share a 226-aa sequence at their C-termini, the S-domain. M and L have additional pre-S domains, Pre-S2 and Pre-S1, respectively. However, it is the S-domain that harbors the HBsAg epitope (Lambert, C. and R. Prang, Virol. J., (2007), 4, 45).

[0562] Control of viral infection requires close surveillance by the host innate immune system, which can respond within minutes to hours after infection to influence initial viral growth and limit the development of chronic and persistent infection. Despite current treatments based on interferon (IFN) and nucleos(t)ide analogs, hepatitis B virus (HBV) infection remains a major health problem worldwide, affecting an estimated 350 million chronic carriers who are at high risk of cirrhosis and hepatocellular carcinoma.

[0563] The secretion of antiviral cytokines by hepatocytes and / or intrahepatic immune cells in response to HBV infection plays a central role in viral clearance from the infected liver.

[0564] However, chronically infected patients exhibit only a weak immune response because the virus employs various escape strategies to counteract the host cell recognition system and the subsequent antiviral response.

[0565] Numerous observations suggest that several HBV viral proteins can counteract the initial host cell response by interfering with the viral recognition signal transduction system and the subsequent antiviral activity of interferon (IFN). Among these, excessive secretion of HBV empty subviral particles (SVPs, HBsAg) may contribute to the maintenance of the immune tolerance observed in patients with chronic HBsAg infection (CHB). Continuous exposure to HBsAg and other viral antigens can lead to the loss or progressive dysfunction of HBV-specific T cells (Kondo et al., Journal of Immunology (1993), 150, 4659-4671; Kondo et al., Journal of Medical Virology (2004), 74, 425-433; Fisicaro et al., Gastroenterology (2010), 138, 682-93). In addition, HBsAg has been reported to inhibit the function of immune cells such as monocytes, dendritic cells (DCs), and natural killer (NK) cells through direct interactions (Op den Brouw et al. Immunology, (2009b), 1 26, 280-9; Woltman et al. PLoS One, (2011), 6, e15324; Shi et al. J Viral Hepat. (2012). 19, c26-33; Kondo et al. ISRN Gastroenterology, (2013), Article ID 935295).

[0566] HBsAg quantification is an important biomarker for the prognosis and treatment response of chronic hepatitis B. However, HBsAg loss and seroconversion are rarely observed in chronically infected patients, but they remain the ultimate goal of therapy. Current therapies, such as nucleoside (acid) analogs, are molecules that inhibit HBV DA synthesis but do not target the reduction of HBsAg levels. Nucleoside (acid) analogs, even after long-term treatment, have demonstrated HBsAg clearance rates comparable to those observed naturally (-1%-2%) (Janssen et al., Lancet, (2005), 365, 123-9; Marcellin et al., N. Engl. J Med., (2004), 351, 1206-17; Buster et al., Hepatology, (2007), 46, 388-94). Therefore, targeting HBsAg and HBV DNA levels in CHB patients can significantly improve immune reactivation and remission in CHB patients (Wieland, S.F. & F.V. Chisari. J Virol, (2005), 79, 9369-80; Kumar et al. J Virol, (2011), 85, 987-95; Woltman et al. PLoS One, (2011), 6, e15324; Opden Brouw et al. Immunology, (2009b), 126, 280-9).

[0567] The compounds disclosed herein are inhibitors of virion production and of the production and secretion of the surface proteins HBsAg and HBeAg. The compounds reduce effective HBV RNA production at the transcriptional or post-transcriptional level, such as as a result of accelerated viral RNA degradation in cells. Alternatively, the compounds disclosed herein inhibit the initiation of viral transcription. In summary, the compounds reduce the overall levels of HBV RNA, particularly HBsAg mRNA and viral surface proteins. HBsAg may suppress the immune response against the virus or virus-infected cells, and high levels of HBsAg are believed to be responsible for T cell depletion and removal. The appearance of anti-HBsAg antibodies after the disappearance of HBsAg leads to a sustained virological response to HBV, which is considered a hallmark of a functional cure.

[0568] In some embodiments, the compound can modulate any molecular mechanism, such as described in Zhou et al., Antiviral Research 149 (2018) 191–201, which is incorporated herein by reference in its entirety. In some embodiments, the compound can modulate any physiological or molecular mechanism, such as described in Mueller et al., Journal of Hepatology 68 (2018) 412-420, which is incorporated herein by reference in its entirety. For example, the compounds of the present disclosure induce HBV RNA degradation (degradation of HBV pgRNA and HBs AgmRNA occurs in the hepatocyte nucleus and requires de novo synthesis of host proteins).

[0569] In some embodiments, the compounds of the present disclosure can be used to inhibit HBsAg production or secretion, inhibit HBV DNA production and / or treat or prevent hepatitis B virus (HBV) infection (acute, fulminant or chronic) in a subject. In some embodiments, the subject is in need of such treatment or prevention (e.g., prior to administering the compounds of the present disclosure, the subject is diagnosed by a treating physician as having HBV infection).

[0570] Other Uses

[0571] In certain embodiments, the compounds of the present disclosure regulate RNA, and its transcription, post-transcriptional processing, stability, steady-state level or function are changed due to the acquired or genetic defects in one or more of any cell pathways. In certain embodiments, these include non-coding RNA (ncRNA) as small nucleolar RNA (snoRNA), small Cajal body RNA (scaRNA), small nuclear RNA (snRNA), ribosomal RNA (rRNA), Y RNA, transfer RNA (tRNA), microRNA (miRNA), PIWI interaction RNA (piRNA) or long non-coding RNA (lncRNA) family members. The compound can also be used to regulate the non-coding RNA (e.g., scaRNA13, scaRNA8) in the cell, and is also used to prevent and treat related diseases and conditions. In some embodiments, these also include those ncRNAs affected by any molecular mechanism, such as those described in Lardelli et al., Nature Genetics, 49(3), 2017, 457-464; and Son et al., 2018, Cell Reports 23, 888-898, including those affected by PARN or TOE1 deadenylase destruction. Thus, the compound can be used to treat or prevent genetic and other disorders, including neurodevelopmental disorders, such as pontocerebellar dysplasia. Neurodevelopmental disorders are a group of disorders in which the development of the central nervous system is disturbed. This may include developmental brain function disorders, which may manifest as neuropsychiatric problems or impaired motor function, learning, language or non-verbal communication. In some embodiments, the neurodevelopmental disorder is selected from attention deficit hyperactivity disorder (ADHD), dyslexia (dyslexia), dysgraphia (dysgraphia), dyscalculia (dyscalculia), expression disorder (verbal expression ability is significantly lower than the appropriate level for the child's mental age), comprehension disorder (comprehension ability is significantly lower than the appropriate level for the child's mental age), mixed receptive expressive language disorder, language disorder (dislalia) (inability to use developmentally appropriate speech), stuttering (interruption of normal fluency and temporal structure of language) and autism spectrum disorder (persistent difficulties in social communication). In some embodiments, the present disclosure provides a method for treating an acquired or hereditary disease or condition associated with RNA changes, the method comprising administering to a subject in need thereof a therapeutically effective amount of any one of the compounds described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable composition comprising the same. In some embodiments, RNA includes ncRNA (e.g., snRNA, scaRNA, snoRNA, rRNA, and miRNA). In some embodiments, RNA is destroyed by destroying PARN or PDE1 deadenylase. In some embodiments, acquired or hereditary diseases or conditions associated with RNA changes include neurodevelopmental disorders, such as pontocerebellar dysplasia.

[0572] Because the compounds are PAPD5 inhibitors, and because they affect TERC, telomerase, telomere maintenance, and stem cell self-renewal, the compounds can be used to modulate the ex vivo expansion of stem cells and can also be used for allograft depletion in hematopoietic or other tissues. For example, PAPD5 inhibitors can be used for the ex vivo expansion of hematopoietic stem cells as described in Fares et al., 2015, Science 345, 1590-1512 and Boitano et al., 2010 329, 1345-1348, both of which are incorporated herein by reference in their entirety.

[0573] CRISPR / Cas9 (CRISPR-associated 9)

[0574] Genome engineering and gene regulation by controlling the expression of individual genes can also be used for therapeutic purposes. CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a family of DNA sequences found in the genomes of prokaryotic organisms such as bacteria and archaea. CRISPR / Cas RNA-guided mammalian cell genome targeting and gene regulation (e.g., using modified bacterial CRISPR / Cas components) can be used to inhibit the expression and / or activity of genes such as PAPD5.

[0575] In some embodiments, catalytically silent Cas-9 mutants (null nucleases) can be linked to specific gene promoter regions and have the effect of reducing the expression of those genes. In some embodiments, Cas-9 mutants are linked to transcription factors.

[0576] In some embodiments, CRISPR / Cas9 genomic targeting can produce biallelic null mutations, thereby inhibiting the expression and activity of a gene (e.g., PAPD5). Therefore, in some embodiments, a PAPD5 inhibitor can be a vector encoding a guide RNA (gRNA) targeting PAPD5 for CRISPR / Cas9, wherein CRISPR / Cas9 produces a null mutation in PAPD5, thereby reducing the level and activity of PAPD5. In some embodiments, the PAPD5 inhibitor comprises a CRISPR / Cas9 system and a guide RNA. In some embodiments, the guide RNA can have the following sequence:

[0577] CCUCUUGUUGCUGCUGCCCG(SEQ ID NO:2);

[0578] CGGAGCGAUACAUGCCGGCC (SEQ ID NO:3); or

[0579] CCUCUUGUUGCUGCUGCCCG (SEQ ID NO:4).

[0580] CRISPR / Cas9 targeting can be used in various methods as described herein, for example, to modulate telomerase RNA components, screen for, diagnose, treat or prevent a disease or condition selected from the group consisting of disorders associated with telomere or telomerase dysfunction, disorders associated with aging, preleukemia or precancerous conditions, viral infections (e.g., HBV infection), neurodevelopmental disorders, and acquired or inherited diseases or conditions associated with RNA alterations, among others.

[0581] Diagnosis of subjects in need of treatment

[0582] The present disclosure provides methods for diagnosing a subject in need of treatment (e.g., having any of the telomere diseases described herein). For example, if the level or activity of TERC, PARN and / or PAPD5 in the subject is comparable to the level or activity of TERC, PARN and / or PAPD5 in a subject having a telomere disease and optionally the subject has one or more symptoms associated with a telomere disease (e.g., aplastic anemia, pulmonary fibrosis, cirrhosis), then the subject can be diagnosed as having a telomere disease or being at risk of developing a telomere disease.

[0583] In some embodiments, a subject can be diagnosed as not having or being at risk of developing a telomere disease if the level or activity of TERC, PARN and / or PAPD5 in the subject is comparable to the level or activity of TERC, PARN and / or PAPD5 in a control subject that does not have a telomere disease.

[0584] In some embodiments, if a mutation is present at PARN, the subject is determined to have a telomere disease or to be at risk of developing a telomere disease. The mutation can be a missense mutation, a deletion or truncation mutation, a missing set of one or more nucleotides encoding one or more amino acids, a non-coding mutation such as a promoter, enhancer, or splicing mutation, or other mutation. (See, e.g., Nagpal et al., Cell Stem Cell, 2020). The mutation can be a deletion comprising a portion of the PARN gene or the entire PARN gene. The mutation can also be a mutation at position 7 and / or position 87 of PARN, e.g., the amino acid residue at position 7 is not asparagine, and / or the amino acid residue at position 87 of PARN is not serine. For example, the mutation can be a missense variant c.19A>C, resulting in a substitution of the highly conserved amino acid p.Asn7His. In some cases, the mutation is a missense mutation c.260C>T, which encodes a substitution of the highly conserved amino acid p.Ser87Leu. In some embodiments, if there is a mutation at DKC1, the subject is determined to have a telomere disease or to be at risk of developing a telomere disease. The mutation can be a missense mutation, a deletion or truncation mutation, a omission of one or more groups of nucleotides encoding one or more amino acids, a non-coding mutation such as a promoter, enhancer or splicing mutation, or other mutation. (See, for example, Fok et al., Blood, 2019; and Nagpal et al., Cell Stem Cell, 2020). In some embodiments, if there is a mutation in any factor that regulates TERC (including NOP10, NHP2, NAF1, GAR1, TCAB1 / WRAP53, ZCCHC8, and TERC itself), the subject is determined to have a telomere disease or to be at risk of developing a telomere disease. The mutation can be a missense mutation, a deletion or truncation mutation of all or part of a gene, or an omission of one or more groups of amino acids. In some embodiments, if there is a mutation in any factor that regulates telomere biology (e.g., TERT, TINF2, ACD / TPP1, STN1, CTC1, or POT1), the subject is determined to have a telomere disease or to be at risk of developing a telomere disease. The mutation can be a missense mutation, a deletion or truncation mutation, a group or groups of nucleotides that omit one or more amino acids, a non-coding mutation such as a promoter, enhancer, or splicing mutation, or other mutation.

[0585] In some embodiments, the subject has no overt signs or symptoms of telomere disease, but the level or activity of TERC, PARN, or PAPD5 may correlate with the presence of telomere disease, and the subject has an increased risk of developing telomere disease. In some embodiments, once a person is determined to have a telomere disease or to have an increased risk of developing a telomere disease, treatment may be administered, such as with a small molecule (such as a PAPD5 inhibitor) or a nucleic acid encoded by a construct known in the art or described herein.

[0586] Suitable reference values ​​can be determined using methods known in the art, such as using standard clinical trial methods and statistical analysis. Reference values ​​can have any relevant form. In some cases, the reference includes a predetermined value of a meaningful PAPD5 protein level, for example, a control reference level representing a normal PAPD5 protein level, such as the level of an unaffected subject or a subject not at risk of developing a disease as described herein, and / or a disease reference representing a protein level related to a telomere disease-related condition, such as the level in a subject suffering from a telomere disease (e.g., pulmonary fibrosis, cirrhosis, or aplastic anemia). In another embodiment, the reference includes a predetermined value of a meaningful PARN protein level, for example, a control reference level representing a normal level of PARN protein, such as the level of an unaffected subject or a subject not at risk of developing a disease as described herein, and / or a disease reference representing a protein level related to a telomere disease-related condition, such as the level in a subject suffering from a telomere disease (e.g., pulmonary fibrosis, cirrhosis, or aplastic anemia).

[0587] The predetermined level can be a single cut-off (critical) value, such as a median or mean, or defines the level of the upper quartile or lower quartile, tertile or other boundaries of a clinical trial population that is statistically different from other segments. It can be a series of cut-off (or critical) values, such as a confidence interval. It can be determined based on a comparison group, such as where the risk of developing a disease in a determined group or the correlation of the presence of a disease is higher or lower than the risk of the disease in another defined group or the presence of several times (e.g., approximately 2 times, 4 times, 8 times, 16 times or more). For example, it can be a range, wherein subject (e.g., control subject) colony is equally (or unequally) divided into several groups, such as a low-risk group, a medium-risk group and a high-risk group, or divided into quartiles, the lowest quartile being the subject with the lowest risk and the highest quartile being the subject with the highest risk, or divided into n quartiles (i.e., n regularly spaced intervals), the lowest n quartile being the subject with the lowest risk and the highest n quartile being the subject with the highest risk.

[0588] In some embodiments, the predetermined level is the level or occurrence in the same subject, eg, at a different time point, such as an earlier time point.

[0589] A subject associated with a predetermined value is often referred to as a reference subject. For example, in some embodiments, a control reference subject does not have a condition described herein. In some embodiments, it may be desirable for the control subject to lack the PARN gene (e.g., dyskeratosis congenita), and in other embodiments, it may be desirable for the control subject to have cancer. In some cases, it may be desirable for the control subject to have high telomerase activity, and in other cases, it may be desirable for the control subject to not have significant telomerase activity.

[0590] In some embodiments, a level of TERC or PARN in a subject that is less than or equal to a reference level of TERC or PARN is indicative of a clinical state (e.g., indicative of a disorder as described herein, such as a telomere disease). In some embodiments, an activity of TERC or PARN in a subject that is greater than or equal to a reference activity level of TERC or PARN is indicative of the absence of a disease.

[0591] The predetermined value may depend on the particular subject population selected (e.g., human subjects or animal models). For example, a seemingly healthy population will have a different "normal" range of TERC levels than a population of subjects who have, may have, or are at greater risk of having a condition described herein. Thus, the predetermined value selected can take into account the category to which the subject (e.g., human subject) belongs (e.g., sex, age, health, risk, presence of other diseases). One of ordinary skill in the art can select appropriate ranges and categories using only routine experimentation. When characterizing likelihood or risk, a number of predetermined values ​​can be established.

[0592] In some embodiments, the methods described in the present disclosure relate to identifying a subject as having a telomerase dysfunction-related condition, at risk of developing a telomerase dysfunction-related condition, or suspected of having a telomerase dysfunction-related condition. The method comprises determining the level or activity of TERC, PARN, or PAPD5 in a cell of the subject; comparing the level or activity of TERC, PARN, or PAPD5 to a reference level or reference activity of TERC, PARN, or PAPD5; if the level or activity of TERC, PARN, or PAPD5 is significantly different from the reference level or activity of TERC, PARN, or PAPD5, then identifying the subject as having a telomerase dysfunction-related condition, at risk of developing a telomerase dysfunction-related condition, or suspected of having a telomerase dysfunction-related condition. In some embodiments, the reference level or activity of TERC, PARN, or PAPD5 is determined from cells obtained from a subject who does not have a telomerase dysfunction-related condition.

[0593] The level or activity of TERC, PARN or PAPD5 can be determined in various types of cells from a subject. The method may include obtaining cells from a subject, converting these cells into induced pluripotent stem cell (I-IPS) cells, and these iPS cells can be used to determine the level or activity of TERC, PARN or PAPD5. These cells can be, for example, primary human cells or tumor cells. Pluripotent stem cell (I-IPS) cells can be produced from somatic cells by methods known in the art (for example, somatic cell genes can be reprogrammed to an embryonic stem cell-like state by forced expression of genes and factors important for maintaining the defining characteristics of embryonic stem cells). In some embodiments, the method of diagnosing a subject includes analyzing a blood sample from the subject, or a hair, urine, saliva or stool sample from the subject (for example, the subject can be diagnosed in the absence of any cell culture obtained from the subject by surgery).

[0594] The subject may have a mutation in PARN, e.g., a deletion comprising a portion of the PARN gene or the entire PARN gene. For example, the mutation may be one in which the amino acid residue at position 7 of PARN is not asparagine or serine. For example, the subject may have a missense variant c.19A>C, resulting in a substitution of the highly conserved amino acid p.Asn7His. The subject may have a missense mutation c.260C>T, encoding a substitution of the highly conserved amino acid p.Ser87Leu.

[0595] Induced pluripotent stem cells

[0596] Induced pluripotent stem cells (i-IPSC or iPS) are somatic cells (e.g., derived from patient skin or other cells) that have been genetically reprogrammed to an embryonic stem cell-like state by being forced to express genes and factors important for maintaining the defining properties of embryonic stem cells. These cells can be produced by methods known in the art.

[0597] Mouse iPSCs are known to exhibit key characteristics of pluripotent stem cells, including the expression of stem cell markers, the formation of tumors with cells from all three germ layers, and the ability to contribute to many different tissues when injected into mouse embryos very early in development.

[0598] Human iPSCs also express stem cell markers and are able to produce cell characteristics of all three germ layers. iPSCs can be produced from human fibroblasts and are already a useful tool for drug development and disease modeling. Viruses are currently used to introduce reprogramming factors into adult cells (such as lentiviral vectors disclosed herein), and the process can be carefully controlled and tested in cultured isolated cells first, and then the cells are treated (for example, by contacting with a test compound) to express the markers of the change, for example, iPSCs from tumor cells can be operated to differentiate, or iPSCs from cardiomyocytes can be operated to dedifferentiate.

[0599] The iPSC manipulation strategy can be applied to any cell obtained from a subject to test whether the compound can alter the level or activity of TERC, PARN, or PAPD5. The cells are contacted with a test compound (e.g., a small molecule). In some embodiments, these iPSC cells can be used to screen for compounds that modulate TERC. In some embodiments, iPSC cells can be transformed from patient skin fibroblasts.

[0600] Cell expansion

[0601] The present disclosure provides a method for expanding a cell population by culturing one or more cells in the presence of a compound disclosed herein (e.g., a compound of formula (I), (II), (III) or (IV)). In some embodiments, cell expansion may involve contacting the cells with an effective amount of a compound of the present disclosure (e.g., a PAPD5 inhibitor of formula (I), (II), (III) or (IV)). PAPD5 inhibitors can reduce the level and activity of PAPD5, thereby increasing or maintaining the length of telomeres. Telomerase activity and telomere length maintenance are related to the ability of cells to expand. As cells divide, telomere length gradually shortens, ultimately leading to cell aging. According to the telomere theory, cell aging is irreversible. Programmed cell cycle arrest occurs in response to telomerase activity, and the total number of cell divisions cannot exceed a specific limit called the Hayflick limit. It has been determined that maintaining telomere length during cell replication is important for cell expansion (e.g., stem cell expansion). The present disclosure provides methods for promoting cell expansion, as well as methods for inhibiting, slowing or preventing cell aging.

[0602] In some embodiments, the cell is a stem cell. Stem cells can include, but are not limited to, for example, pluripotent stem cells, embryonic stem cells, hematopoietic stem cells, adipose-derived stem cells, mesenchymal stem cells, umbilical cord blood stem cells, placental-derived stem cells, stem cells derived from lost teeth, hair follicle stem cells, or neural stem cells. In some embodiments, the cell is a peripheral blood mononuclear (PBMC) cell.

[0603] The cell can be derived from a subject having a disease or condition associated with any of the disorders described herein, e.g., cancer, telomere or telomerase dysfunction, aging-related disorders, preleukemia or precancerous conditions, and neurodevelopmental disorders. The cell can be isolated and derived from, for example, a tissue such as pancreatic tissue, liver tissue, smooth muscle tissue, striated muscle tissue, myocardial tissue, bone tissue, bone marrow tissue, bone spongy tissue, cartilage tissue, liver tissue, pancreatic tissue, pancreatic duct tissue, spleen tissue, thymus tissue, lymph node tissue, thyroid tissue, epidermal tissue, dermal tissue, subcutaneous tissue, heart tissue, lung tissue, vascular tissue, endothelial tissue, blood cells, bladder tissue, kidney tissue, digestive tract tissue, esophageal tissue, stomach tissue, small intestine tissue, large intestine tissue, adipose tissue, uterine tissue, eye tissue, lung tissue, testicular tissue, ovarian tissue, prostate tissue, connective tissue, endocrine tissue, or mesenteric tissue.

[0604] Cells can be isolated from any mammalian organism, such as a human, mouse, rat, dog, or cat, by any means known to those of ordinary skill in the art. One skilled in the art can isolate embryonic or adult tissue and obtain various cells (eg, stem cells).

[0605] By using appropriate cell markers, the cell population of amplification can be further enriched. For example, stem cells can be enriched using specific stem cell markers, such as FLK-1, AC133, CD34, c-kit, CXCR-4, Oct-4, Rex-1, CD9, CD13, CD29, CD34, CD44, CD166, CD90, CD105, SH-3, SH-4, TRA-1-60, TRA-1-81, SSEA-4 and Sox-2. Those skilled in the art can enrich specific cell populations by using antibodies for any of these cell markers known in the art. In certain embodiments, the stem cells of amplification can be purified by fluorescence activated cell sorting (FACS) or magnetic activated cell sorting (MACS) based on desired stem cell markers.

[0606] Cells (e.g., stem cells) can be cultured and expanded in a suitable growth medium. Common growth media include, but are not limited to, Iscove's Modified Dulbecco's Medium (IMDM), McCoy's 5A, Dulbecco's Modified Eagle's Medium (DMEM), KnockOut TMDulbecco's modified Eagle's medium (KO-DMEM), Dulbecco's modified Eagle's medium / Nutrient Mixture F-12 (DMEM / F12), Roswell Park Memorial Institute (RPMI) medium, Minimum Essential Medium α medium (α-MEM), Nutrient Mixture F-12K medium (Kaighn's modification, F-12K), X-vivo TM 20 culture medium, Stemline TM Culture medium, StemSpan TM CC100 culture medium, StemSpan TM H2000 medium, MCDB 131 medium, Basal Media Eagle (BME), Glasgow Minimum Essential Medium (GMEM), Modified Eagle Medium (MEM), Opti-MEM I Reduced Serum Medium, Waymouth's MB 752 / 1 medium, Williams' Medium E, NCTC-109 medium, neuroblastoma medium, BGJb medium, Brinster's BMOC-3 medium, Connaught Medical Research Laboratories (CMRL) medium, CO2-independent medium, and Leibovitz's L-15 medium.

[0607] Compounds of the present disclosure (e.g., compounds of Formula (I), (II), or (III)) can be used to expand various cell populations, for example, by adding the compound to a cell culture medium in a tube or plate. The concentration of the compound can be determined by, but limited to, the time of cell expansion. For example, cells can be cultured with a high concentration of the compound for a short period of time, for example, at least or about 1 day, 2 days, 3 days, 4 days, or 5 days. In some embodiments, cells can be cultured with a low concentration of the compound for a long period of time, for example, at least or about 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, or 4 weeks.

[0608] In certain embodiments, growth factors are also added to the growth medium to expand the cells. Examples of suitable growth factors include, but are not limited to, thrombopoietin, stem cell factor, IL-1, IL-3, IL-7, flt-3 ligand, G-CSF, GM-CSF, Epo, FGF-1, FGF-2, FGF-4, FGF-20, IGF, EGF, NGF, LIF, PDGF, bone morphogenetic protein, activin A, VEGF, forskolin, and glucocorticoids. In addition, those skilled in the art can add a feeder layer to the culture medium using methods known in the art. The feeder layer may include cells, such as placental tissue or its cells.

[0609] The methods described herein can also be used to produce and amplify chimeric antigen receptor (CAR) T cells. CAR-T cell therapy involves genetic modification of the patient's autologous T cells to express CAR specific for tumor antigens, followed by ex vivo cell expansion and re-infusion into the patient's body. PBMC can be collected from the patient and cultured in the presence of a compound described herein (e.g., a compound of formula (I), (II), (III) or (IV)) with a suitable culture medium (e.g., complete culture medium containing 30U / mL interleukin 2 and anti-CD3 / CD28 beads). The cells can be expanded for about 3 to 14 days (e.g., about 3 to 7 days). Subsets of T cells can be sorted by FACS. The gating strategy for cell sorting can exclude other blood cells, including granulocytes, monocytes, natural killer cells, dendritic cells, and B cells. Primary T cells are then transduced by incubating cells with a lentiviral vector expressing CAR in the culture medium. In some embodiments, the culture medium can be supplemented with a compound as described herein. The transduced cells are then cultured for at least a few days (e.g., 3 days) and then used for CAR-T cell therapy.

[0610] In some embodiments, the present disclosure provides a method of expanding cells, comprising culturing the cells in the presence of an effective amount of a compound as described herein (e.g., a compound of Formula (I), (II), (III), or (IV)), or a pharmaceutically acceptable salt thereof.

[0611] In some embodiments, the cell is selected from the group consisting of a stem cell, a pluripotent stem cell, a hematopoietic stem cell, and an embryonic stem cell.

[0612] In some embodiments, the cells are pluripotent stem cells.

[0613] In some embodiments, the cell is a hematopoietic stem cell.

[0614] In some embodiments, the cells are embryonic stem cells.

[0615] In some embodiments, cells are collected from a subject having a disease or condition selected from the group consisting of a disorder associated with telomere or telomerase dysfunction, an aging-related disorder, a preleukemic or precancerous condition, and a neurodevelopmental disorder.

[0616] In some embodiments, the method further comprises culturing the cells in the culture medium with a feeder layer.

[0617] In some embodiments, the cells have at least one stem cell marker selected from the group consisting of FLK-1, AC133, CD34, c-kit, CXCR-4, Oct-4, Rex-1, CD9, CD13, CD29, CD34, CD44, CD166, CD90, CD105, SH-3, SH-4, TRA-1-60, TRA-1-81, SSEA-4, and Sox-2.

[0618] In some embodiments, the stem cell marker is CD34.

[0619] In some embodiments, the method further comprises enriching for stem cells by isolating CD34+ cells.

[0620] In some embodiments, the subject is a mammal.

[0621] In some embodiments, the subject is a human.

[0622] In some embodiments, the method comprises culturing the cells in a culture medium selected from the group consisting of Iscove's Modified Dulbecco's Medium (IMDM) medium, Dulbecco's Modified Eagle's Medium (DMEM), Roswell Park Memorial Institute (RPMI) medium, Minimum Essential Medium alpha medium (α-MEM), Basal Media Eagle (BME) medium, Glasgow Minimum Essential Medium (GMEM), Modified Eagle's Medium (MEM), Opti-MEM I Reduced Serum Medium, Neuroblastoma Medium, CO2-Independent Medium, and Leibovitz's L-15 Medium.

[0623] In some embodiments, the cell is a chimeric antigen receptor (CAR) T cell.

[0624] In some embodiments, the cell is a lymphocyte.

[0625] In some embodiments, the cell is a T cell, an engineered T cell, or a natural killer (NK) cell.

[0626] Pharmaceutical compositions and preparations

[0627] The application also provides a pharmaceutical composition comprising an effective amount of any compound disclosed herein or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier. The pharmaceutical composition may also include at least one of any additional therapeutic agent described herein. In certain embodiments, the application also provides a pharmaceutical composition and dosage form (e.g., in a kit) comprising any additional therapeutic agent described herein. The carrier is "acceptable" in the sense of being compatible with the other ingredients of the preparation, and in the case of a pharmaceutically acceptable carrier, the recipient is harmless in the amount used in the medicine.

[0628] Pharmaceutically acceptable carriers, adjuvants or vehicles that can be used in the pharmaceutical compositions of the present invention include ion exchangers, alumina, aluminum stearate, lecithin, serum proteins (such as human serum albumin), buffer substances (such as phosphates), glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes (such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts), colloidal silicon dioxide, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethyl cellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and lanolin.

[0629] The composition or dosage form may contain any of the compounds described herein and the therapeutic agent in the range of 0.005% to 100%, with the balance consisting of suitable pharmaceutically acceptable excipients. Contemplated compositions may contain 0.001%-100% of any of the compounds provided herein and the therapeutic agent, in one embodiment 0.1-95%, in another embodiment 75-85%, and in a further embodiment 20-80%, wherein the balance may be composed of any pharmaceutically acceptable excipient described herein or any combination of these excipients.

[0630] Route of administration and dosage form

[0631] The pharmaceutical composition of the present application includes those that are applicable to any acceptable route of administration.Acceptable route of administration includes oral, cutaneous, intracervical, intrasinus, intratracheal, intestinal, epidural, interstitial, intraperitoneal, intraarterial, intrabronchial, intracapsular, intracerebral, intracisternal, intracoronary, intradermal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intraileal, intralymphatic, intramedullary, intrameningeal, intramuscular, intranasal, intraovarian, intraperitoneal, intraprostatic, intrapulmonary, intrasinus, intraspinal, intrasynovial, intratesticular, intrathecal, intratubular, intratumoral, intrauterine, intravascular, intravenous, nose, nasogastric, oral, parenteral, transdermal, epidural, rectal, respiratory (inhalation), subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transtracheal, ureteral, urethra and vaginal.

[0632] The compositions and formulations described herein can be conveniently presented in unit dosage forms, such as tablets, capsules (e.g., hard or soft gelatin capsules), sustained-release capsules, and liposomes, and can be prepared by any method known in pharmacy. See, for example, Remington: The Science and Practice of Pharmacy, Lippincott Williams and Wilkins, Baltimore, MD (20th ed. 2000). Such preparation methods include the step of combining the ingredients, such as the molecule to be administered, with a carrier constituting one or more auxiliary ingredients. Typically, the formulation is prepared by uniformly and closely combining the active ingredient with a liquid carrier or a finely divided solid carrier, or both, and then, if necessary, shaping the product.

[0633] In some embodiments, any of the compounds and therapeutic agents disclosed herein are administered orally. The compositions of the present application suitable for oral administration may be present in discrete unit forms, such as capsules, pouches, granules, or tablets, each containing a predetermined amount (e.g., an effective amount) of an active ingredient; a powder or granule; a solution or suspension in an aqueous liquid or a non-aqueous liquid; an oil-in-water liquid emulsion; an oil-in-water liquid emulsion; encapsulated in liposomes; or as a bolus, etc. Soft gelatin capsules can be used to contain such suspensions, which can beneficially increase compound absorption rates. In the case of tablets for oral use, commonly used carriers include lactose, sucrose, glucose, mannitol, and silicic acid and starch. In such solid dosage forms, the active compound is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and / or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and acacia, c) humectants such as glycerol, d) disintegrants such as agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption promoters such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glyceryl monostearate, h) absorbents such as kaolin and bentonite, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate and mixtures thereof. For oral administration in capsule form, useful diluents include lactose and dried corn starch. When an aqueous suspension is required for oral administration, the active ingredient is mixed with an emulsifier and a suspending agent. If desired, certain sweeteners and / or flavoring agents and / or coloring agents may be added. Compositions suitable for oral administration include lozenges containing a flavoring base, typically gum arabic and acacia or tragacanth; and pastilles containing an inert base active ingredient, such as gelatin and glycerin or sucrose and gum arabic.

[0634] Compounds suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions or liquids, which may contain antioxidants, buffers, antibacterial agents and solutes to make the preparation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions, which may include suspending agents and thickening agents. The preparations may be present in unit dose or multi-dose containers, such as sealed ampoules and glass vials, and may be stored under freeze-dried (lyophilized) conditions, requiring only the addition of a sterile liquid vehicle, such as water for injection, normal saline (e.g., 0.9% normal saline) or 5% glucose solution, immediately before use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules and tablets. The injection solution may be in the form of, for example, a sterile injectable aqueous or oily suspension. The suspension may be formulated using suitable dispersants or wetting agents and suspending agents according to techniques known in the art. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenteral acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. The acceptable carrier and solvent that can be adopted are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile fixed oil is usually used as solvent or suspension medium. For this reason, any gentle fixed oil can be used, including synthetic monoglyceride or diglyceride. Fatty acids (such as oleic acid and glyceride derivatives thereof) can be used to prepare injectables, and natural pharmaceutically acceptable oils (such as olive oil or castor oil, especially their polyoxyethylated forms) are also suitable. These oil solutions or suspensions can also contain long-chain alcohol diluents or dispersants.

[0635] The pharmaceutical compositions of the present application can be used for rectal administration in the form of suppositories. These compositions can be prepared by mixing the present application with suitable non-irritating excipients of the compound, which are solid at room temperature but liquid at rectal temperature and will therefore melt in the rectum to release the drug. These materials include cocoa butter, beeswax, and polyethylene glycol.

[0636] The pharmaceutical composition of the present application can be administered by nasal aerosol or inhalation. Such compositions are prepared according to the well-known technology in the field of pharmaceutical preparations, and can be prepared in the form of saline solution using benzyl alcohol or other suitable preservatives, absorption promoters that enhance bioavailability, fluorocarbons and / or other solubilizing agents or dispersants. See, for example, U.S. Patent number 6,803,031. Other preparations and methods for intranasal administration are shown in Ilium, L., J Pharm Pharmacol, 56:3-17, 2004 and Ilium, L., Eur J Pharm Sci, 11:1-18, 2000.

[0637] Topical compositions of the present disclosure can be prepared and used in aerosol sprays, creams, emulsions, solids, liquids, dispersions, foams, oils, gels, hydrogels, lotions, mousses, ointments, powders, patches, pomades, solutions, pump sprays, sticks, towelettes, soaps or other forms commonly used in topical application and / or cosmetics and skin care formulations.Topical compositions can be in the form of emulsions.Topical application of the pharmaceutical composition of the present application is particularly useful when the desired treatment relates to an easily accessible area or organ for topical application. In certain embodiments, the topical compositions comprise a combination of any compound disclosed herein and therapeutic agent and one or more additional ingredients, carriers, excipients or diluents, including absorbents, anti-irritants, anti-acne agents, preservatives, antioxidants, colorants / pigments, emollients (moisturizers), emulsifiers, film formers / retainers, spices, wash-free exfoliants, prescription drugs, preservatives, scrubs, silicones, skin same / repairing agents, slip agents, sunscreen active agents, surfactants / washing detergents, penetration enhancers and thickeners.

[0638] The compound of the present application and therapeutic agent can be incorporated into the composition for coating an implantable medical device such as a prosthesis, artificial valve, vascular graft, stent or catheter. The general preparation of suitable coatings and coated implantable devices is known in the art and is illustrated in U.S. Patent Nos. 6,099,562, 5,886,026 and 5,304,121. Coatings are typically biocompatible polymer materials, such as hydrogel polymers, polydimethylsiloxane, polycaprolactone, polyethylene glycol, polylactic acid, ethylene vinyl acetate and mixtures thereof. Coatings can optionally be further covered with a suitable outer coating of fluorosilicone, polysaccharide, polyethylene glycol, phospholipid or a combination thereof to give the composition controlled release properties. The coating of an invasive device is included in the definition of a pharmaceutically acceptable carrier, adjuvant or vehicle, as those terms are used in this article.

[0639] According to another embodiment, the present application provides an implantable drug release device, which is impregnated with or contains a compound or therapeutic agent, or a composition comprising a compound or therapeutic agent of the present application, such that the compound or therapeutic agent is released from the device and has therapeutic activity.

[0640] Dosage and regimen

[0641] In the pharmaceutical compositions of the present application, the therapeutic compound is present in an effective amount (eg, a therapeutically effective amount).

[0642] The effective dose may vary depending on the disease being treated, the severity of the disease, the route of administration, the sex, age and general health of the subject, the use of excipients, the possibility of co-use with other treatments such as other agents, and the judgment of the attending physician.

[0643] In some embodiments, an effective amount of a therapeutic compound can range from, for example, about 0.001 mg / kg to about 500 mg / kg (e.g., about 0.001 mg / kg to about 200 mg / kg; about 0.01 mg / kg to about 200 mg / kg; about 0.01 mg / kg to about 150 mg / kg; about 0.01 mg / kg to about 100 mg / kg; about 0.01 mg / kg to about 50 mg / kg; about 0.01 mg / kg to about 10 mg / kg; about 0.01 mg / kg to about 5 mg / kg; about 0.01 mg / kg to about 1 mg / kg; about 0 about 0.1 mg / kg to about 5 mg / kg; about 0.1 mg / kg to about 2 mg / kg; about 0.1 mg / kg to about 1 mg / kg; or about 0.1 mg / kg to about 0.5 mg / kg).

[0644] In some embodiments, the effective amount of the therapeutic compound is about 0.1 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 2 mg / kg, or about 5 mg / kg.

[0645] The above dosages can be administered daily (e.g., as a single dose or as two or more divided doses, e.g., once a day, twice a day, three times a day) or non-daily (e.g., every other day, every two days, every three days, once a week, twice a week, once every two weeks, once a month). The compounds and compositions described herein can be administered to the subject in any order. The first therapeutic agent, such as a compound of any of the formulas disclosed herein, can be administered to the subject in need of treatment before or after (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 ​​hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before or after the administration of a second therapeutic agent, such as an anticancer therapy as described herein) or simultaneously. Thus, a compound of any of the formulas disclosed herein or a composition containing the compound can be administered separately, sequentially, or simultaneously with a second therapeutic agent, such as a chemotherapeutic agent as described herein. When a compound of any of the formulae disclosed herein, or a pharmaceutically acceptable salt thereof, and a second or third therapeutic agent are administered to a subject simultaneously, the therapeutic agents can be administered in a single dosage form (e.g., a tablet, capsule, or solution for injection or infusion).

[0646] Combination therapy

[0647] In some embodiments, the compounds described herein can be administered to a subject in any combination with telomere disease treatments known in the art. The combination therapy can be administered to a subject sequentially or concomitantly with a compound of any formula disclosed herein. When the combination therapy includes an alternative therapeutic agent, the therapeutic agent can be administered to a subject in any pharmaceutical composition described herein.

[0648] In some embodiments, the compounds of the present disclosure can be used in combination with therapeutic agents that can be used to treat telomere diseases (e.g., therapeutic agents that regulate the level or activity of TERC). In some embodiments, the agent that can be used to treat telomere diseases is a nucleic acid comprising a nucleotide sequence encoding PARN. The agent can also be an anti-PARN antibody or an anti-PARN antibody fragment. In some embodiments, the agent is an antisense molecule or a small interfering nucleic acid that is specific for the nucleic acid encoding PARN. In some embodiments, the agent is a nucleic acid comprising a nucleotide sequence encoding PAPD5. The agent can also be an anti-PAPD5 antibody or an anti-PAPD5 antibody fragment. In some embodiments, the agent is an antisense molecule or a small interfering nucleic acid that is specific for the nucleic acid encoding PAPD5. The antisense molecules described herein can be oligonucleotides. In some cases, the agent binds to PARN or PAPD5.

[0649] In certain embodiments, the therapeutic agent that can be used for treating telomere diseases is selected from adenosine analogs, aminoglycosides and purine nucleotides. In some cases, aminoglycosides can be members of the neomycin and kanamycin families. Aminoglycosides can be, for example, kanamycin B sulfate, abramycin sulfate, spectinomycin dihydrochloride pentahydrate, ribosomycin sulfate, sisomicin sulfate, amikacin disulfide, dihydrostreptomycin sesquisulfate, hygromycin B, netilmicin sulfate, paromomycin sulfate, kasugamycin, neomycin, gentamicin, tobramycin sulfate, streptomycin sulfate or neomycin B or its derivatives.

[0650] In some embodiments, therapeutic agents useful for treating telomere diseases are nucleoside analogs such as adenosine analogs, 8-chloroadenosine (8-Cl-Ado) and 8-aminoadenosine (8-amino-Ado) or their triphosphate derivatives, synthetic nucleoside analogs with fluoropyranosyl sugar moieties, benzoyl-modified cytosine or adenine, adenosine- and cytosine-based glucopyranosyl nucleoside analogs, or glucopyranosyl analogs with uracil, 5-fluorouracil or thymine, and the like.

[0651] Adenosine analogs, aminoglycosides, and purine nucleotides are known in the art and are described, for example, in Kim, Kyumin, et al. "Exosomal cofactors link transcription termination to RNA processing by directing terminated transcripts to appropriate exonucleases in nuclear exosomes." Journal of Biological Chemistry (2016): jbc-M116; Chen, Lisa S, et al. "Chain termination and inhibition of mammalian poly(A) polymerase by modified ATP analogs." Biochemical pharmacology 79.5 (2010): 669-677; Ren, Yan-Guo, et al. "Aminoglycosides inhibit Klenow DNA polymerase and poly(A)-specific ribonuclease." Rna 8.11 (2002): 1393-1400; Thuresson, Ann-Charlotte, Leif A. Kirsebom, and Anders Virtanen. “Aminoglycosides inhibit poly(A) polymerization.” Biochimie 89.10 (2007): 1221-1227; AA Balatsos, N et al. “Regulation of poly(A)-specific ribonuclease (PARN): current knowledge and perspectives.” Current medicinal chemistry 19.28 (2012): 4838-4849; Balatsos, Nikolaos AA, Dimitrios Anastasakis and Constantinos Stathopoulos. “Purine nucleotides inhibit human poly(A)-specific ribonuclease (PARN): kinetic analysis.” Journal of enzyme inhibition and medicinal chemistry 24.2 (2009): 516-523; Balatsos, Nikolaos et al. “Regulation of poly(A)-specific ribonuclease (PARN): current knowledge and perspectives.” Current medicinal chemistry 19.28 (2012): 4838-4849; Balatsos, Nikolaos AA, Dimitrios Anastasakis and Constantinos Stathopoulos. “Purine nucleotides inhibit human poly(A)-specific ribonuclease (PARN): kinetic analysis.” Journal of enzyme inhibition and medicinal chemistry 24.2 (2009): 516-523; AA, et al. "Synthetic fluoropyranose nucleosides competitively inhibit human poly(A)-specific ribonuclease (PARN)." Biochemistry 48.26 (2009): 6044-6051; and Balatsos, Nikolaos, et al. "Kinetic and in silico analysis of the slow binding inhibition of human poly(A)-specific ribonuclease (PARN) by novel nucleoside analogs." Biochimie 94.1 (2012): 214-221; each of which is incorporated herein by reference in its entirety.A number of therapeutic agents that can modulate the level or activity of PARN and / or PAPD5 are described, for example, in WO 2017 / 066796, which is incorporated herein by reference in its entirety.

[0652] In some embodiments, the compounds of the present disclosure are used in combination with anticancer therapies. In some embodiments, the anticancer therapies are selected from the group consisting of: surgery, radiotherapy, chemotherapy, gene therapy, DNA therapy, viral therapy, RNA therapy, adjuvant therapy, and immunotherapy. In some embodiments, the anticancer therapies are selected from the group consisting of: platinum agents, mitomycin C, poly (ADP-ribose) polymerase (PARP) inhibitors, radioisotopes, vinca alkaloids, antitumor alkylating agents, monoclonal antibodies, and antimetabolites. In some embodiments, the anticancer therapy is an ataxia telangiectasia mutated (ATM) kinase inhibitor. Suitable examples of platinum agents include cisplatin, carboplatin, oxaliplatin, satraplatin, picoplatin, nedaplatin, triplatin, and lipoplatin. Suitable examples of cytotoxic radioisotopes include 67 Cu, 67 Ga, 90 Y. 131 I. 177 Lu, 186 Re、 188 Re, α-particle emitters, 211 At 213 Bi, 225 Ac, Auger electron emitter, 125 I. 212 Pb and 111 Suitable examples of antitumor alkylating agents include mechlorethamine, cyclophosphamide, mechlorethamine or nitrogen mustard (HN2), uramustine or uracil mustard, melphalan, chlorambucil, ifosfamide, bendamustine, nitrosoureas, carmustine, lomustine, streptozotocin, alkyl sulfonates, busulfan, thiotepa, procarbazine, hexamethylmelamine, triazene, dacarbazine, mitozoloamide, and temozolomide. Suitable examples of anti-cancer monoclonal antibodies include necituzumab, denutoximab, nivolumab, blinatumomab, pembrolizumab, ramucirumab, atezolizumab, trastuzumab-emtansine conjugate, pertuzumab, bevacizumab, ipilimumab, ofatumumab, catumaxomab, bevacizumab, cetuximab, tositumomab-I 131Suitable examples of vinca alkaloids include vinblastine, vincristine, vindesine, desoxyvincaminol, vincaminol, vinblastine, vinblastine, vinbutine, and vinpocetine. Suitable examples of antimetabolites include fluorouracil, cladribine, capecitabine, mercaptopurine, pemetrexed, fludarabine, gemcitabine, hydroxyurea, methotrexate, nelarabine, clofarabine, cytarabine, decitabine, pralatrexate, floxuridine, and thioguanine.

[0653] Reagent test kit

[0654] The present disclosure also includes pharmaceutical kits that can be used, for example, to treat the disorders, diseases, and conditions mentioned herein, comprising one or more containers containing a pharmaceutical composition comprising a therapeutically effective amount of a compound of the present disclosure. If desired, such kits may further include one or more of the various conventional pharmaceutical kit components, such as, for example, a container with one or more pharmaceutically acceptable carriers, additional containers, and the like. The kit may also include instructions as an insert or as a label indicating the quantity of the components to be administered, guidelines for administration, and / or guidelines for mixing the components. The kit may optionally include guidelines for performing tests to determine whether a subject needs to be treated with a compound of any one of Formulas (I)-(IV) described herein and / or any reagents and devices for performing such tests. The kit may also optionally include additional therapeutic agents (e.g., nucleic acids comprising a nucleotide sequence encoding PARN or PAPD5).

[0655] definition

[0656] As used herein, the term "about" means "approximately" (eg, plus or minus about 10% of the indicated value).

[0657] At various places in this specification, substituents of the compounds of the present disclosure are disclosed in groups or ranges. It is specifically intended that the invention encompass each and every individual subcombination of the members of such groups and ranges. For example, the term "C1-6 alkyl" is specifically intended to disclose individually methyl, ethyl, C3 alkyl, C4 alkyl, C5 alkyl, and C6 alkyl.

[0658] Various aryl, heteroaryl, cycloalkyl, and heterocycloalkyl rings are described in various places throughout this specification. Unless otherwise indicated, these rings may be attached to the remainder of the molecule at any ring member where valence permits. For example, the term "pyridine ring" or "pyridyl" may refer to a pyridin-2-yl, pyridin-3-yl, or pyridin-4-yl ring.

[0659] It should also be understood that certain features of the invention described in the context of separate embodiments for clarity may also be provided in combination in a single embodiment. Conversely, various features of the invention described in the context of a single embodiment for brevity may also be provided individually or in any suitable subcombination.

[0660] The term "aromatic" refers to a carbocyclic or heterocyclic ring having one or more polyunsaturated rings having aromatic character (ie, having (4n+2) delocalized π (pi) electrons, where n is an integer).

[0661] The term "n-membered," where n is an integer, generally describes the number of ring atoms in a moiety having n as the number of ring atoms. For example, piperidinyl is an example of a 6-membered heterocycloalkyl ring, pyrazolyl is an example of a 5-membered heteroaryl ring, pyridyl is an example of a 6-membered heteroaryl ring, and 1,2,3,4-tetrahydronaphthalene is an example of a 10-membered cycloalkyl.

[0662] As used herein, the phrase "optionally substituted" refers to unsubstituted or substituted. Substituents are independently selected, and substitution can occur at any chemically accessible position. As used herein, the term "substituted" refers to the removal of a hydrogen atom and its replacement by a substituent. A single divalent substituent, such as oxo, can replace two hydrogen atoms. It will be understood that substitution on a given atom is limited by valence.

[0663] Throughout this definition, the term “C n-m " indicates a range including endpoints, where n and m are integers and represent the number of carbons. Examples include C 1-4 、C 1-6 wait.

[0664] As used herein, the term "C n-m "Alkyl" refers to a saturated hydrocarbon radical having n to m carbons, which may be linear or branched. Examples of alkyl moieties include, but are not limited to, chemical groups such as methyl, butyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, sec-butyl; higher homologs such as 2-methyl-1-butyl, n-pentyl, 3-pentyl, n-hexyl, 1,2,2-trimethylpropyl, and the like. In some embodiments, the alkyl group contains 1 to 6 carbon atoms, 1 to 4 carbon atoms, 1 to 3 carbon atoms, or 1 to 2 carbon atoms.

[0665] As used herein, the term "C n-m "Haloalkyl" refers to an alkyl group having from 1 halogen atom to 2s + 1 halogen atoms, which may be the same or different, where "s" is the number of carbon atoms in the alkyl group, wherein the alkyl group has nm carbon atoms. In some embodiments, the haloalkyl group is only fluorinated. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0666] As used herein, “C n-m "Alkenyl" refers to an alkyl group having one or more double carbon-carbon bonds and having n to m carbons. Exemplary alkenyl groups include, but are not limited to, ethenyl, n-propenyl, isopropenyl, n-butenyl, sec-butenyl, and the like. In some embodiments, the alkenyl moiety contains 2 to 6, 2 to 4, or 2 to 3 carbon atoms.

[0667] As used herein, “C n-m "Alkynyl" refers to an alkyl group having one or more carbon-carbon triple bonds and having n to m carbon atoms. Exemplary alkynyl groups include, but are not limited to, ethynyl, propyn-1-yl, propyn-2-yl, and the like. In some embodiments, the alkynyl moiety contains 2 to 6, 2 to 4, or 2 to 3 carbon atoms.

[0668] As used herein, the term "C n-m "Alkylene" refers to a divalent alkyl linking group having n to m carbons. Examples of alkylene include, but are not limited to, ethane-1,1-diyl, ethane-1,2-diyl, propane-1,1,-diyl, propane-1,3-diyl, propane-1,2-diyl, butane-1,4-diyl, butane-1,3-diyl, butane-1,2-diyl, 2-methyl-propane-1,3-diyl, and the like. In some embodiments, the alkylene moiety contains 2 to 6, 2 to 4, 2 to 3, 1 to 6, 1 to 4, or 1 to 2 carbon atoms.

[0669] As used herein, the term "C n-m "Alkoxy" refers to a radical of the formula -O-alkyl, where the alkyl radical has n to m carbon atoms. Exemplary alkoxy radicals include, but are not limited to, methoxy, ethoxy, propoxy (e.g., n-propoxy and isopropoxy), butoxy (e.g., n-butoxy and tert-butoxy), and the like. In some embodiments, the alkyl radical has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0670] As used herein, “C n-m "Haloalkoxy" refers to a radical of the formula -O-haloalkyl having n to m carbon atoms. An exemplary haloalkoxy radical is OCF3. In some embodiments, the haloalkoxy radical is only fluorinated. In some embodiments, the alkyl radical has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0671] As used herein, the term "amino" refers to a group of formula -NH2.

[0672] As used herein, the term "C n-m"Alkylamino" refers to a group of the formula -NH(alkyl), wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Examples of alkylamino groups include, but are not limited to, N-methylamino, N-ethylamino, N-propylamino (e.g., N-(n-propyl)amino and N-isopropylamino), N-butylamino (e.g., N-(n-butyl)amino and N-(tert-butyl)amino), and the like.

[0673] As used herein, the term "di(C n-m "-alkyl)amino" refers to a radical of the formula -N(alkyl)2, wherein each of the two alkyl groups independently has n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0674] As used herein, the term "C n-m "Alkoxycarbonyl" refers to a group of the formula -C(O)O-alkyl, wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Examples of alkoxycarbonyl groups include, but are not limited to, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl (e.g., n-propoxycarbonyl and isopropoxycarbonyl), butoxycarbonyl (e.g., n-butoxycarbonyl and tert-butoxycarbonyl), and the like.

[0675] As used herein, the term "C n-m "Alkylcarbonyl" refers to a radical of the formula -C(O)-alkyl, wherein the alkyl radical has n to m carbon atoms. In some embodiments, the alkyl radical has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Examples of alkylcarbonyl radicals include, but are not limited to, methylcarbonyl, ethylcarbonyl, propylcarbonyl (e.g., n-propylcarbonyl and isopropylcarbonyl), butylcarbonyl (e.g., n-butylcarbonyl and tert-butylcarbonyl), and the like.

[0676] As used herein, the term "C n-m "Alkylcarbonylamino" refers to a radical of the formula -NHC(O)-alkyl, wherein the alkyl radical has n to m carbon atoms. In some embodiments, the alkyl radical has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0677] As used herein, the term "C n-m "Alkylsulfonylamino" refers to a radical of the formula -NHS(O)2-alkyl, wherein the alkyl radical has n to m carbon atoms. In some embodiments, the alkyl radical has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0678] As used herein, the term "aminosulfonyl" refers to a group of formula -S(O)2NH2.

[0679] As used herein, the term "C n-m"Alkylaminosulfonyl" refers to a radical of the formula -S(O)2NH(alkyl) where the alkyl radical has n to m carbon atoms. In some embodiments, the alkyl radical has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0680] As used herein, the term "di(C n-m "(4-(4-alkyl)aminosulfonyl" refers to a radical of the formula -S(O)2N(alkyl)2 wherein each alkyl group independently has n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0681] As used herein, the term "aminosulfonylamino" refers to a group of formula -NHS(O)2NH2.

[0682] As used herein, the term "C n-m "Alkylaminosulfonylamino" refers to a radical of the formula -NHS(O)2NH(alkyl) where the alkyl radical has n to m carbon atoms. In some embodiments, the alkyl radical has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0683] As used herein, the term "di(C n-m "(alkyl)aminosulfonylamino" refers to a radical of the formula -NHS(O)2N(alkyl)2, wherein each alkyl radical has n to m carbon atoms. In some embodiments, each alkyl radical independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0684] As used herein, the term "aminocarbonylamino," employed alone or in combination with other terms, refers to a group of formula -NHC(O)NH2.

[0685] As used herein, the term "C n-m "Alkylaminocarbonylamino" refers to a radical of the formula -NHC(O)NH(alkyl) where the alkyl radical has n to m carbon atoms. In some embodiments, the alkyl radical has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0686] As used herein, the term "di(C n-m "(alkyl)aminocarbonylamino" refers to a radical of the formula -NHC(O)N(alkyl)2, wherein each alkyl group independently has n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0687] As used herein, the term "carbamoyl" refers to a group of formula -C(O)NH2.

[0688] As used herein, the term "C n-m"Alkylcarbamoyl" refers to a radical of the formula -C(O)-NH(alkyl) where the alkyl radical has n to m carbon atoms. In some embodiments, the alkyl radical has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0689] As used herein, the term "di(C n-m -alkyl)carbamoyl" refers to a group of the formula -C(O)N(alkyl)2, wherein each of the two alkyl groups independently has n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0690] As used herein, the term "mercapto" refers to a group of formula -SH.

[0691] As used herein, the term "C n-m "Alkylthio" refers to a radical of the formula -S-alkyl, wherein the alkyl radical has n to m carbon atoms. In some embodiments, the alkyl radical has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0692] As used herein, the term "C n-m "Alkylsulfinyl" refers to a radical of the formula -S(O)-alkyl, wherein the alkyl radical has n to m carbon atoms. In some embodiments, the alkyl radical has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0693] As used herein, the term "C n-m "Alkylsulfonyl" refers to a radical of the formula -S(O)2-alkyl, wherein the alkyl radical has n to m carbon atoms. In some embodiments, the alkyl radical has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0694] As used herein, the term "carbonyl," employed alone or in combination with other terms, refers to a -C(=O)- group, also written as C(O).

[0695] As used herein, the term "carboxy" refers to a -C(O)OH group.

[0696] As used herein, the term "cyano-C 1-3 "Alkyl" refers to a group of the formula -(C 1-3 alkylene)-CN group.

[0697] As used herein, the term "HO-C 1-3 "Alkyl" refers to a group of the formula -(C 1-3 alkylene)-OH group.

[0698] As used herein, "halogen" refers to F, Cl, Br, or I. In some embodiments, the halogen is F, Cl, or Br.

[0699] As used herein, the term "aryl," employed alone or in combination with other terms, refers to an aromatic hydrocarbon group which may be monocyclic or polycyclic (e.g., having 2, 3, or 4 fused rings). n-m "Aryl" refers to an aromatic radical having n to m ring carbon atoms. Aryl groups include, for example, phenyl, naphthyl, anthracenyl, phenanthrenyl, indanyl, indenyl, and the like. In some embodiments, the alkyl group has 6 to 10 carbon atoms. In some embodiments, the aryl group is phenyl or naphthyl.

[0700] As used herein, "cycloalkyl" refers to a non-aromatic cyclic hydrocarbon including cyclized alkyl and / or alkenyl groups. Cycloalkyl can include monocyclic or polycyclic (e.g., with 2, 3 or 4 fused rings) groups and spirocycles. The ring-forming carbon atoms of the cycloalkyl can optionally be substituted by 1 or 2 independently selected oxo or sulfide groups (e.g., C(O) or C(S)). The definition of cycloalkyl also includes parts having one or more aromatic rings fused to the cycloalkyl ring (i.e., having a common bond), such as benzo or thienyl derivatives of cyclopentane, cyclohexane, etc. The cycloalkyl containing the fused aromatic ring can be connected by any ring-forming atom including the ring-forming atom of the fused aromatic ring. The cycloalkyl can have 3, 4, 5, 6, 7, 8, 9 or 10 ring-forming carbons (C 3-10 In some embodiments, the cycloalkyl group is C 3-10 In some embodiments, the cycloalkyl group is C 3-7 Monocyclic cycloalkyl. Exemplary cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclopentenyl, cyclohexenyl, cyclohexadienyl, cycloheptatrienyl, norbornyl, norpinyl, norcaryl, adamantyl, and the like. In some embodiments, the cycloalkyl group is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.

[0701] As used herein, "heteroaryl" refers to a monocyclic or polycyclic aromatic heterocycle having at least one heteroatom ring member selected from sulfur, oxygen, and nitrogen. In some embodiments, the heteroaryl ring has 1, 2, 3, or 4 heteroatom ring members independently selected from nitrogen, sulfur, and oxygen. In some embodiments, any ring-forming N in the heteroaryl moiety may be an N-oxide. In some embodiments, the heteroaryl is a 5-10 membered monocyclic or bicyclic heteroaryl having 1, 2, 3, or 4 heteroatom ring members independently selected from nitrogen, sulfur, and oxygen. In some embodiments, the heteroaryl is a 5-6 monocyclic heteroaryl having 1 or 2 heteroatom ring members independently selected from nitrogen, sulfur, and oxygen. In some embodiments, the heteroaryl is a five-membered or six-membered heteroaryl ring. A five-membered heteroaryl ring is a heteroaryl ring having five ring atoms, wherein one or more (e.g., 1, 2, or 3) ring atoms are independently selected from N, O, and S. Exemplary five-membered ring heteroaryl groups are thienyl, furyl, pyrrolyl, imidazolyl, thiazolyl, oxazolyl, pyrazolyl, isothiazolyl, isoxazolyl, 1,2,3-triazolyl, tetrazolyl, 1,2,3-thiadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-triazolyl, 1,2,4-thiadiazolyl, 1,2,4-oxadiazolyl, 1,3,4-triazolyl, 1,3,4-thiadiazolyl and 1,3,4-oxadiazolyl. Six-membered heteroaryl rings are heteroaryl groups having six ring atoms, wherein one or more (e.g., 1, 2 or 3) ring atoms are independently selected from N, O and S. Exemplary six-membered ring heteroaryl groups are pyridinyl, pyrazinyl, pyrimidinyl, triazinyl and pyridazinyl.

[0702] As used herein, "heterocycloalkyl" refers to a non-aromatic monocyclic or polycyclic heterocycle having one or more ring heteroatoms selected from O, N or S. Heterocycloalkyl includes monocyclic 4-, 5-, 6-, 7-, 8-, 9- or 10-membered heterocycloalkyl. Heterocycloalkyl can also include spirocycles. Exemplary heterocycloalkyls include pyrrolidin-2-one, 1,3-isoxazolidin-2-one, pyranyl, tetrahydropyran, oxetanyl, azetidinyl, morpholino, thiomorpholino, piperazinyl, tetrahydrofuranyl, tetrahydrothiophenyl, piperidinyl, pyrrolidinyl, isoxazolidinyl, isothiazolidinyl, pyrazolidinyl, oxazolidinyl, thiazolidinyl, imidazolidinyl, azepanyl, benzazepanyl, etc. The ring-forming carbon atoms and heteroatoms of heterocycloalkyl can be optionally substituted by 1 or 2 independently selected oxo or sulfide groups (e.g., C(O), S(O), C(S) or S(O) 2, etc.).Heterocycloalkyl can be connected by ring-forming carbon atoms or ring-forming heteroatoms. In certain embodiments, heterocycloalkyl contains 0 to 3 double bonds. In certain embodiments, heterocycloalkyl contains 0 to 2 double bonds. The definition of heterocycloalkyl also includes the part of one or more aromatic rings fused to the cycloalkyl ring (i.e., having a common bond), for example, benzo or thienyl derivatives of piperidine, morpholine, azacycloheptatriene. The heterocycloalkyl containing fused aromatic rings can be connected by any ring-forming atom including the ring-forming atoms of the fused aromatic rings. In certain embodiments, heterocycloalkyl is a monocyclic 4-6 membered heterocycloalkyl having 1 or 2 heteroatoms independently selected from nitrogen, oxygen or sulfur and having one or more oxidized ring members. In some embodiments, the heterocycloalkyl group is a monocyclic or bicyclic 4-10 membered heterocycloalkyl group having 1, 2, 3, or 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, and having one or more oxygenated ring members.

[0703] In some places, the definitions or examples refer to specific rings (e.g., azetidine ring, pyridine ring, etc.). Unless otherwise indicated, these rings can be attached to any ring member, provided that the valence of the atoms is not exceeded. For example, the azetidine ring can be attached at any position of the ring, while the pyridin-3-yl ring is attached at the 3-position.

[0704] As used herein, the term "oxo" refers to an oxygen atom as a divalent substituent, which when attached to carbon forms a carbon group (eg, C=O), or to a heteroatom forms a sulfoxide or sulfone group.

[0705] As used herein, the term "compound" is intended to include all stereoisomers, geometric isomers, tautomers, and isotopes of the depicted structure. Unless otherwise indicated, a compound identified herein as one particular tautomeric form by name or structure is intended to include the other tautomeric forms.

[0706] The compounds described herein may be asymmetric (e.g., having one or more stereocenters). Unless otherwise indicated, all stereoisomers, such as enantiomers and diastereomers, are contemplated. Compounds of the invention containing asymmetrically substituted carbon atoms can be separated in optically active or racemic forms. Methods for preparing optically active forms from optically inactive raw materials are known in the art, such as by resolving racemic mixtures or stereoselective synthesis. Many geometric isomers of alkenes, C=N double bonds, N=N double bonds, etc. may also be present in the compounds described herein, and all such stable isomers are included in the present invention. Cis and trans geometric isomers of the compounds of the present invention are described and can be separated into mixtures of isomers or separated isomeric forms. In some embodiments, the compound has an (R)-structure: in some embodiments, the compound has an (S)-structure.

[0707] Compounds provided herein also include tautomeric forms. Tautomeric forms arise from the exchange of a single bond with an adjacent double bond and the concomitant migration of a proton. Tautomeric forms include prototropic tautomers, which are isomeric protonation states with the same empirical formula and total charge. Exemplary prototropic tautomers include keto-enol pairs, amide-imidic acid pairs, lactam-lactim pairs, enamine-imine pairs, and cyclic forms in which protons can occupy two or more positions of a heterocyclic ring system, such as 1H- and 3H-imidazoles, 1H-, 2H-, and 4H-1,2,4-triazoles, 1H- and 2H-isoindoles, and 1H- and 2H-pyrazoles. Tautomeric forms can be in equilibrium or spatially locked into one form by appropriate substitution.

[0708] As used herein, the term "cell" is intended to refer to a cell in vitro, ex vivo, or in vivo. In some embodiments, an ex vivo cell can be part of a tissue sample excised from an organism, such as a mammal. In some embodiments, an in vitro cell can be a cell in a cell culture. In some embodiments, an in vivo cell is a cell living in an organism, such as a mammal.

[0709] As used herein, the term "contacting" refers to bringing together designated moieties in an in vitro system or an in vivo system. For example, "contacting" PAPD5 with a compound of the invention includes administering the compound of the invention to an individual or patient, such as a human, who has PAPD5, as well as, for example, introducing the compound of the invention into a sample containing cells or purified preparations containing PAPD5.

[0710] As used herein, the terms "individual," "patient," or "subject," which are used interchangeably, refer to any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, pigs, cows, sheep, horses, or primates, and most preferably humans.

[0711] As used herein, the phrase "effective amount" or "therapeutically effective amount" refers to that amount of an active compound or agent that elicits the biological or medical response in a tissue, system, animal, individual or human that is being sought by a researcher, veterinarian, medical doctor or other clinician.

[0712] As used herein, the terms "treating" or "treatment" refer to 1) inhibiting the disease; e.g., inhibiting the disease, condition or disorder in an individual who is experiencing or displaying the pathology or symptomology of the disease, condition or disorder (i.e., arresting further development of the pathology and / or symptomology), or 2) ameliorating the disease; e.g., ameliorating the disease, condition or disorder in an individual who is experiencing or displaying the pathology or symptomology of the disease, condition or disorder (i.e., reversing the pathology and / or symptomology).

[0713] As used herein, the terms "preventing" or "prevention" of a disease, condition, or disorder refers to reducing the risk of the disease, condition, or disorder occurring in a subject or group of subjects (e.g., a subject or group of subjects susceptible to or affected by the disease, condition, or disorder). In some embodiments, preventing a disease, condition, or disorder refers to reducing the likelihood of acquiring the disease, condition, or disorder and / or its associated symptoms. In some embodiments, preventing a disease, condition, or disorder refers to completely or nearly completely preventing the disease, condition, or disorder from occurring.

[0714] Examples

[0715] Example 1 - Inhibition of recombinant PAPD5

[0716] Recombinant PAPD5 and catalytically inactive mutant PAPD5 (D189A, D191A) were purified for use in in vitro assays. The in vitro RNA polyadenylation assay using recombinant PAPD5, ATP, and oligonucleotide substrates exploits the phenomenon that ATP utilization by PAPD5 is read out as a decrease in the luminescent signal produced by luciferase (KinaseGlo, Promega, Madison, WI).

[0717] 0.25 μl of PAPD5 in buffer composition was added to the wells of a microtiter plate (e.g., Product No. 3820; non-binding surface; Corning Incorporated, Corning, NY) at a concentration of 50 nM using a Thermo MultiDrop Combi (Thermo Fisher Scientific, Waltham, MA). For the positive control (e.g., well A24:P24 in a multiwell plate), 0.5 μl of mutant PAPD5 was added at a concentration of 50 nM.

[0718] Transfer 100 nl of compound dissolved in DMSO to each well of the assay plate by needle transfer. For negative control wells, add DMSO only. Gently vortex the plate for 5 seconds and then incubate at room temperature for 2 hours.

[0719] After 2 hours, 5 μl of luciferase (Promega KinaseGlo, Madison, WI) was added using a MultiDrop Combi (Thermo Fisher Scientific, Waltham, MA). The mixture was gently vortexed for 5 seconds and incubated at room temperature for 10 minutes. The plate was rotated for 1 minute before luminescence measurement. The luminescence was measured using a PerkinElmer EnVision TM Luminescence measurements were quantified by a plate reader.

[0720] The fold change was calculated for 100 μM compound and 33 μM compound. For some compounds, the fold change at 10 μM, 3.3 μM, and 1 μM concentrations was also determined. The fold change is the ratio of the luminescence of the sample containing the inhibitor to the sample containing DMSO (a higher number indicates a higher degree of inhibition).

[0721] refer to Figure 3-6 , cmpd.1 (also known as 32A) is a compound having the formula:

[0722]

[0723] Example 2

[0724] Qualitative measures of RNA oligomer extension inhibition by test compounds, expressed as a range from minimal activity (0) to the activity of compound 1 (+++), and the results of the DSF binding assay, shown as temperature change at 100 μM compound, are shown in Table 2 below.

[0725] Table 2

[0726] Compound Code Inhibition of PAPD5 RNA oligoadenylation <![CDATA[ΔT m 100μM]]> 10A + 1.0 13A + 5.6 1A 0 0.4 12A + 6.1 15A ++ 8.8 26A +++ 11.1 27A 0 2.8 14A ++ 1.7 23A +++ 4.6 25A 0 0.1 18A 0 -0.1 28A + 5.5 29A +++ 4.9 30A 0 1.7 31A 0 1.8 33A 0 0.7 32A +++ 7.9 17A +++ 8.4 5A 0 2.3 16A +++ 9.6 19A 0 0.6 34A 0 0.3 51A + 7.9 53A + 5.2 54A +++ Fluorescence 55A +++ 13.9 56A 0 0.4 57A +++ 9.8 58A + 8.5 61A +++ 11.1 63A +++ 9.3 64A 6.3 70A +++ 13.7 78A +++ 17.1 78A-BR Fluorescence 78A-INT 0 1.1 79A 79A-INT 0 80A +++ 16.4 81A 81A-INT 82A +++ 13.5 83A-INT 85A 0 85A-BP 6.8 86A 93A 93A-INT 0

[0727] Example 3 - Preparation of Compound 1A

[0728]

[0729] Synthesis of 2-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolinyl]amino]pyridine-3-carboxylic acid: To a sealed tube was added ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (100 mg, 312.83 μmol, 1 eq), AcOH (4.70 mg, 78.21 μmol, 4.47 μL, 0.25 eq), 2-aminopyridine-3-carboxylic acid (129.63 mg, 938.49 μmol, 3 eq), and DMF (4 mL). The sealed tube was then stirred at 130 ° C. under microwave for 0.5 hours. LCMS showed residual starting material and the desired product was formed. The mixture was filtered and the filtrate was directly purified. The filtrate was purified by preparative HPLC: Column: Waters Xbridge BEH C18 100 × 25 mm × 5 μm; Mobile phase: [water (10 m MNH4HCO3)-ACN]; B%: 20%-70% over 8 min. 2-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolinyl]amino]pyridine-3-carboxylic acid (2.24 mg, 5.10 μmol, 1.63% yield, 95.96% purity) was obtained as an off-white solid. 1 H NMR (400MHz, DMSO-d6) δ = 9.38 (s, 1H), 8.49 (d, J = 1.6Hz, 1H), 8.38 (d, J = 1.6Hz, 1H), 8.36 (d, J = 10.8Hz, 1H), 8.35 (s, 1H),8.32–8.01(m,1H),7.48–7.23(m,2H),6.81–6.78(m,1H),4.23(1,J=6.8Hz,2H),1.07(t,J=7.2Hz,1H).MS(M+H) + =422.0.

[0730] Example 4 - Preparation of Compound 5A

[0731]

[0732] Step 1 - Synthesis of 5-bromothiazole-4-carboxylic acid: To a stirred solution of ethyl 5-bromothiazole-4-carboxylate (3.7 g, 15.67 mmol, 1 eq) in MeOH (20 mL), THF (20 mL), and H2O (20 mL) was added NaOH (2M, 23.51 mL, 3 eq). The mixture was then stirred at 20°C for 1 hour. TLC (petroleum ether:ethyl acetate = 20 / 1) showed complete consumption of the starting material. The mixture was adjusted to pH = 3 by adding 6N HCl and then filtered. The filter cake was dried in vacuo. 5-bromothiazole-4-carboxylic acid (2.8 g, 13.46 mmol, 85.88% yield) was obtained as a yellow solid. 1H NMR (400MHz, DMSO-d6) δ = 13.38 (brs, 1H), 9.14 (s, 1H).

[0733]

[0734] Step 2 - Synthesis of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride: To a solution of 5-bromothiazole-4-carboxylic acid (1.7 g, 8.17 mmol, 1 eq) in dioxane (20 mL) was added 1,1-di-tert-butoxy-N,N-dimethyl-methylamine (1.66 g, 8.17 mmol, 1.96 mL, 1 eq) dropwise, followed by stirring at 100°C for 2 hours. TLC (petroleum ether:ethyl acetate = 5:1, Rf = 0.43) indicated the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by flash column chromatography (ISCO 20 g silica, 0-10% ethyl acetate / petroleum ether, 30 min gradient). TLC (petroleum ether:ethyl acetate = 5:1, Rf = 0.43) afforded tert-butyl 5-bromothiazole-4-carboxylate (1.6 g, 6.06 mmol, 74.14% yield) as a yellow oil. 1 H NMR (400MHz, DMSO-d6) δ = 8.76 (s, 1H), 1.64 (s, 9H).

[0735]

[0736] Step 3 - Synthesis of tert-butyl 5-(benzhydrylamino)thiazole-4-carboxylate: To a stirred solution of tert-butyl 5-bromothiazole-4-carboxylate (2 g, 7.57 mmol, 1 eq) in toluene (20 mL) were added CsCO (4.93 g, 15.14 mmol, 2 eq), Xantphos (788.61 mg, 1.36 mmol, 0.18 eq), Pd(dba) (346.68 mg, 378.59 μmol, 0.05 eq), and benzophenone imine (2.06 g, 11.36 mmol, 1.91 mL, 1.5 eq). The mixture was then stirred at 80°C for 16 hours. TLC (petroleum ether:ethyl acetate = 3 / 1) indicated complete consumption of the starting material and the formation of a new spot. The solvent was removed in vacuo to yield a residue. The residue was dissolved in ethyl acetate (30 mL), washed with water (20 mL), dried over anhydrous sodium sulfate, and concentrated to give the crude product. The crude product was purified by column chromatography (SiO2, petroleum ether / ethyl acetate = 1 / 0 to 10 / 1). tert-Butyl 5-(benzhydrylamino)thiazole-4-carboxylate (2.3 g, 6.31 mmol, 83.35% yield) was obtained as a yellow solid. 1H NMR (400 MHz, chloroform-d) δ = 8.29 (s, 1H), 7.88–7.81 (m, 2H), 7.51–7.40 (m, 6H), 7.26–7.15 (m, 2H), 1.55 (s, 9H).

[0737]

[0738] Step 4 – Synthesis of tert-butyl 5-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolinyl]amino]thiazole-4-carboxylate: To a stirred solution of ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (400 mg, 1.25 mmol, 1 eq) in DMF (5 mL) was added tert-butyl 5-aminothiazole-4-carboxylate (375.88 mg, 1.88 mmol, 1.5 eq) and Na2CO3 (265.25 mg, 2.50 mmol, 2 eq). The mixture was then stirred at 110°C for 5 hours. LCMS showed the formation of the desired product. The mixture was poured into water (20 mL) and extracted with ethyl acetate (20 mL x 3). The combined organic layers were dried over anhydrous sodium sulfate and concentrated to give the crude product. The residue was purified by flash column (ISCO 10 g silica, 0-30% ethyl acetate / petroleum ether, 20 min gradient). Tert-butyl 5-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolinyl]amino]thiazole-4-carboxylate was obtained as a yellow solid (370 mg, 765.32 μmol, 61.16% yield). 1 H NMR (400 MHz, chloroform-d) δ = 11.24 (s, 1H), 9.37 (s, 1H), 8.18 (d, J = 9.2 Hz, 1H), 8.10 (s, 1H), 7.77 (s, 1H), 7.66 (br d, J = 8.0 Hz, 1H), 4.51 (q, J = 7.2 Hz, 2H), 1.71 (s, 9H), 1.46 (t, J = 7.2 Hz, 3H).

[0739]

[0740] Step 5 - Synthesis of 5-((3-(ethoxycarbonyl)-6-(trifluoromethoxy)quinolin-4-yl)amino)thiazole-4-carboxylic acid: To a stirred solution of tert-butyl 5-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolinyl]amino]thiazole-4-carboxylate (140 mg, 289.58 μmol, 1 eq) in DCM (1 mL) was added TFA (1 mL). The mixture was then stirred at 25°C for 1 hour. LCMS showed complete consumption of the starting material and formation of the desired product. DMF (3 mL) was added to the mixture. The TFA was partially removed in vacuo. The solution was purified by preparative HPLC: Column: Phenomenex Luna C18 100 × 30 mm × 5 μm; Mobile phase: [Water (0.1% TFA)-ACN]; B%: 10%-45%, 12 min. 5-[[3-Ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolinyl]amino]thiazole-4-carboxylic acid (25 mg, 38.35 μmol, 13.24% yield, 83.04% purity, TFA) was obtained as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=8.92(br s,1H),8.45(s,1H),8.20–7.97(m,2H),7.86(br d,J=8.0Hz,1H),4.24-4.05(m,2H),1.21(br t,J=6.9Hz,3H).MS(M+H) + =428.0.

[0741] Example 5 - Preparation of Compound 10A

[0742]

[0743] Step 1-4-(2-cyanoanilino)-6-(trifluoromethoxy)quinoline-3-carboxylic acid ethyl ester synthesis: 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylic acid ethyl ester (0.2 mg, 625.66 μmol, 1 eq) and 2-aminobenzonitrile (147.83 mg, 1.25 mmol, 2.0 eq) in ACN (3 mL) were stirred at 90 ° C for 16 hours. LCMS showed that the starting material was completely consumed and the desired product was formed. The mixture was concentrated to give a crude product. The crude product was purified by flash column (ISCO 12 g silica, 0-50% ethyl acetate / petroleum ether, 20 min gradient, 1 / 400 TEA) to give 4-(2-cyanoanilino)-6-(trifluoromethoxy)quinoline-3-carboxylic acid ethyl ester (0.2 g, 498.33 μmol, 79.65% yield) as a yellow solid. MS(M+H) + =402.0

[0744]

[0745] Step 2 - Synthesis of ethyl 4-[2-(2H-tetrazol-5-yl)anilino]-6-(trifluoromethoxy)quinoline-3-carboxylate: To a stirred solution of ethyl 4-(2-cyanoanilino)-6-(trifluoromethoxy)quinoline-3-carboxylate (150 mg, 373.75 μmol, 1 eq) and NH4Cl (199.92 mg, 3.74 mmol, 10 eq) in DMF (2 mL) was added NaN3 (121.49 mg, 1.87 mmol, 5 eq), followed by stirring at 100°C for 14 hours. LCMS indicated the detection of approximately 65% ​​of the desired product and approximately 25% of the starting material. The mixture was filtered to obtain a filtrate. The crude product was purified by preparative HPLC (Waters Xbridge Prep OBD C18 150×40 mm×10 μm column; 10%-40% acetonitrile / 0.04% ammonia solution and 10 mM NH 4 HCO 3 aqueous solution, 10 min gradient) to give ethyl 4-[2-(2H-tetrazol-5-yl)anilino]-6-(trifluoromethoxy)quinoline-3-carboxylate (34.27 mg, 75.27 μmol, 20.14% yield, 97.6% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ = 10.83 (br s, 1H), 9.07 (s, 1H), 8.22-8.00 (m, 2H), 7.87-7.65 (m, 2H), 7.38-7.24 (m, 2H), 6.94 (d, J = 8.1Hz, 1H), 4.15 (br s,2H),1.18(t,J=7.1Hz,3H).MS(M+H) + =445.0.

[0746] Example 6 - Preparation of Compound 12A

[0747]

[0748] Step 1 - Synthesis of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride: A stirred solution of 4-oxo-6-(trifluoromethoxy)-1H-quinoline-3-carboxylic acid (300 mg, 1.10 mmol, 1 eq) in POCl3 (3 mL) was heated to 100°C and stirred for 1 hour. LCMS showed no remaining starting material. The mixture was cooled to room temperature and concentrated in vacuo. The residue was dissolved in toluene (3 mL x 2) and concentrated in vacuo to dryness to give 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride (335.2 mg, crude) as a brown gum.

[0749]

[0750] Step 2: Synthesis of 4-chloro-N,N-dimethyl-6-(trifluoromethoxy)quinoline-3-carboxamide: To a solution of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride (330 mg, 1.06 mmol, 1 eq) in DCM (3 mL) was added TEA (429.05 mg, 4.24 mmol, 590.16 μL, 4 eq) and N-methylmethylamine (77.79 mg, 954.00 μmol, 87.41 μL, 0.9 eq, HCl) at 0°C, followed by stirring at 0°C for 0.5 hours. LCMS indicated the reaction was complete. Water (3 mL) was added to the solution, separated, and extracted with DCM (5 mL x 2). The combined organic layers were washed with water (3 mL), dried over Na2SO4, and concentrated in vacuo to give 4-chloro-N,N-dimethyl-6-(trifluoromethoxy)quinoline-3-carboxamide (230.2 mg, crude) as a brown oil. MS (M+H) + =319.1.

[0751]

[0752] Step 3 - Synthesis of 2-[[3-(dimethylcarbamoyl)-6-(trifluoromethoxy)-4-quinolinyl]amino]benzoic acid: A solution of 4-chloro-N,N-dimethyl-6-(trifluoromethoxy)quinoline-3-carboxamide (110 mg, 345.18 μmol, 1 eq) and 2-aminobenzoic acid (56.80 mg, 414.21 μmol, 1.2 eq) in ACN (4 mL) was stirred at 90 ° C for 14 hours. LCMS showed that the reaction was complete and the desired product was detected. The mixture was concentrated in vacuo and dissolved in MeOH (2 mL). The crude product was purified by preparative HPLC (Waters Xbridge Prep OBD C18 150×40 mm×10 μm column; 1%-30% acetonitrile / 0.04% ammonia solution and 10 mM NH4HCO3 aqueous solution, 10 min gradient) to give 2-[[3-(dimethylcarbamoyl)-6-(trifluoromethoxy)-4-quinolinyl]amino]benzoic acid (67.29 mg, 152.20 μmol, 44.09% yield, 94.85% purity) as a yellow solid. 1H NMR (400MHz, DMSO-d6) δ = 12.00 (br s, 1H), 8.68 (s, 1H), 8.13 (d, J = 9.0Hz, 1H), 8.00-7.91 (m, 2H), 7.79 (br d, J = 8.8Hz, 1H), 7.38 (br s,1H),7.23(t,J=7.6Hz,1H),6.90(t,J=7.4Hz,1H),6.72(d,J=8.2Hz,1H),2.72(s,3H),2.56(s,3H).MS(M+H) + =420.0

[0753] Example 7 - Preparation of Compound 13A

[0754]

[0755] Step 1-Synthesis of 4-oxo-6-(trifluoromethoxy)-1H-quinoline-3-carboxylic acid: A suspension of ethyl 4-oxo-6-(trifluoromethoxy)-1H-quinoline-3-carboxylate (500 mg, 1.66 mmol, 1 eq) in NaOH (2 M, 12.50 mL, 15.06 eq) was stirred at 90 ° C for 1 hour. LCMS showed that the starting material was completely consumed and the desired product was formed. The mixture was cooled to 0 ° C, adjusted to pH 6 to 7 by adding 4N HCl, and then filtered. The filter cake was dried in vacuo. 4-oxo-6-(trifluoromethoxy)-1H-quinoline-3-carboxylic acid (450 mg, 1.65 mmol, 99.24% yield) was obtained as a white solid. 1 HNMR (400MHz, DMSO-d6) δ = 8.81 (s, 1H), 8.01 (s, 1H), 7.84 (d, J = 9.2Hz, 1H), 7.64 (d, J = 8.0Hz, 1H). MS (MH) - = 271.9.

[0756]

[0757] Step 2-4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride synthesis: a solution of 4-oxo-6-(trifluoromethoxy)-1H-quinoline-3-carboxylic acid (200 mg, 732.16 μmol, 1 eq) in POCl (2 mL) was stirred at 100 ° C for 1 hour. LCMS (quenching the sample with MeOH at low temperatures) showed that the raw material was completely consumed and the desired product was formed. The resulting solution was evaporated to dryness, and the residue was azeotroped with toluene (3 mL × 2). 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride (200 mg, crude product) was obtained as a brown solid.

[0758]

[0759] Step 3-[4-chloro-6-(trifluoromethoxy)-3-quinolinyl]-morpholino-methanone synthesis: to a stirred solution of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride (100 mg, 322.52 μmol, 1 eq) in DCM (3 mL) was added TEA (97.91 mg, 967.57 μmol, 134.67 μL, 3.0 eq) and morpholine (25.29 mg, 290.27 μmol, 25.54 μL, 0.9 eq) at 0 ° C. The mixture was then stirred at 0 ° C for 0.5 hours. LCMS showed that the starting material was completely consumed and the desired product was formed. The mixture was quenched with water (5 mL) at 0 ° C and extracted with DCM (5 mL × 3). The combined organic layers were dried over anhydrous sodium sulfate and concentrated to give a crude product. [4-Chloro-6-(trifluoromethoxy)-3-quinolinyl]-morpholino-methanone (90 mg, crude) was obtained as a yellow solid. MS (M+H) + =361.1.

[0760]

[0761] Step 4 - Synthesis of 2-[[3-(morpholine-4-carbonyl)-6-(trifluoromethoxy)-4-quinolinyl]amino]benzoic acid: To a stirred solution of [4-chloro-6-(trifluoromethoxy)-3-quinolinyl]-morpholino-methanone (90 mg, 249.50 μmol, 1 eq) in CH3CN (3 mL) was added 2-aminobenzoic acid (47.90 mg, 349.31 μmol, 1.4 eq). The mixture was then stirred at 90°C for 12 hours. LCMS showed complete consumption of the starting material and formation of the desired product. The mixture was concentrated to give the crude product. The crude product was purified by preparative HPLC: Welch Xtimate C18 150×30 mm×5 μm; mobile phase: [water (10 mM NH4HCO3)-ACN]; B%: 10%-50%, 8 min. 2-[[3-(Morpholine-4-carbonyl)-6-(trifluoromethoxy)-4-quinolinyl]amino]benzoic acid (51.07 mg, 110.69 μmol, 44.36% yield, 100.00% purity) was obtained as a yellow solid. 1HNMR(400MHz, DMSO-d6)δ=13.20(brs,1H),10.74(brs,1H),8.78(s,1H),8.19(d,J=9.2Hz,1H),8.96(d,J=7.2Hz,1H),7.93( s,1H),7.83(d,J=8.8Hz,1H),7.32(t,J=8.0Hz,1H),6.95(t,J=7.6Hz,1H),6.72(d,J=8.4Hz,1H),3.85–3.23(m,8H).MS(M+H) + =428.0.

[0762] Example 8 - Preparation of Compound 14A

[0763]

[0764] Step 1 - Synthesis of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride: A solution of 4-oxo-6-(trifluoromethoxy)-1H-quinoline-3-carboxylic acid (500 mg, 1.83 mmol, 1 eq) in POCl3 (2 mL) was stirred at 100°C for 1 hour. LCMS (quenching the sample with MeOH at low temperature) showed complete consumption of the starting material and formation of the desired product. The resulting solution was evaporated to dryness, and the residue was azeotroped with toluene (5 mL x 2). 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride (500 mg, crude) was obtained as a brown gum.

[0765]

[0766] Step 2 - Synthesis of tert-butyl 4-(4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl)piperazine-1-carboxylate: To a stirred solution of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride (500 mg, 1.61 mmol, 1 eq) in DCM (7 mL) was added TEA (489.54 mg, 4.84 mmol, 673.37 μL, 3.0 eq) and tert-butyl piperazine-1-carboxylate (270.32 mg, 1.45 mmol, 0.9 eq) at 0-5°C. The mixture was then stirred at 0-5°C for 0.5 h. LCMS showed complete consumption of the starting material and formation of the desired product. The mixture was quenched with water (6 mL) at 0°C and extracted with DCM (5 mL x 3). The combined organic layers were dried over anhydrous sodium sulfate and concentrated to give the crude product. Tert-butyl 4-[4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl]piperazine-1-carboxylate (630 mg, crude) was obtained as a brown solid. MS (M+H) + =460.1.

[0767]

[0768] Step 3 - Synthesis of 2-[[3-(4-tert-Butoxycarbonylpiperazine-1-carbonyl)-6-(trifluoromethoxy)-4-quinolinyl]amino]benzoic acid: A solution of tert-butyl 4-[4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl]piperazine-1-carboxylate (300 mg, 652.39 μmol, 1 eq) and 2-aminobenzoic acid (107.36 mg, 782.87 μmol, 1.2 eq) in CH3CN (5 mL) was stirred at 90°C for 40 hours. LCMS showed the formation of the desired product. The mixture was concentrated to give the crude product. 2-[[3-(4-tert-Butoxycarbonylpiperazine-1-carbonyl)-6-(trifluoromethoxy)-4-quinolinyl]amino]benzoic acid (450 mg, crude) was obtained as a brown solid. MS (M+H) + =561.2.

[0769]

[0770] Step 4 - Synthesis of 2-[[3-(piperazine-1-carbonyl)-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid: To a stirred solution of 2-[[3-(4-tert-butoxycarbonylpiperazine-1-carbonyl)-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid (170 mg, 303.29 μmol, 1 eq) in ethyl acetate (2 mL) was added 4N HCl / EtOAc (2 mL). The mixture was then stirred at 20°C for 3 hours. LCMS showed complete consumption of the starting material and formation of the desired product. The mixture was concentrated to give the crude product. The crude product was purified by preparative HPLC: column: Phenomenex Luna C18 150 × 30 mm × 5 μm; mobile phase: [water (0.04% HCl)-ACN]; B%: 15%-40%, 10 min. 2-[[3-(Piperazine-1-carbonyl)-6-(trifluoromethoxy)-4-quinolinyl]amino]benzoic acid (63.81 mg, 138.30 μmol, 45.60% yield, 99.79% purity) was obtained as a yellow solid. 1 H NMR(400MHz,Methol-d4)δ=8.76(s,1H),8.52(s,1H),8.21(d,J=6.4Hz,1H),8.16(d,J=9.2Hz,1H),8.01(d,J=8.8Hz,1 H),7.67(t,J=8.0Hz,1H),7.50(t,J=9.2Hz,1H),7.39(d,J=8.0Hz,1H),3.56–3.32(m,4H),3.30–3.01(m,4H).MS(M+H) + =461.1.

[0771] Example 9 - Preparation of Compound 15A

[0772]

[0773] Step 1-Synthesis of ethyl 2-cyano-3-[4-(trifluoromethoxy)anilino]prop-2-enoate: To a stirred solution of 4-(trifluoromethoxy)aniline (2 g, 11.29 mmol, 1.53 mL, 1 eq) in toluene (50 mL) was added ethyl 2-cyano-3-ethoxy-prop-2-enoate (2.10 g, 12.42 mmol, 1.1 eq). The mixture was then stirred at 110 ° C for 14 hours. TLC (petroleum ether: ethyl acetate = 2 / 1) showed that the starting material was completely consumed and new spots were observed. The mixture was concentrated to obtain a crude product. The crude product was triturated with MTBE (30 mL) at 20 ° C for 15 minutes. Ethyl 2-cyano-3-[4-(trifluoromethoxy)anilino]prop-2-enoate (1.7 g, 5.66 mmol, 50.15% yield) was obtained as a light yellow solid. 1 H NMR (400MHz, DMSO) δ=8.51–8.32(m,1H),7.70–7.51(m,2H),7.48–7.32(m,2H),4.26–4.15(m,2H),1.28–1.10(m,3H).

[0774]

[0775] Step 2 - Synthesis of 6-(trifluoromethoxy)quinolin-4-ol: A solution of ethyl 2-cyano-3-[4-(trifluoromethoxy)anilino]prop-2-enoate (500 mg, 1.67 mmol, 1 eq) in Ph2O (3 mL) was stirred at 250°C for 12 hours. TLC (petroleum ether:ethyl acetate = 5 / 1) indicated complete consumption of the starting material and new spots were observed. The mixture (2 batches) was cooled to room temperature (~20°C), MTBE (20 mL) was added, and stirred for 5 minutes. The mixture was then filtered, washed with MTBE (3 mL x 2), and dried under vacuum. 4-hydroxy-6-(trifluoromethoxy)quinoline-3-carbonitrile (0.6 g, crude product) was obtained as a brown solid.

[0776]

[0777] Step 3-4-chloro-6-(trifluoromethoxy)quinoline-3-carbonitrile synthesis: to a suspension of 4-hydroxy-6-(trifluoromethoxy)quinoline-3-carbonitrile (200 mg, 786.89 μmol, 1 eq) in SOCl2 (1 mL) was added DMF (5.75 mg, 78.69 μmol, 6.05 μL, 0.1 eq) at 0 ° C. The mixture was then stirred at 20 ° C for 13 hours. LCMS (quenched with MeOH at low temperatures) showed that the starting material was completely consumed and the desired product was formed. The resulting solution was evaporated to dryness, and the residue was azeotroped with toluene (3 mL × 2). 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonitrile (160 mg, crude product) was obtained as a brown solid.

[0778]

[0779] Step 4 - Synthesis of 2-[[3-cyano-6-(trifluoromethoxy)-4-quinolinyl]amino]benzoic acid: A suspension of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonitrile (80 mg, 293.46 μmol, 1 eq) and 2-aminobenzoic acid (48.29 mg, 352.15 μmol, 1.2 eq) in CH3CN (3 mL) was stirred at 90°C for 12 hours. LCMS showed complete consumption of the starting material and formation of the desired product. The mixture was concentrated to give the crude product. The crude product was purified by preparative HPLC using a Phenomenex Luna C18 column (150 × 30 mm × 5 μm); mobile phase (water (0.04% HCl)-ACN); B%: 30%-60% over 10 min. 2-[[3-Cyano-6-(trifluoromethoxy)-4-quinolinyl]amino]benzoic acid (19.62 mg, 51.29 μmol, 17.48% yield, 97.59% purity) was obtained as a yellow solid. 1 H NMR (400MHz, DMSO-d6)δ=8.94(s,1H),8.72(s,1H),8.18(d,J=8.8Hz,1H),8.02(t,J=6.4Hz,2H),7.69(t,J=7.2Hz,1H),7.55–7.51(m,2H).MS(M+H) + =428.0.

[0780] Example 10 - Preparation of Compound 16A

[0781]

[0782] Step 1 - A solution of 2,2-dimethyl-1,3-dioxane-4,6-dione (4.48 g, 31.05 mmol, 1.1 eq) and trimethoxymethane (13.30 g, 125.34 mmol, 13.74 mL, 4.44 eq) was stirred at 100°C for 1 hour. 4-(trifluoromethoxy)aniline (5 g, 28.23 mmol, 3.82 mL, 1 eq) was then added dropwise at 100°C over 0.5 hours and stirred at 100°C for an additional hour. TLC (petroleum ether:ethyl acetate = 2 / 1) indicated complete consumption of the starting material, and a new spot was observed. The mixture was diluted with MTBE (30 mL) and filtered. The filter cake was dried under vacuum. 2,2-Dimethyl-5-[[4-(trifluoromethoxy)anilino]methylene]-1,3-dioxane-4,6-dione (8 g, 24.15 mmol, 85.56% yield) was obtained as a yellow solid. 1 H NMR (400MHz, DMSO) δ = 11.29 (brs, 1H), 8.64 (s, 1H), 7.70 (d, J = 9.2Hz, 2H), 7.42 (d, J = 8.8Hz, 2H), 1.67 (s, 6H).

[0783]

[0784] Step 2 - 2,2-Dimethyl-5-[[4-(trifluoromethoxy)anilino]methylene]-1,3-dioxane-4,6-dione (4 g, 12.08 mmol, 1 eq) was added to Ph2O (10 mL) at 240°C, followed by stirring at 240°C for 0.5 hours. TLC (petroleum ether:ethyl acetate = 3:1, Rf = 0.04) indicated the reaction was complete. The mixture was cooled to 20°C, and MTBE (10 mL) was added, followed by filtration to afford the crude product. 6-(trifluoromethoxy)quinolin-4-ol (870 mg, crude) was obtained as a brown solid. 1 H NMR (400MHz, METHANOL-d4) δ = 8.07 (br s, 1H), 7.97 (d, J = 7.3Hz, 1H), 7.70-7.61 (m, 1H), 7.61-7.54 (m, 1H), 6.32 (d, J = 7.3Hz, 1H), 4.89 (s, 1H).

[0785]

[0786] Step 3 - To a stirred solution of chlorosulfonic acid (10 mL) was added 6-(trifluoromethoxy)quinolin-4-ol (1 g, 4.36 mmol, 1 eq) at 20 ° C. The mixture was then heated to 100 ° C and stirred at 100 ° C for 16 hours. LCMS showed complete consumption of the starting material and a new peak of sulfonic acid Ms was shown. The mixture was poured onto ice (~8 g) and extracted with ethyl acetate (8 mL x 3). The combined organic layers were dried over anhydrous sodium sulfate and concentrated to give the crude product. 4-Hydroxy-6-(trifluoromethoxy)quinoline-3-sulfonyl chloride (1 g, 3.05 mmol, 69.94% yield) was obtained as a brown solid.

[0787]

[0788] Step 4 - A stirred solution of THF (5 mL) was bubbled with NH3 to pH ~ 14 at 0°C, followed by the addition of 4-hydroxy-6-(trifluoromethoxy)quinoline-3-sulfonyl chloride (1 g, 3.05 mmol, 1 eq) dissolved in THF (1 mL) at 0°C. The mixture was then stirred at 20°C for 2 hours. LCMS showed that the starting material was completely consumed and the desired product was formed. The mixture was concentrated to give a crude product. 4-hydroxy-6-(trifluoromethoxy)quinoline-3-sulfonamide (1.1 g, crude) was obtained as a yellow solid.

[0789]

[0790] Step 5 - A stirred solution of 4-hydroxy-6-(trifluoromethoxy)quinoline-3-sulfonamide (200 mg, 648.86 μmol, 1 eq) in POCl₃ (2 mL) was stirred at 110°C for 0.5 h. LCMS indicated complete consumption of the starting material. The POCl₃ was removed in vacuo to yield a residue. The residue was dissolved in ethyl acetate (5 mL), poured into ice water (5 mL), and separated. The organic layer was dried over anhydrous sodium sulfate and concentrated to yield the crude product. 4-Chloro-6-(trifluoromethoxy)quinoline-3-sulfonamide (160 mg, crude) was obtained as a brown gum. MS (MH)- = 324.8.

[0791]

[0792] Step 6 - A solution of 4-chloro-6-(trifluoromethoxy)quinoline-3-sulfonamide (200 mg, 612.22 μmol, 1 eq) and 2-aminobenzoic acid (83.96 mg, 612.22 μmol, 1 eq) in CHCN (3 mL) was stirred at 90°C for 3 hours. LCMS showed complete consumption of the starting material and formation of the desired product. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC: Column: Waters Xbridge BEH C18 100 × 25 mm × 5 μm; Mobile phase: [water (10 mM NH4HCO3)-ACN]; B%: 15%-45% over 8 min. 2-[[3-Sulfamoyl-6-(trifluoromethoxy)-4-quinolinyl]amino]benzoic acid (69.01 mg, 155.36 μmol, 25.38% yield, 96.21% purity) was obtained as a yellow solid. 1 H NMR (400MHz, MeOH-d4) δ = 9.21 (s, 1H), 8.11 (d, J = 9.2Hz, 1H), 8.06 (dd, J = 2.0, 8.0Hz, 1H), 7.69 (d, J = 2.0Hz,1H),7.53(s,1H),7.19(t,J=2.0Hz,1H),7.05(t,J=2.0Hz,1H),6.55(d,J=7.6Hz,1H).MS(M+H) + =428.0.

[0793] Example 11 - Preparation of Compound 17A

[0794]

[0795] Step 1 – Synthesis of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride: A stirred solution of 4-oxo-6-(trifluoromethoxy)-1H-quinoline-3-carboxylic acid (500 mg, 1.83 mmol, 1 eq) in POCl₃ (5 mL) was heated to 100°C and stirred for 1 hour. LCMS showed no remaining starting material. The mixture was cooled to room temperature and concentrated in vacuo. The residue was dissolved in toluene (3 mL x 2) and concentrated in vacuo to afford 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride (550.6 mg, crude) as a brown gum.

[0796]

[0797] Step 2 – Synthesis of 4-chloro-N-(2,2-dimethoxyethyl)-6-(trifluoromethoxy)quinoline-3-carboxamide: To a solution of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride (550 mg, 1.77 mmol, 1 eq) in DCM (6 mL) was added TEA (538.49 mg, 5.32 mmol, 740.71 μL, 3 eq) and 2,2-dimethoxyethylamine (167.85 mg, 1.60 mmol, 173.93 μL, 0.9 eq) at 0°C, followed by stirring at 0°C for 0.5 hours. LCMS indicated the reaction was complete. Water (6 mL) was added to the solution, which was then separated and extracted with DCM (3 mL x 2). The combined organic layers were dried over sodium sulfate and concentrated in vacuo to give 4-chloro-N-(2,2-dimethoxyethyl)-6-(trifluoromethoxy)quinoline-3-carboxamide (420.3 mg, crude) as a brown solid. 1 H NMR (400MHz, DMSO-d6) δ = 8.99-8.84 (m, 2H), 8.30 (d, J = 9.3Hz, 1H), 8.16 (s, 1H), 7.95 (d d,J=1.9,9.2Hz,1H),4.55(t,J=5.5Hz,1H),3.43(t,J=5.7Hz,2H),3.34(s,6H).MS(M+H) + =379.0

[0798]

[0799] Step 3 – Synthesis of 2-[4-chloro-6-(trifluoromethoxy)-3-quinolyl]oxazole: A solution of 4-chloro-N-(2,2-dimethoxyethyl)-6-(trifluoromethoxy)quinoline-3-carboxamide (350 mg, 924.14 μmol, 1 eq) in Eaton's reagent (6.08 g, 25.54 mmol, 4 mL, 27.64 eq) was stirred at 120°C for 3 hours. LCMS indicated the reaction was complete. The mixture was added to ice water (5 mL) and stirred for 5 minutes. Ethyl acetate (5 mL) was added to the solution and separated. The aqueous layer was extracted with ethyl acetate (5 mL x 2). The combined organic layers were dried over Na2SO4 and concentrated in vacuo. The crude product was purified by flash column chromatography (ISCO 10 g silica, 0-30% ethyl acetate / petroleum ether, gradient 30 min) to afford 2-[4-chloro-6-(trifluoromethoxy)-3-quinolyl]oxazole (55.3 mg, 175.75 μmol, 19.02% yield) as an off-white solid. MS (M+H) + =315.0

[0800]

[0801] Step 4 – Synthesis of 2-[[3-oxazol-2-yl-6-(trifluoromethoxy)-4-quinolinyl]amino]benzoic acid: 2-Aminobenzoic acid (19.18 mg, 139.84 μmol, 1.1 eq) and 2-[4-chloro-6-(trifluoromethoxy)-3-quinolinyl]oxazole (40 mg, 127.13 μmol, 1 eq) were added to ACN (1 mL) and stirred at 90°C for 5 hours. LCMS showed complete consumption of the starting material and the desired product was detected. The mixture was filtered to obtain a filter cake. The crude product was purified by preparative HPLC (Waters XbridgeBEH C18 100×30 mm×10 μm column; 5%-35% acetonitrile / 10 mM aqueous NH 4 HCO 3 solution, 10 min gradient) to give 2-[[3-oxazol-2-yl-6-(trifluoromethoxy)-4-quinolinyl]amino]benzoic acid (10.3 mg, 24.55 μmol, 19.31% yield, 99.00% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ = 11.40 (br s, 1H), 9.34 (s, 1H), 8.29 (s, 1H), 8.16 (d, J = 9.0Hz, 1H), 7.96 (dd, J = 1.4, 7.8Hz, 1H), 7.75 (br d,J=9.2Hz,1H),7.56-7.47(m,2H),7.20(t,J=7.7Hz,1H),7.01(t,J=7.5Hz,1H),6.58(d,J=8.2Hz,1H).MS(MH) + =414.0.

[0802] Example 12 - Preparation of Compounds 26A and 18A

[0803]

[0804] Step 1 – Synthesis of 6-bromo-4-chloro-quinoline-3-carboxylic acid ethyl ester: 6-Bromo-4-oxo-1H-quinoline-3-carboxylic acid ethyl ester (1.5 g, 5.07 mmol, 1.0 eq) was added to POCl3 (15 mL) at 0°C and then stirred at 110°C for 3 hours. LCMS showed approximately 2% starting material remaining. The mixture was cooled to room temperature and concentrated in vacuo to remove excess solvent. The residue was added dropwise to a mixture of ice water (10 mL) and ethyl acetate (10 mL), separated, and extracted with ethyl acetate (10 mL x 2). The combined organic layers were washed with 10% NaHCO3 and concentrated in vacuo. 6-Bromo-4-chloro-quinoline-3-carboxylic acid ethyl ester (1.41 g, 4.48 mmol, 88.49% yield) was obtained as an off-white solid. 1H NMR (400 MHz, chloroform-d) δ = 9.20 (s, 1H), 8.56 (d, J = 2.0 Hz, 1H), 8.03 (d, J = 8.8 Hz, 1H), 7.91 (dd, J = 2.1, 8.9 Hz, 1H), 4.51 (q, J = 7.1 Hz, 2H), 1.47 (t, J = 7.1 Hz, 3H).

[0805]

[0806] Step 2 – Synthesis of 2-[(6-bromo-3-ethoxycarbonyl-4-quinolyl)amino]benzoic acid: A solution of ethyl 6-bromo-4-chloroquinoline-3-carboxylate (200 mg, 635.80 μmol, 1 eq) and 2-aminobenzoic acid (95.91 mg, 699.39 μmol, 1.1 eq) in CHCN (3 mL) was stirred at 90°C for 16 hours. TLC (petroleum ethanol:ethyl acetate = 3 / 1) indicated complete consumption of the starting material. The mixture was filtered and the filter cake was dried under vacuum. 2-[(6-bromo-3-ethoxycarbonyl-4-quinolyl)amino]benzoic acid (220 mg, 529.82 μmol, 83.33% yield) was obtained as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=11.56(brs,1H),9.07(s,1H),8.27(s,1H),8.13–8.10(m,2H),8.06(d,J=7.6Hz,1H ),7.56(t,J=7.2Hz,1H),7.41(t,J=7.6Hz,1H),7.25(d,J=8.0Hz,1H),4.20(brs,2H),1.20(d,J=7.2Hz,3H).

[0807]

[0808] Step 3-Synthesis of 2-[[3-ethoxycarbonyl-6-(piperazine-1-carbonyl)-4-quinolyl]amino]benzoic acid: Add 2-[(6-bromo-3-ethoxycarbonyl-4-quinolyl)amino]benzoic acid (100 mg, 240.83 μmol, 1 eq), piperazine (31.12 mg, 361.24 μmol, 1.5 eq), carbon monoxide; molybdenum (127.16 mg, 481.65 μmol) to a sealed tube. , 64.88 μL, 2.0 eq), DBU (109.99 mg, 722.48 μmol, 108.90 μL, 3.0 eq), tri-tert-butylphosphonium tetrafluoroborate (13.97 mg, 48.17 μmol, 0.2 eq), acetoxy-[[2-(bis-o-tolylphosphinoyl)phenyl]methyl]palladium (11.29 mg, 12.04 μmol, 0.05 eq) and THF (4 mL). The sealed tube was then bubbled with nitrogen for 30 seconds and heated to 120°C. The mixture was then stirred at 120°C for 5 minutes. LCMS showed complete consumption of the starting material and the formation of the desired product. The mixture was concentrated to obtain the crude product. The crude product was purified by preparative HPLC using a Phenomenex Luna C18 column (100 x 30 mm x 5 μm); mobile phase: water (0.04% HCl)-ACN; B%: 10%-40% over 10 min. 2-[[3-ethoxycarbonyl-6-(piperazine-1-carbonyl)-4-quinolinyl]amino]benzoic acid (19.93 mg, 43.92 μmol, 18.24% yield, 98.84% purity) was obtained as a yellow solid. 1 H NMR (400MHz, MeOD-d4) δ=9.26(s,1H),8.22(d,J=6.4Hz,1H),8.07(s,2H),7.27(s,1H),7.59(t,J=3.6Hz,1H),7.57(d,J=7 .6Hz,1H),7.40(d,J=8.0Hz,2H),4.48–4.43(m,2H),3.90–3.48(m,4H),3.30–3.10(m,4H),1.39(t,J=7.2Hz,3H).MS(M+H) + =449.2.

[0809] Example 13 - Preparation of Compound 19A

[0810]

[0811] Step 1 – Synthesis of 4-(4-nitrophenoxy)piperidine: A solution of benzyl 4-(4-nitrophenoxy)piperidine-1-carboxylate (1.8 g, 5.05 mmol, 1 eq) in HBr (30% in AcOH) (5 mL) was stirred at 15°C for 1 hour. LCMS indicated the formation of the desired compound. MTBE (20 mL) was added to the mixture, stirred for 5 minutes, and filtered to afford 4-(4-nitrophenoxy)piperidine (1.3 g, 4.29 mmol, 84.90% yield, HBr) as a pink solid. 1 H NMR (400MHz, chloroform-d) δ = 8.55 (brs, 2H), 8.26-8.11 (m, 2H), 7.29-7.08 (m, 2H), 4.87 (tt, J = 3.6, 7.6Hz, 1H), 3.51 (br s, 1H), 3.26 (br s,2H),3.15-3.00(m,2H),2.14(ddd,J=3.4,7.0,10.3Hz,2H),1.93-1.74(m,2H).MS(M+H) + =223.1.

[0812]

[0813] Step 2 - Synthesis of 9H-fluoren-9-ylmethyl 4-(4-nitrophenoxy)piperidine-1-carboxylate: To a solution of 4-(4-nitrophenoxy)piperidine (1.3 g, 4.29 mmol, 1 eq, HBr) and NaHCO3 (1.44 g, 17.15 mmol, 667.15 μL, 4 eq) in a mixed solution of THF (12 mL) and H2O (3 mL) was added Fmoc-Cl (1.66 g, 6.43 mmol, 1.5 eq) dropwise at 0°C, followed by stirring at 15°C for 3 hours. TLC (petroleum ether:ethyl acetate = 3:1, R f =0.69) indicated the reaction was complete. The mixture was separated. The aqueous layer was extracted with ethyl acetate (20 mL). The combined organic phases were dried over anhydrous Na2SO4 and concentrated to dryness in vacuo. The crude product was purified by flash column chromatography (ISCO 20 g silica, 0-8% ethyl acetate / petroleum ether, gradient over 30 min) to afford 9H-fluoren-9-ylmethyl 4-(4-nitrophenoxy)piperidine-1-carboxylate (1.8 g, 4.05 mmol, 94.44% yield) as a yellow solid. 1HNMR (400MHz, DMSO-d6) δ = 7.40-7.34 (m, 2H), 7.07 (d, J = 7.5Hz, 2H), 6.81 (d, J = 7.3Hz, 2H), 6.62-6.56 (m, 2H), 6.54-6.49 (m, 2H), 6.39-6.34(m,2H),3.97-3.90(m,1H),3.59(brs,2H),3.48-3.43(m,1H),2.43-2.33(m,2H),1.68(td,J=1.7,3.6Hz,2H),1.05(br s,2H),0.65(br s,2H).

[0814]

[0815] Step 3 - Synthesis of 9H-fluoren-9-ylmethyl 4-(4-aminophenoxy)piperidine-1-carboxylate: 9H-fluoren-9-ylmethyl 4-(4-nitrophenoxy)piperidine-1-carboxylate (1.6 g, 3.60 mmol, 1 eq) was dissolved in THF (20 mL) and acetic acid (2.16 g, 36.00 mmol, 2.06 mL, 10 eq) was added. The mixture was cooled to 0°C and Zn (4.71 g, 71.99 mmol, 20 eq) was added portionwise. The reaction was warmed to 15°C and maintained for 1 hour. TLC (petroleum ether:ethyl acetate = 3:1, R f =0.10) indicated the reaction was complete. The mixture was filtered through celite to obtain a filtrate, which was washed with 10% NaHCO3 solution (20 mL) and brine (20 mL), dried over Na2SO4, and concentrated in vacuo to give 9H-fluoren-9-ylmethyl 4-(4-aminophenoxy)piperidine-1-carboxylate (1.7 g, crude) as a yellow gum. 1 H NMR (400MHz, DMSO-d6) δ = 7.89 (d, J = 7.5Hz, 2H), 7.63 (d, J = 7.3Hz, 2H), 7.47-7.38 (m, 2H),7.37-7.28(m,2H),6.72-6.62(m,2H),6.53-6.46(m,2H),4.64(brs,2H),4.39(br d,J=5.9Hz,2H),4.30-4.25(m,1H),4.21(tt,J=3.6,7.7Hz,1H),3.57(brs,2H),3.22-3.08(m,2H),1.83-1.65(m,2H),1.38(br d,J=15.8Hz,2H).

[0816]

[0817] Step 4 - Synthesis of diethyl 2-[[4-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidinyl]oxy]anilino]methylene]malonate: A solution of diethyl 2-(ethoxymethylene)malonate (1.57 g, 7.24 mmol, 1.46 mL, 2 eq) and 9H-fluoren-9-ylmethyl 4-(4-aminophenoxy)piperidine-1-carboxylate (1.5 g, 3.62 mmol, 1 eq) in EtOH (20 mL) was stirred at 80 °C for 14 h. TLC (petroleum ether:ethyl acetate = 2:1, R f =0.43) indicated the reaction was complete. The mixture was concentrated in vacuo to give diethyl 2-[[4-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidinyl]oxy]anilino]methylene]malonate (3.4 g, crude) as a yellow gum.

[0818]

[0819] Step 5 – Synthesis of ethyl 6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidinyl]oxy]-4-hydroxy-quinoline-3-carboxylate: Diethyl 2-[[4-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidinyl]oxy]anilino]methylene]malonate (300 mg, 513.12 μmol, 1 eq) in POCl3 (3 mL) and PPA (150 mg) was stirred at 75°C for 2 hours. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo and dissolved in ethyl acetate (2 mL). The solution was added dropwise to ice water (5 mL) and stirred for 5 minutes before separation. The aqueous layer was extracted with ethyl acetate (5 mL x 2), and the combined organic phases were dried over Na2SO4 and concentrated in vacuo. The crude product was purified by flash column (ISCO 10 g silica, 0-100% ethyl acetate / petroleum ether, gradient 30 min) to afford ethyl 6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidinyl]oxy]-4-hydroxy-quinoline-3-carboxylate (170 mg, 315.64 μmol, 61.51% yield) as a yellow gum. MS (M+H) + =539.2

[0820]

[0821] Step 6 – Synthesis of ethyl 4-chloro-6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidinyl]oxy]quinoline-3-carboxylate: Synthesis of 2-[[3-ethoxycarbonyl-6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidinyl]oxy]-4-quinolinyl]amino]benzoic acid: Ethyl 6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidinyl]oxy]-4-hydroxy-quinoline-3-carboxylate (170 mg, 315.64 μmol, 1 eq) in POCl₃ (2 mL) was stirred at 110°C for 3 hours. LCMS showed the desired MS was detected. The mixture was concentrated in vacuo and dissolved in ethyl acetate (3 mL). The solution was added dropwise to ice water (4 mL), separated, and extracted with ethyl acetate (5 mL x 2). The combined organic layers were washed with 10% NaHCO₃ (3 mL), dried over Na₂SO₄, and concentrated in vacuo. The crude product was purified by flash column chromatography (ISCO 10 g silica, 0-30% ethyl acetate / petroleum ether, gradient over 30 min) to afford ethyl 4-chloro-6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidinyl]oxy]quinoline-3-carboxylate (70 mg, 125.67 μmol, 39.81% yield) as a yellow solid. MS (M+H) + =557.1

[0822]

[0823] Step 7 – Synthesis of 2-[[3-ethoxycarbonyl-6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidinyl]oxy]-4-quinolinyl]amino]benzoic acid: A solution of ethyl 4-chloro-6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidinyl]oxy]quinoline-3-carboxylate (58 mg, 104.12 μmol, 1 eq) and 2-aminobenzoic acid (14.56 mg, 106.21 μmol, 1.02 eq) in ACN (1 mL) was stirred at 90°C for 2 h. LCMS indicated the desired MS was found. The mixture was filtered to give 2-[[3-ethoxycarbonyl-6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidinyl]oxy]-4-quinolinyl]amino]benzoic acid (50 mg, 76.02 μmol, 73.01% yield) as a yellow solid. 1H NMR (400MHz, DMSO-d6) δ = 11.55 (br s, 1H), 9.07 (s, 1H), 8.11 (d, J = 9.3Hz, 1H), 8.05 (br d,J=7.5Hz,1H),7.90(d,J=7.7Hz,2H),7.67-7.60(m,3H),7.56-7.50(m,1H),7.46-7.39(m,2H),7.35(br t,J=7.4Hz,3H),7.19-7.12(m,2H),4.43(br s,2H),4.28(br t,J=6.0Hz,1H),4.20(br s,3H),3.72-3.50(m,2H),3.04-2.84(m,2H),1.59(br s,2H),1.29(t,J=7.1Hz,5H).MS(M+H) + =658.2.

[0824]

[0825] Step 8 - Synthesis of 2-[[3-Ethoxycarbonyl-6-(4-piperidinyloxy)-4-quinolyl]amino]benzoic acid: 2-[[3-Ethoxycarbonyl-6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidinyl]oxy]-4-quinolyl]amino]benzoic acid (45 mg, 68.42 μmol, 1 eq) and DBU (11.46 mg, 75.26 μmol, 11.34 μL, 1.1 eq) in DCM (1 mL) were stirred at 15°C for 4 hours. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo and dissolved in DMF (3 mL). The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100×25 mm×5 μm column; 15%-45% acetonitrile / 10 mM aqueous NH 4 HCO 3 solution, 8 min gradient) to give 2-[[3-ethoxycarbonyl-6-(4-piperidinyloxy)-4-quinolinyl]amino]benzoic acid (5.45 mg, 12.17 μmol, 17.78% yield, 97.22% purity) as a pale yellow solid. 1H NMR (400MHz, DMSO-d6) δ = 11.71 (s, 1H), 9.22 (br s,2H),8.99(s,1H),8.19(d,J=9.0Hz,1H),8.05(d,J=7.9Hz,1H),7.75(dd,J=2.3,9.2Hz,1H),7.61-7.55(m,1H),7.49(br s,1H),7.45-7.39(m,1H),7.29(d,J=7.7Hz,1H),5.75(s,1H),4.53(br s,1H),3.92(br s,2H),3.14(br s,2H),2.94(br s,2H),1.98(br s,2H),1.78(br s,2H),1.22(t,J=7.1Hz,3H).MS(M / 2+H) + =218.7

[0826] Example 14 - Preparation of Compound 23A

[0827]

[0828] To a solution of 2-[(6-bromo-3-ethoxycarbonyl-4-quinolyl)amino]benzoic acid (100 mg, 240.83 μmol, 1 eq), Pd(OAc)2 (5.41 mg, 24.08 μmol, 0.1 eq), PPh3 (12.63 mg, 48.17 μmol, 0.2 eq), and K3PO4 (204.48 mg, 963.31 μmol, 4 eq) in DMF (1 mL) and H2O (0.1 mL) was added 1H-indol-4-ylboronic acid (77.53 mg, 481.65 μmol, 2 eq). The mixture was degassed and purged with N2 five times, then stirred at 80°C under N2 for 14 hours. LCMS showed the reaction was complete. The mixture was filtered to obtain a filtrate. The crude product was purified by preparative HPLC (Phenomenex Luna C18 150×30 mm×5 μm column; 20%-50% acetonitrile / 0.04% aqueous HCl solution, 10 min gradient) to give 2-[[3-ethoxycarbonyl-6-(1H-indol-4-yl)-4-quinolinyl]amino]benzoic acid (63.1 mg, 134.83 μmol, 55.99% yield, 96.47% purity) as a yellow solid. 1H NMR (400MHz, DMSO-d6) δ = 11.69 (br s, 1H), 11.40 (br s,1H),9.17(s,1H),8.37-8.30(m,1H),8.29-8.24(m,1H),8.18(s,1H),8.05(d,J=7.7Hz,1H),7.65-7.57(m,1H),7.49-7.36(m,3H),7.33(br d,J=7.9Hz,1H),7.13(t,J=7.7Hz,1H),6.86(d,J=7.2Hz,1H),6.28(br s,1H),4.19(br s,2H),1.28(t,J=7.1Hz,3H).MS(M+H) + =452.0.

[0829] Example 15 - Preparation of Compound 25A

[0830]

[0831] Synthesis of ethyl 4-(2-cyanoanilino)-6-(trifluoromethoxy)quinoline-3-carboxylate: Ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (50 mg, 156.41 μmol, 1 eq) and 2-aminobenzonitrile (20.33 mg, 172.06 μmol, 1.1 eq) were added to ACN (2 mL) and stirred at 90°C for 12 hours. LCMS indicated the reaction was complete. The mixture was filtered to obtain a filter cake. The crude product was purified by preparative HPLC (Waters Xbridge Prep OBD C18 150×40 mm×10 μm column; 25%-55% acetonitrile / 0.04% ammonia solution and 10 mM NH 4 HCO 3 aqueous solution, 10 min gradient) to give ethyl 4-(2-cyanoanilino)-6-(trifluoromethoxy)quinoline-3-carboxylate (17.5 mg, 43.39 μmol, 27.74% yield, 99.5% purity) as an off-white solid. 1 H NMR (400MHz, DMSO-d6)δ=9.88(br s,1H),8.98(br s,1H),8.13(br s,2H),7.82(br s,2H),7.54(br s,1H),7.34-6.99(m,2H),3.98(br s,2H),1.14(br s,3H).MS(M+H) + =402.0.

[0832] Example 16 - Preparation of Compound 26A

[0833]

[0834] Step 1 – Synthesis of 6-bromo-4-chloro-quinoline-3-carboxylic acid ethyl ester: 6-bromo-4-oxo-1H-quinoline-3-carboxylic acid ethyl ester (1.5 g, 5.07 mmol, 1.0 eq) was added to POCl3 (15 mL) at 0°C and then stirred at 110°C for 3 hours. LCMS showed that approximately 2% of the starting material remained. The mixture was cooled to room temperature and concentrated in vacuo to remove excess solvent. The residue was added dropwise to a mixture of ice water (10 mL) and ethyl acetate (10 mL), separated, and extracted with ethyl acetate (10 mL x 2). The combined organic layers were washed with 10% NaHCO3 and concentrated in vacuo to give 6-bromo-4-chloro-quinoline-3-carboxylic acid ethyl ester (1.41 g, 4.48 mmol, 88.49% yield) as an off-white solid. 1 H NMR (400 MHz, chloroform-d) δ = 9.20 (s, 1H), 8.56 (d, J = 2.0 Hz, 1H), 8.03 (d, J = 8.8 Hz, 1H), 7.91 (dd, J = 2.1, 8.9 Hz, 1H), 4.51 (q, J = 7.1 Hz, 2H), 1.47 (t, J = 7.1 Hz, 3H). MS (M+H) + = 315.9.

[0835]

[0836] Step 2 - Synthesis of 2-[(6-bromo-3-ethoxycarbonyl-4-quinolyl)amino]benzoic acid: 2-Aminobenzoic acid (191.82 mg, 1.40 mmol, 1.1 eq) and ethyl 6-bromo-4-chloro-quinoline-3-carboxylate (400 mg, 1.27 mmol, 1 eq) were added to ACN (2 mL) and stirred at 90° C. for 12 hours. LCMS showed the reaction was complete. The mixture was filtered to give a crude product (503.5 mg). 50 mg of the crude product was purified by preparative HPLC (Phenomenex Luna C18 150×30 mm×5 μm column; 15%-50% acetonitrile / 0.04% aqueous HCl, 10 min gradient) to give 2-[(6-bromo-3-ethoxycarbonyl-4-quinolyl)amino]benzoic acid (39.14 mg) as a yellow solid. 1 H NMR(400MHz,DMSO-d6)δ=11.57(br s,1H),9.05(s,1H),8.26(s,1H),8.17-8.11(m,2H),8.09-8.03(m,1H), 7.59-7.51(m,1H),7.39(t,J=7.5Hz,1H),7.24(d,J=8.1Hz,1H),4.04(br s,2H),1.20(t,J=7.1Hz,3H).MS(M+H)+ =415.0.

[0837] Example 17 - Preparation of Compound 27A

[0838]

[0839] Synthesis of 14-oxo-7-(trifluoromethoxy)-17,18,19-triazatetracyclooctadecan-(4),1(8),2(7),3(9),5(10),6(17),11,13(18)-octaene-8-carboxylic acid: To a stirred solution of 2-aminopyridine-3-carboxylic acid (64.81 mg, 469.24 μmol, 3 eq) in DMF (2 mL) was added NaH (50.05 mg, 1.25 mmol, 60% purity, 8.0 eq) at 0°C. The suspension was stirred at 0°C for 20 minutes, and then ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (50 mg, 156.41 μmol, 1 eq) dissolved in DMF (0.5 mL) was added dropwise. The mixture was then heated to 100°C and stirred at 100°C for 12 hours. LCMS showed complete consumption of the starting material and formation of the desired product. The crude product was purified by preparative HPLC: column: Phenomenex Luna C18 100×30 mm×5 μm; mobile phase: [water (0.04% HCl)-ACN]; B%: 10%-40%, 10 min. 14-Oxo-7-(trifluoromethoxy)-17,18,19-triazatetracyclooctadecan-(4),1(8),2(7),3(9),5(10),6(17),11,13(18)-octaene-8-carboxylic acid (2.75 mg, 6.60 μmol, 4.22% yield, 98.82% purity, HCl) was obtained as a yellow solid. 1 H NMR (400MHz, CDCl3) δ = 9.59 (s, 1H), 9.27 (d, J = 5.6Hz, 1H), 8.65 (d, J = 5.6Hz, 1H), 8.49 (s, 1H), 8.31 (d,J=9.2Hz,1H),8.03(dd,J=2.4,9.2Hz,1H),7.53(s,J=7.2Hz,1H),7.17(t,J=10.8Hz,1H).MS(MH) + =376.1.

[0840] Example 18 - Preparation of Compound 28A

[0841]

[0842] Synthesis of 4-[(3-carboxy-2-pyridinyl)amino]-6-(trifluoromethoxy)quinoline-3-carboxylic acid: To a stirred solution of 2-aminopyridine-3-carboxylic acid (129.63 mg, 938.49 μmol, 3 eq) in DMF (4 mL) at 0°C was added NaH (100.10 mg, 2.50 mmol, 60% purity, 8.0 eq). The suspension was stirred at 0°C for 20 minutes, followed by the dropwise addition of ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (100 mg, 312.83 μmol, 1 eq) dissolved in DMF (0.5 mL). The mixture was then heated to 100°C and stirred at 100°C for 12 hours. LCMS indicated complete consumption of the starting material and formation of the desired product. The mixture was quenched with saturated NH4Cl (8 mL), adjusted to pH ~7 by the addition of 12N HCl, and then concentrated to remove the solvent. The crude product was purified by preparative HPLC: Column: Waters Xbridge BEH C18 100 × 25 mm × 5 μm; Mobile phase: [water (10 mM NH4HCO3)-ACN]; B%: 5%-35% over 8 min. 4-[(3-carboxy-2-pyridinyl)amino]-6-(trifluoromethoxy)quinoline-3-carboxylic acid (6.72 mg, 14.20 μmol, 4.54% yield, 83.11% purity) was obtained as a yellow solid. 1 HNMR (400MHz, CDCl3) δ = 9.12 (s, 1H), 8.25 (d, J = 6.0Hz, 1H), 8.12 (d, J = 12.0Hz, 1H), 8.05(d,J=2.8Hz,1H),7.78–7.60(m,2H),7.19(brs,2H),6.95–6.92(m,1H).MS(MH) + =391.9.

[0843] Example 19 - Preparation of Compound 29A

[0844]

[0845] Synthesis of 2-[[3-ethoxycarbonyl-6-(5-hydroxyindol-1-yl)-4-quinolyl]amino]benzoic acid: To a solution of 2-[(6-bromo-3-ethoxycarbonyl-4-quinolyl)amino]benzoic acid (100 mg, 240.83 μmol, 1 eq), Pd(dba) (29.99 mg, 32.75 μmol, 0.136 eq), t-BuOK (81.07 mg, 722.48 μmol, 3 eq), and Xantphos (29.96 mg, 51.78 μmol, 0.215 eq) in DMF (1 mL) was added 1H-indol-5-ol (48.10 mg, 361.24 μmol, 1.5 eq), degassed and purged with N for three times, then stirred at 110° C. under N for 14 h. LCMS showed the reaction was complete. The mixture was filtered to obtain a filtrate. The crude product was purified by preparative HPLC (Welch Xtimate C18 150×25 mm×5 μm column; 5%-35% acetonitrile / 0.05% aqueous HCl, 10 min gradient) to afford 2-[[3-ethoxycarbonyl-6-(5-hydroxyindol-1-yl)-4-quinolinyl]amino]benzoic acid (6.11 mg, 13.00 μmol, 5.40% yield, 99.49% purity) as a yellow solid. 1 HNMR(400MHz,DMSO-d6)δ=13.76(br s,1H),8.92(s,1H),8.18-8.07(m,2H),8.02-7.98(m,1H),7.93(d,J=7.5Hz,1H),7.56(d,J=3.2Hz,1H),7.29-7.14(m,3H),6.97-6.86 (m,2H),6.75(d,J=8.1Hz,1H),6.63(dd,J=1.9,8.9Hz,1H),6.54(d,J=3.2Hz,1H),3.99(q,J=6.9Hz,2H),1.04(t,J=7.1Hz,3H).MS(MH) + =466.0.

[0846] Example 20 - Preparation of Compound 30A

[0847]

[0848] Synthesis of 6-(trifluoromethoxy)-14,15,16,17-tetraazatetracycloheptadecan-(6),1(7),2(8),3(15),4(9),5(16),10-heptaen-12-one: A solution of ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (100 mg, 312.83 μmol, 1 eq) and 5-amino-1H-pyrazole-4-carboxylic acid (119.28 mg, 938.49 μmol, 3 eq) in DMF (1 mL) was stirred at 110°C for 14 hours. LCMS showed the reaction was complete and the desired product was detected. The mixture was filtered to obtain a filtrate. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100×25 mm×5 μm column; 20%-50% acetonitrile / 10 mM NH4HCO3 aqueous solution, 8 min gradient) to give (trifluoromethoxy)-14,15,16,17-tetraazatetracycloheptadecan-(6),1(7),2(8),3(15),4(9),5(16),10-hepten-12-one (6.80 mg, 21.00 μmol, 6.71% yield, 98.89% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=13.95-13.35(m,1H),9.31(s,1H),8.56(brs,1H),8.08(d,J=1.8Hz,1H),8.05(br d,J=9.0Hz,1H),7.94-7.79(m,1H),6.48(d,J=1.8Hz,1H).MS(M+H) + =321.0.

[0849] Example 21 - Preparation of Compound 31A

[0850]

[0851] Synthesis of 14-oxo-7-(trifluoromethoxy)-17,18,19,20-tetraazatetracycloheptadecan-1(7),2(8),3(9),4(18),5(19),10,12-heptadecene-12-carboxylic acid ethyl ester: A solution of ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (100 mg, 312.83 μmol, 1 eq) and ethyl 5-amino-1H-imidazole-4-carboxylate (145.61 mg, 938.49 μmol, 3 eq) in DMF (1 mL) was stirred at 110°C for 14 hours. LCMS showed the reaction was complete. The mixture was filtered to obtain a filtrate. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100×25 mm×5 μm column; 25%-45% acetonitrile / 10 mM NH4HCO3 aqueous solution, 8 min gradient) to give 14-oxo-7-(trifluoromethoxy)-17,18,19,20-tetraazatetracycloheptadecan-1(7),2(8),3(9),4(18),5(19),10,12-heptaene-12-carboxylic acid ethyl ester (1.56 mg, 3.78 μmol, 1.21% yield, 95.02% purity). 1 H NMR (400MHz, DMSO-d6) δ = 9.54 (s, 1H), 9.05 (s, 1H), 8.81-8.74 (m, 1H), 8.40 (d, J = 9.2Hz, 1H), 8.08 (br d,J=8.9Hz,1H),4.35(q,J=7.1Hz,2H),1.33(t,J=7.0Hz,3H).MS(M+H) + =393.1.

[0852] Example 22 - Preparation of Compound 32A

[0853]

[0854] Step 1-Synthesis of ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate: ethyl 4-hydroxy-6-(trifluoromethoxy)quinoline-3-carboxylate (3.00 g, 9.96 mmol, 1 eq) was added to POCl3 (20 mL) at 0 ° C and then stirred at 110 ° C for 2 hours. LCMS showed that the starting material was completely consumed and the reaction was complete. The mixture was cooled to room temperature and concentrated in vacuo to remove excess solvent. A mixture of ice water (10 mL) and ethyl acetate (20 mL) was added dropwise to the residue, separated, and extracted with ethyl acetate (20 ml × 2). The combined organic layer was washed with 10% NaHCO3, dried over anhydrous sodium sulfate, and concentrated in vacuo. The crude product was purified by flash column (ISCO 20 g silica, 0-6% ethyl acetate / petroleum ether, gradient 30 min) to give ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (2.6 g, 8.13 mmol, 81.67% yield, -purity) as a white solid. MS (M+H) + =320.0.

[0855]

[0856] Step 2-2-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid synthesis: 2-aminobenzoic acid (707.85 mg, 5.16 mmol, 1.1 eq) and ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (1.5 g, 4.69 mmol, 1 eq) were added to ACN (15 mL) and then stirred at 90 ° C for 14 hours. LCMS showed that the reaction was complete. The mixture was filtered to obtain a filter cake. The crude product was purified by recrystallization from methanol (5 mL) at 65 ° C, cooled to room temperature, stirred for 0.5 hours, and filtered to obtain 2-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid (1610.97 mg, 3.83 mmol, 81.78% yield, 98.63% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ = 11.84 (brs, 1H), 9.09 (s, 1H), 8.41 (d, J = 9.3Hz, 1H), 8.15-7.99 ( m,2H),7.89(s,1H),7.59-7.51(m,1H),7.47-7.40(m,1H),7.33(d,J=7.9Hz,1H),4.13(br s,2H),1.25(t,J=7.2Hz,3H).MS(M+H) + =421.0.

[0857] Example 23 - Preparation of Compound 33A

[0858]

[0859] Synthesis of ethyl 5-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolinyl]amino]thiazole-4-carboxylate: A solution of ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (100 mg, 312.83 μmol, 1 eq) and ethyl 5-aminothiazole-4-carboxylate (161.61 mg, 938.49 μmol, 3.0 eq) in DMF (4 mL) was stirred at 110°C for 12 hours. LCMS showed complete consumption of the starting material and formation of the desired product. The mixture was purified by preparative HPLC using a Waters Xbridge BEHC18 column (100 × 25 mm × 5 μm); mobile phase (water (10 mM NH4HCO3)-ACN); B%: 35%-65% over 8 min. Ethyl 5-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolyl]amino]thiazole-4-carboxylate (5.51 mg, 12.08 μmol, 2.75% yield, 99.86% purity) was obtained as a light yellow solid. 1 H NMR (400MHz, chloroform-d) δ = 9.38 (s, 1H), 8.19 (d, J = 9.2Hz, 1H), 8.09 (s, 1H), 7.77 ( s,1H),7.67(d,J=9.2Hz,1H),4.59–4.49(m,4H),1.52–1.34(m,6H).MS(M+H) + =456.1.

[0860] Example 24 - Preparation of Compound 34A

[0861]

[0862] Step 1 – Synthesis of 2-Nitro-N-(2,2,2-trifluoroethyl)benzenesulfonamide: To a solution of 2-nitrobenzenesulfonyl chloride (1 g, 4.51 mmol, 1 eq) in dioxane (10 mL) at 0°C was added 2,2,2-trifluoroethylamine (491.66 mg, 4.96 mmol, 390.21 μL, 1.1 eq) and TEA (502.26 mg, 4.96 mmol, 690.86 μL, 1.1 eq). The mixture was then stirred at 15°C for 14 hours. TLC (petroleum ether:ethyl acetate = 5:1, Rf = 0.28) indicated the reaction was complete with no residual starting material. The mixture was poured into ice water (5 mL) and stirred for 5 minutes. Ethyl acetate (10 mL) was added to the solution, separated, and extracted with ethyl acetate (5 mL x 2). The combined organic layers were dried over anhydrous Na 2 SO 4 , filtered, and concentrated in vacuo to give 2-nitro-N-(2,2,2-trifluoroethyl)benzenesulfonamide (1 g, crude) as a light yellow solid.1 H NMR (400MHz, DMSO-d6) δ = 9.16 (t, J = 6.5Hz, 1H), 8.07-8.03 (m, 1H), 8.03-7.98 (m, 1H), 7.91-7.86 (m, 2H), 3.96-3.80 (m, 2H).

[0863]

[0864] Step 2 - Synthesis of 2-amino-N-(2,2,2-trifluoroethyl)benzenesulfonamide: A solution of 2-nitro-N-(2,2,2-trifluoroethyl)benzenesulfonamide (500 mg, 1.76 mmol, 1 eq), Fe (491.23 mg, 8.80 mmol, 5 eq), and NHCl (282.31 mg, 5.28 mmol, 3 eq) in a mixture of methanol (4 mL) and HO (2 mL) was stirred at 80°C for 14 hours. LCMS indicated the desired MS. The mixture was filtered to obtain a filtrate, which was concentrated in vacuo to afford 2-amino-N-(2,2,2-trifluoroethyl)benzenesulfonamide (350.2 mg, 1.38 mmol, 78.30% yield) as a light yellow solid. 1 HNMR(400MHz,DMSO-d6)δ=8.48(br t,J=6.5Hz,1H),7.51(dd,J=1.0,8.0Hz,1H),7.33-7.20(m,1H),6.86-6.80(m,1H),6.62(t,J=7.4Hz,1H),5.97-5.89(m,2H),3.75-3.52(m,2H).

[0865]

[0866] Step 3 - Synthesis of ethyl 4-[2-(2,2,2-trifluoroethylsulfamoyl)anilino]-6-(trifluoromethoxy)quinoline-3-carboxylate: A solution of 2-amino-N-(2,2,2-trifluoroethyl)benzenesulfonamide (209.96 mg, 825.87 μmol, 1.1 eq) and ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (240 mg, 750.79 μmol, 1 eq) in ACN (2 mL) was stirred at 90°C for 4 hours. LCMS indicated the desired MS was detected. The mixture was concentrated in vacuo to remove the solvent. The crude product was purified by preparative HPLC (Waters Xbridge Prep OBD C18 150×40 mm×10 μm column; 15%-45% acetonitrile / 0.04% ammonia solution and 10 mM NH 4 HCO 3 aqueous solution, 10 min gradient) to give ethyl 4-[2-(2,2,2-trifluoroethylsulfamoyl)anilino]-6-(trifluoromethoxy)quinoline-3-carboxylate (78.65 mg, 139.11 μmol, 18.53% yield, 95.06% purity) as an off-white solid. 1H NMR (400MHz, DMSO-d6)δ=10.30(br s,1H),9.26(br s,1H),9.12(br s,1H),8.13(br d,J=9.3Hz,1H),7.91(d,J=6.8Hz,1H),7.79-7.72(m,1H),7.47-7.35(m,1H),7.31-7.22(m,2H),6.83(d,J=7.9Hz,1H),4.40(br d,J=6.6Hz,2H),3.93-3.79(m,2H),1.37(t,J=7.1Hz,3H).MS(M+H)+=538.1.

[0867] Example 25 - Preparation of Compound 51A

[0868]

[0869] Step 1 - Synthesis of 1-methoxy-2-(3-methoxypropoxy)-4-nitro-benzene: To a solution of 2-methoxy-5-nitro-phenol (25 g, 147.81 mmol, 1 eq), NaI (33.23 g, 221.72 mmol, 1.5 eq), and Cs2CO3 (96.32 g, 295.62 mmol, 2 eq) in DMF (250 mL) was added dropwise 1-bromo-3-methoxy-propane (22.62 g, 147.81 mmol, 1 eq). The mixture was stirred at 100°C for 2 hours. TLC (petroleum ether:ethyl acetate = 3:1, Rf = 0.43) indicated the reaction was complete. The suspension was filtered to obtain a filtrate. The filtrate was dissolved in ethyl acetate (100 mL) and water (30 mL), separated, and extracted with ethyl acetate (50 × 2 mL). The combined organic layers were washed with water (20 mL x 3), dried over Na2SO4, filtered, and concentrated in vacuo to give 1-methoxy-2-(3-methoxypropoxy)-4-nitro-benzene (20.4 g, 84.56 mmol, 57.21% yield, -purity) as a light yellow solid. 1 H NMR (400MHz, DMSO-d6) δ = 7.89 (dd, J = 2.7, 8.9Hz, 1H), 7.71 (d, J = 2.7Hz, 1H), 7.16 (d, J = 8.9Hz, 1H), 4. 11(t,J=6.4Hz,2H),3.90(s,3H),3.47(t,J=6.3Hz,2H),3.28-3.23(m,3H),1.97(quin,J=6.4Hz,2H).

[0870]

[0871] Step 2 – Synthesis of 4-methoxy-3-(3-methoxypropoxy)aniline: A solution of 1-methoxy-2-(3-methoxypropoxy)-4-nitro-benzene (20.4 g, 84.56 mmol, 1 eq), Fe (40.14 g, 718.79 mmol, 8.5 eq), and NHCl (40.71 g, 761.07 mmol, 9 eq) in a mixture of methanol (160 mL) and H2O (80 mL) was stirred at 80°C for 4 hours. TLC (petroleum ether:ethyl acetate = 3:1, Rf = 0.24) indicated complete consumption of the starting material. The mixture was filtered to obtain a filtrate, which was then concentrated in vacuo. The residue was dissolved in ethyl acetate (100 mL), separated, and extracted with ethyl acetate (100 mL x 3). The combined organic layers were dried over Na2SO4 and concentrated in vacuo to afford 4-methoxy-3-(3-methoxypropoxy)aniline (19 g, crude) as a brown oil.

[0872]

[0873] Step 3 - Synthesis of (E)-2-cyano-3-[4-methoxy-3-(3-methoxypropoxy)anilino]prop-2-enoic acid ethyl ester: A solution of 4-methoxy-3-(3-methoxypropoxy)aniline (19 g, 89.94 mmol, 1 eq) and (E)-2-cyano-3-ethoxy-prop-2-enoate (15.22 g, 89.94 mmol, 1 eq) in toluene (200 mL) was stirred at 110°C for 14 hours. TLC (petroleum ether:ethyl acetate = 3:1, Rf = 0.43) showed complete consumption of the reactants. The mixture was concentrated in vacuo to afford (E)-2-cyano-3-[4-methoxy-3-(3-methoxypropoxy)anilino]prop-2-enoic acid ethyl ester (29.3 g, crude) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ = 10.74-10.57 (m, 1H), 8.51-8.40 (m, 0.5H), 8.25 (br s,0.5H),7.21(d,J=1.8Hz,0.5H),7.07(d,J=1.5Hz,0.5H),6.96-6.83(m,2H),4.30-4.10(m,2H),4.06-3.95(m,2H), 3.74(s,3H),3.47(t,J=6.1Hz,2H),3.25(s,3H),2.02-1.91(m,2H),1.32-1.21(m,1H),1.25(td,J=7.0,11.8Hz,2H).

[0874]

[0875] Step 4 – Synthesis of 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonitrile: A solution of ethyl (E)-2-cyano-3-[4-methoxy-3-(3-methoxypropoxy)anilino]prop-2-enoate (400 mg, 1.20 mmol, 1 eq) in PhO (10 mL) was stirred at 270°C for 5 hours. TLC (petroleum ether:ethyl acetate = 2:1, Rf = 0.00) indicated the presence of a new spot. The mixture was cooled to room temperature, and then petroleum ether (10 mL) was added. The filter cake was filtered and dried under vacuum to afford 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonitrile (100 mg, 346.86 μmol, 28.99% yield) as a light-colored solid. 1H NMR(400MHz,DMSO-d6)δ=12.51(br s,1H),8.59(s,1H),7.44(s,1H),7.13-7.01(m,1H),4.11(t,J=6.4Hz,2H),3.86(s ,3H),3.49(t,J=6.2Hz,2H),3.33(s,5H),3.25(s,3H),2.08-1.97(m,2H).MS(M+H) + =289.1.

[0876]

[0877] Step 5 - Synthesis of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonitrile: To a solution of 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonitrile (80 mg, 277.49 μmol, 1 eq) in SOCl2 (1 mL) was added DMF (2.03 mg, 27.75 μmol, 2.14 μL, 0.1 eq) and stirred at 25°C for 14 hours. LCMS showed no detectable reactant and the desired MS was detected. The mixture was concentrated in vacuo to afford 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonitrile (90 mg, crude) as a brown gum. MS (M+H) = 307.1.

[0878]

[0879] Step 6 - Synthesis of 2-[[3-cyano-6-methoxy-7-(3-methoxypropoxy)-4-quinolinyl]amino]benzoic acid: A solution of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonitrile (80 mg, 260.80 μmol, 1 eq) and 2-aminobenzoic acid (35.77 mg, 260.80 μmol, 1 eq) in ACN (1 mL) was stirred at 90° C. for 3 hours. LCMS indicated approximately 70% of the desired product was detected. The suspension was concentrated in vacuo. The crude product was purified by preparative HPLC (Kromasil 150×25 mm×10 μm column; 35%-55% acetonitrile / 0.04% ammonia solution and 10 mM NH 4 HCO 3 aqueous solution, 10 min gradient) to give 2-[[3-cyano-6-methoxy-7-(3-methoxypropoxy)-4-quinolinyl]amino]benzoic acid (20.23 mg, 49.65 μmol, 19.04% yield, 100% purity) as a light yellow solid. 1H NMR(400MHz,DMSO-d6)δ=10.36(br s,1H),8.60(s,1H),7.97(d,J=7.7Hz,1H),7.54-7.46(m,2H),7.39(s,1H),7.17(t,J=7.5Hz,1H),7.11(d,J=8.2H z,1H),4.23(t,J=6.3Hz,2H),3.85(s,3H),3.51(t,J=6.2Hz,2H),3.27(s,3H),2.04(quin,J=6.2Hz,2H).MS(M+H) + =408.2.

[0880] Example 26 - Preparation of Compound 53A

[0881]

[0882] Step 1 - Synthesis of diethyl 2-[[4-methoxy-3-(3-methoxypropoxy)anilino]methylene]malonate: A solution of 4-methoxy-3-(3-methoxypropoxy)aniline (3 g, 14.20 mmol, 1 eq) and diethyl 2-(ethoxymethylene)malonate (3.07 g, 14.20 mmol, 2.87 mL, 1 eq) in toluene (30 mL) was stirred at 110 °C for 14 hours. TLC (petroleum ether:ethyl acetate = 3:1, R f =0.43) showed that the reactant was completely consumed.The mixture was concentrated in vacuo to give diethyl 2-[[4-methoxy-3-(3-methoxypropoxy)anilino]methylene]malonate (5.8 g, crude) as a yellow solid.

[0883]

[0884] Step 2 - Synthesis of ethyl 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxylate: A solution of diethyl 2-[[4-methoxy-3-(3-methoxypropoxy)anilino]methylene]malonate (5.3 g, 13.90 mmol, 1 eq) in Ph2O (100 mL) was stirred at 260 °C for 1 hour. TLC (petroleum ether:ethyl acetate = 2:1, R f =0.00) indicated that the reaction was complete. The mixture was cooled to room temperature, and then petroleum ether (100 mL) was added, stirred for 10 minutes, and filtered to give ethyl 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxylate (2.88 g, 8.59 mmol, 61.80% yield) as a brown solid. MS (M+H) + =336.1

[0885]

[0886] Step 3 – Synthesis of 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxylic acid: To a solution of ethyl 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxylate (2.8 g, 8.35 mmol, 1 eq) in MeOH (30 mL) was added NaOH (2 M, 41.75 mL, 10 eq) and stirred at 60°C for 14 hours. LCMS showed no reactant remaining and the desired MS was found. The mixture was concentrated in vacuo, dissolved in ethyl acetate (30 mL), and the aqueous layer was separated. This layer was acidified to pH = 5 with 1N HCl solution and filtered to afford 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxylic acid (2.2 g, 7.16 mmol, 85.74% yield) as a light-colored solid. 1 H NMR (400MHz, DMSO-d6) δ = 15.86 (br s, 1H), 8.73 (s, 1H), 7.54 (s, 1H), 7.24 (s, 1H), 4.15 (br t, J = 6.2Hz, 2H), 3.90 (s, 3H), 3.50 (br t,J=6.1Hz,2H),3.26(s,3H),2.10-2.00(m,2H).

[0887]

[0888] Step 4 - Synthesis of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride: A solution of 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxylic acid (500 mg, 1.63 mmol, 1 eq) in POCl (5 mL) was stirred at 100°C for 1 hour. LCMS (quenching the sample with 1 mL of glacial MeOH) indicated the reaction was complete. The mixture was concentrated in vacuo to afford 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride (580 mg, crude) as a brown oil.

[0889]

[0890] Step 5 – Synthesis of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride: To a solution of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride (560 mg, 1.63 mmol, 1 eq) in DCM (6 mL) was added TEA (658.55 mg, 6.51 mmol, 905.84 μL, 4 eq) and morpholine (141.75 mg, 1.63 mmol, 143.18 μL, 1 eq) at 0°C, followed by stirring at 25°C for 14 hours. LCMS indicated that the reactant was consumed, and the desired MS was detected. The mixture was dissolved in water (5 mL), separated, and extracted with ethyl acetate (5 mL x 3). The combined organic layers were dried over Na2SO4, filtered, and concentrated in vacuo. The crude product was purified by flash column (ISCO 20 g silica, 0-100% ethyl acetate / petroleum ether, gradient 30 min) to afford [4-chloro-6-methoxy-7-(3-methoxypropoxy)-3-quinolinyl]-morpholino-methanone (310 mg, 785.11 μmol, 48.25% yield) as a white solid. MS (M+H) + =395.1.

[0891]

[0892] Step 6 - Synthesis of [4-chloro-6-methoxy-7-(3-methoxypropoxy)-3-quinolinyl]-morpholino-methanone: A solution of [4-chloro-6-methoxy-7-(3-methoxypropoxy)-3-quinolinyl]-morpholino-methanone (150 mg, 379.89 μmol, 1 eq) and 2-aminobenzoic acid (62.52 mg, 455.87 μmol, 1.2 eq) in ACN (2 mL) was stirred at 90°C for 14 hours. LCMS indicated approximately 50% of the desired product and approximately 20% of the reactant was detected. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100×25 mm×5 μm column; 15%-45% acetonitrile / 10 mM aqueous NH 4 HCO 3 solution, 8 min gradient) to give 2-[[6-methoxy-7-(3-methoxypropoxy)-3-(morpholine-4-carbonyl)-4-quinolinyl]amino]benzoic acid (91.92 mg, 185.50 μmol, 48.83% yield, 100% purity) as a yellow solid. 1 HNMR (400 MHz, DMSO-d 6,T=273+80K)δ=8.50(s,1H),7.99-7.93(m,1H),7.40(s,1H),7.27(s,1H),7.24-7.17(m,1H),6.82(t,J =7.5Hz,1H),6.60(d,J=8.2Hz,1H),4.24(t,J=6.4Hz,2H),3.76(s,3H),3.54(t,J=6.3Hz,2H),3.37(br d,J=4.5Hz,4H),3.29(s,3H),3.27(br d,J=8.2Hz,4H),2.06(quin,J=6.4Hz,2H).MS(M+H) + =496.3.

[0893] Example 27 - Preparation of Compound 54A

[0894]

[0895] Step 1 – Synthesis of 6-bromo-4-chloro-quinoline-3-carbonitrile: To a suspension of 6-bromo-4-hydroxy-quinoline-3-carbonitrile (0.23 g, 923.46 μmol, 1 eq) in SOCl2 (4.92 g, 41.35 mmol, 3 mL, 44.78 eq) at 0°C was added DMF (6.75 mg, 92.35 μmol, 7.11 μL, 0.1 eq), and the mixture was stirred at 25°C for 24 hours. TLC (petroleum ether:ethyl acetate = 0:1) indicated that the reactant was consumed and a new spot had formed. The mixture was concentrated, dissolved in toluene (5 mL x 2), and concentrated in vacuo to afford 6-bromo-4-chloro-quinoline-3-carbonitrile (0.25 g, crude) as a pale yellow solid.

[0896]

[0897] Step 2 – Synthesis of 2-[(6-bromo-3-cyano-4-quinolyl)amino]benzoic acid: A suspension of 6-bromo-4-chloro-quinoline-3-carbonitrile (0.15 g, 560.73 μmol, 1 eq) and 2-aminobenzoic acid (92.28 mg, 672.87 μmol, 1.2 eq) in ACN (7 mL) was stirred at 90°C for 12 hours. TLC (petroleum ether:ethyl acetate = 0:1) showed consumption of the reactant and the formation of a new spot. The mixture was concentrated in vacuo to afford 2-[(6-bromo-3-cyano-4-quinolyl)amino]benzoic acid (0.2 g, crude) as a light yellow solid. Note: An additional 0.1 g of the desired product was obtained using the same synthetic procedure.

[0898]

[0899] Step 3-Synthesis of 2-[[3-cyano-6-(5-quinolyl)-4-quinolyl]amino]benzoic acid: To a solution of 2-[(6-bromo-3-cyano-4-quinolyl)amino]benzoic acid (220 mg, 597.53 μmol, 1 eq), Pd(OAc)2 (13.42 mg, 59.75 μmol, 0.1 eq), PPh3 (31.35 mg, 119.51 μmol, 0.2 eq) and K3PO4 (507.35 mg, 2.39 mmol, 4 eq) in DMF (4 mL) and H2O (1 mL) was added 5-quinolylboronic acid (206.72 mg, 1.20 mmol, 2 eq). The mixture was degassed and purged with N2 5 times, then stirred at 80 ° C under N2 for 14 hours. LCMS showed that the reactants were consumed and the desired MS was detected. The mixture was filtered to obtain a filtrate. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100×25 mm×5 μm column; 15%-45% acetonitrile / 10 mM aqueous NH 4 HCO 3 solution, 8 min gradient) to give 2-[[3-cyano-6-(5-quinolinyl)-4-quinolinyl]amino]benzoic acid (136.08 mg, 320.24 μmol, 53.59% yield, 98.00% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ = 10.96-10.41 (m, 1H), 9.02 (d, J = 2.9Hz, 1H), 8.76 (s, 1H),8.58(s,1H),8.28(d,J=8.4Hz,1H),8.17(dd,J=5.3,8.4Hz,2H),8.05(br d,J=8.6Hz,1H),8.00-7.90(m,2H),7.74(d,J=7.1Hz,1H),7.66-7.57(m,2H),7.41(d,J=7.9Hz,1H),7.34(t,J=7.5Hz,1H).MS(M+H) + =417.2.

[0900] Example 28 - Preparation of Compound 55A

[0901]

[0902] Synthesis of 2-[[3-cyano-6-methoxy-7-(3-methoxypropoxy)-4-quinolinyl]amino]-6-hydroxy-benzoic acid: A solution of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonitrile (150 mg, 489.01 μmol, 1 eq) and 2-amino-6-hydroxy-benzoic acid (89.86 mg, 586.81 μmol, 1.2 eq) in ACN (0.5 mL) was stirred at 90°C for 14 hours. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters XbridgePrep OBD C18 150×40 mm×10 μm column; 10%-40% acetonitrile / 10 mM aqueous NH 4 HCO 3 solution, 8 min gradient) to give 2-[[3-cyano-6-methoxy-7-(3-methoxypropoxy)-4-quinolinyl]amino]-6-hydroxy-benzoic acid (13.96 mg, 32.43 μmol, 6.63% yield, 98.35% purity) as a yellow solid. 1H NMR (400MHz, DMSO-d6) δ = 8.67 (s, 1H), 7.54 (s, 1H), 7.35 (s, 1H), 7.17 (t, J = 8.0Hz, 1H), 6.52 (dd, J = 2.5, 8.0Hz, 2H), 4.21 (br t,J=6.3Hz,2H),3.87(s,3H),3.48-3.45(m,2H),3.26(s,3H),2.10-1.98(m,2H).MS(M+H) + =424.0.

[0903] Example 29 - Preparation of Compound 56A

[0904]

[0905] Synthesis of 1-[3-cyano-6-methoxy-7-(3-methoxypropoxy)-4-quinolinyl]-4-oxo-pyridine-3-carboxylic acid: A solution of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonitrile (150 mg, 489.01 μmol, 1 eq) and 4-oxo-1H-pyridine-3-carboxylic acid (95.24 mg, 684.61 μmol, 1.4 eq) in ACN (2 mL) was stirred at 90°C for 14 hours. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters XbridgeBEH C18 100×25 mm×5 μm column; 5%-35% acetonitrile / 10 mM aqueous NH 4 HCO 3 solution, 8 min gradient) to give 1-[3-cyano-6-methoxy-7-(3-methoxypropoxy)-4-quinolinyl]-4-oxo-pyridine-3-carboxylic acid (14.55 mg, 35.54 μmol, 7.27% yield, 100% purity) as a pale yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=9.19(s,1H),9.07(d,J=2.2Hz,1H),8.42(dd,J=2.3,7.6Hz,1H),7.66(s,1H),7.03(d,J=7.5Hz,1 H),6.93(s,1H),4.32(t,J=6.4Hz,2H),3.87(s,3H),3.50(t,J=6.2Hz,2H),3.26(s,3H),2.06(quin,J=6.3Hz,2H).MS(M+H) + =410.2.

[0906] Example 30 - Preparation of Compound 57A

[0907]

[0908] Step 1-Synthesis of 1-bromo-2-(3-methoxypropoxy)-4-nitro-benzene: A solution of 2-bromo-5-nitro-phenol (5 g, 22.94 mmol, 1 eq), 1-bromo-3-methoxy-propane (3.51 g, 22.94 mmol, 1 eq), NaI (5.16 g, 34.40 mmol, 1.5 eq) and Cs2CO3 (14.95 g, 45.87 mmol, 2 eq) in DMF (10 mL) was stirred at 100°C for 2 hours. TLC (petroleum ether:ethyl acetate = 3:1, R f=0.43) indicated that the reaction was complete. The suspension was filtered to obtain a filtrate. The filtrate was dissolved in ethyl acetate (20 mL) and water (30 mL), separated, and extracted with ethyl acetate (10 mL). The combined organic layer was washed with water (5 mL x 3), dried over Na2SO4, filtered, and concentrated to obtain 1-bromo-2-(3-methoxypropoxy)-4-nitro-benzene (6.3 g, 21.72 mmol, 94.68% yield) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ = 7.88 (dd, J = 1.5, 8.6Hz, 1H), 7.81 (s, 1H), 7.77-7.72 (m, 1H), 4. 25(t,J=6.2Hz,2H),3.51(t,J=6.3Hz,2H),3.28-3.24(m,3H),2.01(quin,J=6.0Hz,2H).

[0909]

[0910] Step 2 - Synthesis of 4-bromo-3-(3-methoxypropoxy)aniline: A solution of 1-bromo-2-(3-methoxypropoxy)-4-nitro-benzene (5.3 g, 18.27 mmol, 1 eq), Fe (8.67 g, 155.29 mmol, 8.5 eq), and NH4Cl (8.80 g, 164.42 mmol, 9 eq) in a mixture of methanol (40 mL) and H2O (20 mL) was stirred at 80°C for 4 hours. TLC (petroleum ether:ethyl acetate = 3:1, Rf = 0.24) indicated the reaction was complete. The mixture was filtered to obtain a filtrate, which was then concentrated in vacuo. The residue was dissolved in ethyl acetate (20 mL) and water (10 mL), separated, and extracted with ethyl acetate (20 mL x 2). The combined organic layers were dried over Na 2 SO 4 and concentrated in vacuo to give 4-bromo-3-(3-methoxypropoxy)aniline (4.0 g, 15.38 mmol, 84.17% yield) as a light yellow oil. 1 H NMR (400MHz, DMSO-d6) δ = 7.10 (d, J = 8.4Hz, 1H), 6.31 (d, J = 2.3Hz, 1H), 6.10 (dd, J = 2.4, 8.5Hz, 1H), 5.25 (br s,2H),3.96(t,J=6.3Hz,2H),3.50(t,J=6.3Hz,2H),3.25(s,3H),1.94(quin,J=6.3Hz,2H).

[0911]

[0912] Step 3 - Synthesis of diethyl 2-[[4-bromo-3-(3-methoxypropoxy)anilino]methylene]malonate: A solution of 4-bromo-3-(3-methoxypropoxy)aniline (4.0 g, 15.38 mmol, 1 eq) and diethyl 2-(ethoxymethylene)malonate (3.32 g, 15.38 mmol, 3.11 mL, 1 eq) in toluene (40 mL) was stirred at 110° C. for 4 hours. LCMS indicated the reaction was complete. The reaction mixture was concentrated in vacuo to afford diethyl 2-[[4-bromo-3-(3-methoxypropoxy)anilino]methylene]malonate (6.8 g, crude) as a brown gum. 1 H NMR(400MHz,DMSO-d6)δ=10.63(br d,J=13.9Hz,1H),8.36(d,J=13.7Hz,1H),7.51(d,J=8.6Hz,1H),7.21(d,J=1.8Hz,1H),6.89(dd,J=1.9,8.5Hz,1H),4.19 (q,J=7.1Hz,2H),4.14-4.04(m,4H),3.49(t,J=6.2Hz,2H),3.24(s,3H),1.96(quin,J=6.2Hz,2H),1.23(q,J=7.7Hz,6H).

[0913]

[0914] Step 4 - Synthesis of ethyl 6-bromo-4-hydroxy-7-(3-methoxypropoxy)quinoline-3-carboxylate: A solution of diethyl 2-[[4-bromo-3-(3-methoxypropoxy)anilino]methylene]malonate (2 g, 4.65 mmol, 1 eq) in Ph2O (20 mL) was stirred at 260 ° C for 0.5 hours. LCMS (added to petroleum ether, solid dissolved in MeOH) showed that the desired MS was detected. The mixture was cooled to room temperature, then petroleum ether (20 mL) was added and filtered to give ethyl 6-bromo-4-hydroxy-7-(3-methoxypropoxy)quinoline-3-carboxylate (1.2 g, crude) as a light solid. MS (M+H) + =384.0.

[0915]

[0916] Step 5 - Synthesis of 6-bromo-4-hydroxy-7-(3-methoxypropoxy)quinoline-3-carboxylic acid: To a solution of ethyl 6-bromo-4-hydroxy-7-(3-methoxypropoxy)quinoline-3-carboxylate (800 mg, 2.08 mmol, 1 eq) in MeOH (10 mL) was added NaOH (2 M, 10.41 mL, 10 eq) and stirred at 50° C. for 14 hours. LCMS showed the reaction was complete. The mixture was concentrated in vacuo, acidified to pH = 4 with 1N HCl solution, and filtered to give 6-bromo-4-hydroxy-7-(3-methoxypropoxy)quinoline-3-carboxylic acid (760 mg, crude) as a light solid. 1 H NMR (400MHz, DMSO-d6) δ = 13.82 (br s, 1H), 8.75 (br d,J=4.2Hz,1H),8.33-8.24(m,1H),7.42-7.35(m,1H),4.20(t,J=6.2Hz,2H),3.54(t,J=6.2Hz,2H),3.26(s,3H),2.06(quin,J=6.2Hz,2H).MS(M+H) + =356.0

[0917]

[0918] Step 6 - Synthesis of 6-bromo-4-chloro-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride: A solution of 6-bromo-4-hydroxy-7-(3-methoxypropoxy)quinoline-3-carboxylic acid (400 mg, 1.12 mmol, 1 eq) in POCl (4 mL) was stirred at 100°C for 1 hour. LCMS (quenching the sample with 1 mL of glacial EtOH) indicated the reaction was complete. The mixture was concentrated in vacuo to afford 6-bromo-4-chloro-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride (520 mg, crude) as a brown oil.

[0919]

[0920] Step 7 – Synthesis of 6-bromo-4-chloro-7-(3-methoxypropoxy)-N,N-dimethyl-quinoline-3-carboxamide: To a solution of 6-bromo-4-chloro-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride (440 mg, 1.12 mmol, 1 eq) in DCM (5 mL) was added TEA (339.82 mg, 3.36 mmol, 467.43 μL, 3 eq) and N-methylmethanamine (82.15 mg, 1.01 mmol, 92.31 μL, 0.9 eq, HCl) at 0°C, followed by stirring at 25°C for 14 hours. LCMS indicated the reaction was complete. Water (5 mL) was added, the mixture was separated, and extracted with DCM (5 mL x 3). The combined organic layers were dried over Na2SO4 and concentrated in vacuo to give 6-bromo-4-chloro-7-(3-methoxypropoxy)-N,N-dimethyl-quinoline-3-carboxamide (490 mg, crude) as a yellow gum. MS (M+H) + =401.0

[0921]

[0922] Step 8 - Synthesis of 2-[[6-bromo-3-(dimethylcarbamoyl)-7-(3-methoxypropoxy)-4-quinolinyl]amino]benzoic acid: A solution of 6-bromo-4-chloro-7-(3-methoxypropoxy)-N,N-dimethyl-quinoline-3-carboxamide (160 mg, 398.33 μmol, 1 eq) and 2-aminobenzoic acid (65.55 mg, 477.99 μmol, 1.2 eq) in ACN (2 mL) was stirred at 90° C. for 14 hours. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100×25 mm×5 μm column; 25%-55% acetonitrile / 10 mM aqueous NH 4 HCO 3 solution, 8 min gradient) to give 2-[[6-bromo-3-(dimethylcarbamoyl)-7-(3-methoxypropoxy)-4-quinolinyl]amino]benzoic acid (33.45 mg, 65.15 μmol, 16.36% yield, 97.85% purity) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ=11.78(br d,J=6.1Hz,1H),8.59(s,1H),8.27(s,1H),7.92(dd,J=1.3,7.8Hz,1H),7.50(s,1H),7.29-7.19(m,2H),6.88(t,J=7.5Hz,1H),6.69(d ,J=8.1Hz,1H),4.29(t,J=6.2Hz,2H),3.57(t,J=6.2Hz,2H),3.28(s,3H),2.71(s,3H),2.54(s,3H),2.07(quin,J=6.2Hz,2H).MS(M+H) + =502.0.

[0923] Example 31 - Preparation of Compound 58A

[0924]

[0925] Step 1 - Synthesis of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride: A solution of 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxylic acid (900 mg, 2.93 mmol, 1 eq) in POCl (8 mL) was stirred at 100°C for 1 hour. LCMS (quenching the sample with 1 mL of glacial MeOH) indicated the reaction was complete. The mixture was concentrated in vacuo to afford 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride (1 g, crude) as a brown oil.

[0926]

[0927] Step 2 – Synthesis of 4-chloro-N-(2,2-dimethoxyethyl)-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxamide: To a solution of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride (1 g, 2.91 mmol, 1 eq) in DCM (10 mL) was added TEA (1.18 g, 11.62 mmol, 1.62 mL, 4 eq) and 2,2-dimethoxyethylamine (305.46 mg, 2.91 mmol, 316.54 μL, 1 eq) at 0°C, followed by stirring at 25°C for 14 hours. LCMS indicated the reaction was complete. The mixture was dissolved in water (10 mL), separated, and extracted with DCM (20 mL x 2). The combined organic layers were dried over Na2SO4 and concentrated in vacuo. The crude product was purified by flash column (ISCO 20 g silica, 0-100% ethyl acetate / petroleum ether, gradient over 30 min) to afford 4-chloro-N-(2,2-dimethoxyethyl)-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxamide (500 mg, 1.21 mmol, 41.68% yield) as a white solid.

[0928]

[0929] Step 3 – Synthesis of 2-[4-chloro-6-methoxy-7-(3-methoxypropoxy)-3-quinolyl]oxazole: A solution of 4-chloro-N-(2,2-dimethoxyethyl)-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxamide (105 mg, 254.32 μmol, 1 eq) in PPA (2 g) was stirred at 90°C for 4 hours. LCMS indicated the reaction was complete. The two reaction mixtures were combined, added to ice water (10 mL), dissolved in ethyl acetate (20 mL), separated, and extracted with ethyl acetate (20 mL x 3). The combined organic layers were dried over Na2SO4 and concentrated in vacuo. The crude product was purified by flash column (ISCO 10 g silica, 0-30% ethyl acetate / petroleum ether, gradient 30 min) to afford 2-[4-chloro-6-methoxy-7-(3-methoxypropoxy)-3-quinolyl]oxazole (36 mg, 103.22 μmol, 20.29% yield) as a pale yellow solid. MS (M+H) + =349.2

[0930]

[0931] Step 4 – Synthesis of 2-[[6-methoxy-7-(3-methoxypropoxy)-3-oxazol-2-yl-4-quinolinyl]amino]benzoic acid: A solution of 2-[4-chloro-6-methoxy-7-(3-methoxypropoxy)-3-quinolinyl]oxazole (20 mg, 57.34 μmol, 1 eq), 2-aminobenzoic acid (19.97 mg, 145.65 μmol, 2.54 eq), and HCl (12 M, 23.89 μL, 5.0 eq) in ACN (0.6 mL) was stirred at 90°C for 14 hours. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100×30 mm×10 μm column; 5%-25% acetonitrile / 10 mM aqueous NH 4 HCO 3 solution, 10 min gradient) to give 2-[[6-methoxy-7-(3-methoxypropoxy)-3-oxazol-2-yl-4-quinolinyl]amino]benzoic acid (12.64 mg, 27.76 μmol, 48.41% yield, 98.71% purity) as a yellow solid. 1 HNMR(400MHz,DMSO-d6)δ=11.40(br s,1H),9.10(s,1H),8.19(s,1H),7.95(dd,J=1.5,7.9Hz,1H),7.45-7.37(m,2H),7.26-7.15(m,1H),6.97(s,1H),6.89( t,J=7.6Hz,1H),6.43(d,J=7.9Hz,1H),4.21(t,J=6.4Hz,2H),3.53-3.49(m,5H),3.27(s,3H),2.04(quin,J=6.3Hz,2H).

[0932] Example 32 - Preparation of Compound 61A

[0933]

[0934] Step 1 - Synthesis of 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride: A solution of 6-bromoquinolin-4-ol (1 g, 4.46 mmol, 1 eq) in chlorosulfonic acid (13 mL) was stirred at 100°C under N2 for 10 hours. LCMS showed no reactant 1 remaining. The mixture was added to ice water (10 mL) and filtered to obtain a filter cake, which was dried under vacuum to afford 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride (1.7 g, crude) as an off-white solid. 1H NMR (400MHz, DMSO-d6) δ = 8.83 (s, 1H), 8.36 (d, J = 2.2Hz, 1H), 8.01 (dd, J = 2.2, 8.8Hz, 1H), 7.85 (d, J = 9.0Hz, 1H).

[0935]

[0936] Step 2 - Synthesis of 6-bromo-4-hydroxy-quinoline-3-sulfonamide: NH3 was bubbled into a stirred solution of THF (4 mL) at 0°C until pH ~14, followed by the addition of 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride (1.0 g, 3.10 mmol, 1 eq) at 0°C. The mixture was then stirred at 25°C for 2 hours. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo, triturated with MTBE (5 mL) at room temperature, and filtered to obtain a filter cake, which was dried in vacuo to afford 6-bromo-4-hydroxy-quinoline-3-sulfonamide (1 g, crude) as a light-colored solid. 1 H NMR (400MHz, DMSO-d6) δ = 8.52 (s, 1H), 8.26 (d, J = 2.2Hz, 1H), 7.92 (dd, J = 2.2, 8.8Hz, 1H), 7.72 (d, J = 8.8Hz, 1H), 6.86 (br s, 2H).

[0937]

[0938] Step 3 - Synthesis of 6-bromo-4-chloro-quinoline-3-sulfonamide: A solution of 6-bromo-4-hydroxy-quinoline-3-sulfonamide (200 mg, 659.78 μmol, 1 eq) and DMF (4.82 mg, 65.98 μmol, 5.08 μL, 0.1 eq) in SOCl2 (3 mL) was stirred at 25°C for 14 hours. LCMS showed no reactant 1 remaining. The mixture was concentrated in vacuo to give 6-bromo-4-chloro-quinoline-3-sulfonamide (190 mg, crude) as an off-white solid.

[0939]

[0940] Step 4 – Synthesis of 2-[(6-bromo-3-sulfamoyl-4-quinolinyl)amino]benzoic acid: A solution of 6-bromo-4-chloroquinoline-3-sulfonamide (150 mg, 466.45 μmol, 1 eq), HCl (236.21 mg, 2.33 mmol, 231.58 μL, 36% purity, 5 eq), and 2-aminobenzoic acid (70.36 mg, 513.09 μmol, 1.1 eq) in ACN (1 mL) was stirred at 90°C for 14 hours. LCMS indicated the desired MS was detected. The reaction solution was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100×25 mm×5 μm column; 15%-35% acetonitrile / 10 mM aqueous NH 4 HCO 3 solution, 8 min gradient) to give 2-[(6-bromo-3-sulfamoyl-4-quinolinyl)amino]benzoic acid (16.76 mg, 37.74 μmol, 8.09% yield, 95.09% purity) as a yellow solid. 1 H NMR(400MHz,DMSO-d6)δ=11.28(br s,1H),9.15(s,1H),8.01-7.94(m,2H),7.93-7.89(m,1H),7.79(d,J=2.0Hz, 1H),7.23-7.16(m,1H),6.95(t,J=7.5Hz,1H),6.43(d,J=8.2Hz,1H).MS(MH) - =419.9.

[0941] Example 33 - Preparation of Compound 63A

[0942]

[0943] Step 1 – Synthesis of 6-chloro-4-hydroxy-quinoline-3-sulfonyl chloride: A solution of 6-chloroquinolin-4-ol (1.5 g, 8.35 mmol, 1 eq) in chlorosulfonic acid (15 mL) was stirred at 100°C for 14 hours. LCMS indicated the reaction was complete. The mixture was added dropwise to ice water (50 mL) at 0-5°C and filtered to obtain a filter cake, which was dried under vacuum to afford 6-chloro-4-hydroxy-quinoline-3-sulfonyl chloride (1.9 g, 6.83 mmol, 81.80% yield) as an off-white solid. 1 H NMR (400MHz, DMSO-d6) δ = 8.90 (s, 1H), 8.23 ​​(d, J = 2.2Hz, 1H), 8.00-7.97 (m, 1H), 7.95-7.91 (m, 1H).

[0944]

[0945] Step 2 - Synthesis of 6-chloro-4-hydroxy-quinoline-3-sulfonamide: NH3 (36.74 mg, 2.16 mmol, 1 eq) was bubbled into THF (10 mL) at 0°C until pH = 14, followed by the addition of 6-chloro-4-hydroxyquinoline-3-sulfonyl chloride (600 mg, 2.16 mmol, 1 eq). The mixture was stirred at 25°C for 2 hours. LCMS indicated that the reactants had been consumed, with a new major peak detected. The mixture was concentrated in vacuo, triturated with MTBE (5 mL), and filtered to afford 6-chloro-4-hydroxy-quinoline-3-sulfonamide (600 mg, crude) as an off-white solid. 1 H NMR (400MHz, DMSO-d6) δ = 8.52 (s, 1H), 8.11 (s, 1H), 7.84-7.76 (m, 2H), 6.84 (brs, 2H).

[0946]

[0947] Step 3 - Synthesis of 4,6-dichloroquinoline-3-sulfonamide: A solution of 6-chloro-4-hydroxyquinoline-3-sulfonamide (50 mg, 193.29 μmol, 1 eq) in POCl (2 mL) was stirred at 110°C for 2 hours. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo to afford 4,6-dichloroquinoline-3-sulfonamide (52 mg, crude) as a yellow gum.

[0948]

[0949] Step 4 – Synthesis of 2-[(6-chloro-3-sulfamoyl-4-quinolinyl)amino]benzoic acid: To a stirred solution of 4,6-dichloroquinoline-3-sulfonamide (50 mg, 180.42 μmol, 1 eq) in CHCN (2 mL) was added 2-aminobenzoic acid (24.74 mg, 180.42 μmol, 1 eq). The mixture was then stirred at 90°C for 2 hours. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo. The crude residue was purified by preparative HPLC (Nano-micro Kromasil C18 80×25 mm μm column; 22-42% acetonitrile / 0.04% aqueous HCl acid, 7 min gradient) to give 2-[(6-chloro-3-sulfamoyl-4-quinolinyl)amino]benzoic acid (17.70 mg, 46.49 μmol, 25.77% yield, 99.24% purity) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ=10.39(br s,1H),9.18(s,1H),8.14(d,J=8.8Hz,1H),8.07-7.98(m,3H),7.91(dd,J=2.2,9. 0Hz,1H),7.51(d,J=2.2Hz,1H),7.41-7.33(m,1H),7.17(t,J=7.5Hz,1H),6.71(br d,J=7.9Hz,1H).MS(M+H) + =377.9.

[0950] Example 34 - Preparation of Compound 64A

[0951]

[0952] Step 1 – Synthesis of 6-bromo-4-chloro-quinoline-3-sulfonamide: A suspension of 6-bromo-4-hydroxy-quinoline-3-sulfonamide (300 mg, 989.67 μmol, 1 eq) in POCl₃ (1 mL) was stirred at 110°C for 2 hours. LCMS indicated complete consumption of the starting material and formation of the desired product. The mixture was concentrated in vacuo, and the residue was azeotroped with toluene (3 mL x 2) to afford 6-bromo-4-chloro-quinoline-3-sulfonamide (300 mg, crude) as a yellow gum.

[0953]

[0954] Step 2 – Synthesis of 2-[(6-bromo-3-sulfamoyl-4-quinolinyl)amino]benzoic acid: To a stirred solution of 6-bromo-4-chloro-quinoline-3-sulfonamide (300 mg, 932.90 μmol, 1 eq) in CHCN (8 mL) was added 2-aminobenzoic acid (127.93 mg, 932.90 μmol, 1 eq). The mixture was then stirred at 90°C for 3 hours. LCMS indicated complete consumption of the starting material and formation of the desired product. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC using a Nano-microKromasil C18 column (80 × 25 mm μm); mobile phase: water (0.04% HCl)-ACN; B%: 15% to 45% over 7 min to afford 2-[(6-bromo-3-sulfamoyl-4-quinolinyl)amino]benzoic acid (170 mg, 402.60 μmol, 43.16% yield) as a yellow solid. MS (M+H) = 422.0.

[0955]

[0956] Step 3 – Synthesis of 2-[[6-(1,3-benzoxazol-7-yl)-3-sulfamoyl-4-quinolyl]amino]benzoic acid: To a solution of 2-[(6-bromo-3-sulfamoyl-4-quinolyl)amino]benzoic acid (80 mg, 189.46 μmol, 1 eq), K3PO4 (0.4 M, 947.30 μL, 2 eq), [2-(2-aminophenyl)phenyl]-chloro-palladium; bis(1-adamantyl)-butyl-phosphine (12.67 mg, 18.95 μmol, 0.1 eq) in THF (2 mL) and H2O (0.5 mL) was added 7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3-benzoxazole (55.72 mg, 227.35 μmol, 1.2 eq). The mixture was further degassed and purged with N2 5 times, then stirred at 80 ° C under N2 for 14 hours. LCMS showed that the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters Xbridge Prep OBD C18 150×40mm×10μm column; 15%-45% acetonitrile / 10mM NH4HCO3 aqueous solution, 8min gradient) to give 2-[[6-(1,3-benzoxazol-7-yl)-3-sulfamoyl-4-quinolinyl] amino] benzoic acid (24.45 mg, 52.50 μmol, 27.71% yield, 98.88% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6+D2O) δ=9.13(s,1H),8.55(s,1H),8.31(qd,J=2.2,4.6Hz,2H),8.19-8.16(m,1H),7.97(dd,J=1.6,7.8Hz,1H ),7.77(dd,J=1.0,7.7Hz,1H),7.53-7.47(m,1H),7.45-7.40(m,1H),7.18-7.11(m,1H),7.00-6.91(m,1H),6.56(d,J=7.7Hz,1H). 1 H NMR (400MHz, DMSO-d6) δ = 9.15 (s, 1H), 8.58 (s, 1H), 8.34-8.27 (m, 2H), 8.18 (d, J = 9.3Hz, 1H), 7.98 (dd, J = 1.5, 7.7Hz, 1H), 7.7 8(dd,J=1.1,7.7Hz,1H),7.51-7.40(m,3H),7.20-7.11(m,1H),6.94(t,J=7.5Hz,1H),6.56(d,J=7.7Hz,1H).MS(M+H)+=461.1.

[0957] Example 35 - Preparation of Compound 70A

[0958]

[0959] Step 1 – Synthesis of 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride: A solution of 6-bromoquinolin-4-ol (3.5 g, 15.62 mmol, 1 eq) in chlorosulfonic acid (30 mL) was stirred at 100°C for 14 hours. LCMS showed no reactant remaining, with two new spots forming. The mixture was added to ice water (100 mL) and filtered to afford 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride (4.2 g, 13.02 mmol, 83.35% yield) as an off-white solid. 1 H NMR (400MHz, DMSO-d6) δ = 8.89 (s, 1H), 8.38 (d, J = 2.0Hz, 1H), 8.04 (dd, J = 2.2, 8.8Hz, 1H), 7.90 (d, J = 8.8Hz, 1H).

[0960]

[0961] Step 2 – Synthesis of 6-bromo-3-morpholinosulfonyl-quinolin-4-ol: To a solution of 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride (700 mg, 2.17 mmol, 1 eq) in chloroform (0.5 mL) and TEA (658.78 mg, 6.51 mmol, 906.17 μL, 3 eq) was added morpholine (378.12 mg, 4.34 mmol, 381.94 μL, 2 eq) at 0°C. The resulting solution was stirred at 0°C for 1 hour and at 25°C for 3 hours. LCMS indicated the reaction was complete. The suspension was filtered to obtain a filter cake, which was dried under vacuum to afford 6-bromo-3-morpholinosulfonyl-quinolin-4-ol (460 mg, 1.23 mmol, 56.79% yield) as an off-white solid. 1 H NMR (400MHz, DMSO-d6) δ = 8.54 (s, 1H), 8.24 (d, J = 2.2Hz, 1H), 7.93 (dd, J = 2.4, 8.8Hz, 1H), 7.68 (d, J = 8. 8Hz,1H),3.81-3.75(m,2H),3.62-3.56(m,2H),3.20-3.16(m,2H),3.14-3.10(m,2H).MS(M+H)+=372.9.

[0962]

[0963] Step 3 – Synthesis of 4-[(6-bromo-4-chloro-3-quinolinyl)sulfonyl]morpholine: A solution of 6-bromo-3-morpholinosulfonyl-quinolin-4-ol (330 mg, 884.19 μmol, 1 eq) in POCl3 (15 mL) was stirred at 110°C for 6 hours. LCMS showed approximately 30% of the reactant remained. The mixture was stirred at 110°C for another 4 hours. LCMS showed the reaction was complete. The solution was concentrated in vacuo, diluted with toluene (2 mL), concentrated in vacuo, and dissolved in ethyl acetate (5 mL). The solution was added dropwise to ice water (5 mL), separated, and extracted with ethyl acetate (5 mL x 2). The combined organic layers were washed with brine (2 mL), dried over Na2SO4, filtered, and concentrated in vacuo. The crude product was purified by flash column (ISCO 10 g silica, 0-30% ethyl acetate / petroleum ether, gradient 30 min) to afford 4-[(6-bromo-4-chloro-3-quinolinyl)sulfonyl]morpholine (190 mg, 485.11 μmol, 54.86% yield) as an off-white solid. 1 H NMR (400MHz, DMSO-d6) δ = 9.24 (s, 1H), 8.60 (d, J = 1.8Hz, 1H), 8.22-8.17 (m, 1H ),8.16-8.12(m,1H),3.67-3.57(m,4H),3.31-3.25(m,4H).MS(M+H)+=390.9.

[0964]

[0965] Step 4 - Synthesis of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolinyl)amino]benzoic acid: A solution of 4-[(6-bromo-4-chloro-3-quinolinyl)sulfonyl]morpholine (180 mg, 459.57 μmol, 1 eq) and 2-aminobenzoic acid (75.63 mg, 551.49 μmol, 1.2 eq) in ACN (5 mL) was stirred at 90°C for 14 hours. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Nano-micro Kromasil C18 80×25 mm μm column; 35%-60% acetonitrile / 0.04% aqueous HCl, 7 min gradient) to give 2-[(6-bromo-3-morpholinosulfonyl-4-quinolinyl)amino]benzoic acid (114.5 mg, 232.56 μmol, 50.60% yield, 100% purity) as a yellow solid. 1H NMR(400MHz,DMSO-d6)δ=10.45(br s,1H),9.10(s,1H),8.12-7.97(m,3H),7.74(d,J=2.0Hz,1H),7.42-7.31(m,1H),7.10 (t,J=7.5Hz,1H),6.73(d,J=8.2Hz,1H),3.54-3.31(m,4H),3.14-2.97(m,4H).MS(M+H) + =491.9.

[0966] Example 36 - Preparation of Compound 78A

[0967]

[0968] Step 1 - Synthesis of 6-bromo-3-morpholinosulfonyl-quinolin-4-ol: To a solution of 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride (2 g, 6.20 mmol, 1 eq) in CHCl3 (20 mL) was added morpholine (1.08 g, 12.40 mmol, 1.09 mL, 2 eq) at 0 °C and TEA (1.88 g, 18.60 mmol, 2.59 mL, 3 eq) was added dropwise. The mixture was stirred at 20 °C for 1 hour. LCMS showed that the reaction was complete. The suspension was filtered to obtain a filter cake and dried under vacuum. 6-bromo-3-morpholinosulfonyl-quinolin-4-ol (2.7 g, crude) was obtained as an off-white solid. MS (M+H) + =372.9.

[0969]

[0970] Step 2 – Synthesis of 4-[(6-bromo-4-chloro-3-quinolinyl)sulfonyl]morpholine: A solution of 6-bromo-3-morpholinosulfonyl-quinolin-4-ol (2.5 g, 6.70 mmol, 1 eq) in POCl₃ (25 mL) was stirred at 110°C for 12 h. LCMS indicated the desired MS was detected. The reaction mixture was concentrated in vacuo to remove POCl₃. Ethyl acetate (20 mL) was added dropwise to the residue. The solution was added dropwise to the above solution, separated, and extracted with ethyl acetate (20 mL x 2). The combined organic layers were dried over Na₂SO₄ and concentrated in vacuo. The crude product was purified by flash column chromatography (ISCO 20 g silica, 0-20% ethyl acetate / petroleum ether, gradient 30 min) to afford 4-[(6-bromo-4-chloro-3-quinolinyl)sulfonyl]morpholine (1.2 g, 3.06 mmol, 45.74% yield) as a yellow solid. 1H NMR (400MHz, DMSO-d6) δ9.20(s,1H),8.57(s,1H),8.25-8.09(m,2H),3.59(br s,4H),3.25(br s,4H).

[0971]

[0972] Step 3 – Synthesis of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolinyl)amino]-6-hydroxy-benzoic acid: A solution of 4-[(6-bromo-4-chloro-3-quinolinyl)sulfonyl]morpholine (100 mg, 255.32 μmol, 1 eq) and 2-amino-6-hydroxybenzoic acid (46.92 mg, 306.38 μmol, 1.2 eq) in EtOH (5 mL) and CHCl₃ (1 mL) was stirred at 70°C for 0.5 h. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Phenomenex luna C18 80×40 mm×3 μm column; 27%-55% acetonitrile / 0.04% aqueous HCl, 7 min gradient) to give 2-[(6-bromo-3-morpholinosulfonyl-4-quinolinyl)amino]-6-hydroxy-benzoic acid (9.4 mg, 17.38 μmol, 6.81% yield, 94.00% purity) as a light yellow solid. 1 H NMR (400MHz, DMSO-d6) δ10.48-10.05(m,1H),9.04(s,1H),8.03(s,2H),7.70(s,1H),7.21(t,J=8.1 Hz,1H),6.74(d,J=8.0Hz,1H),6.38(d,J=8.0Hz,1H),3.60-3.46(m,4H),3.19-3.07(m,4H).MS(M+H) + =508.0.

[0973] Example 37 - Preparation of Compounds 78A-INT and 78A-BR

[0974]

[0975] Step 1 – Synthesis of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolinyl)amino]-6-methoxy-benzoic acid: A solution of 4-[(6-bromo-4-chloro-3-quinolinyl)sulfonyl]morpholine (100 mg, 255.32 μmol, 1 eq), HCl (5.17 mg, 51.06 μmol, 5.07 μL, 36% purity, 0.2 eq), and 2-amino-6-methoxy-benzoic acid (51.22 mg, 306.38 μmol, 1.2 eq) in EtOH (5 mL) and CHCl₃ (1 mL) was stirred at 70°C for 0.5 h. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo and dissolved in DMSO (1 mL). The crude product was purified by preparative HPLC (Phenomenex luna C18 80×40 mm×3 μm column; 28%-55% acetonitrile / 0.04% aqueous HCl, 7 min gradient) to give 2-[(6-bromo-3-morpholinosulfonyl-4-quinolinyl)amino]-6-methoxy-benzoic acid (60 mg, 114.86 μmol, 44.99% yield, 100% purity) as a yellow solid. 1 H NMR(400MHz,DMSO-d6)δ8.98(s,1H),8.02-7.98(m,1H),7.96-7.91(m,1H),7.73(s,1H), 7.27(t,J=8.3Hz,1H),6.94(d,J=8.2Hz,1H),6.43(d,J=8.2Hz,1H),3.89(s,3H),3.54(br s,4H),3.14(br s,4H).MS(M+H) + =522.0.

[0976]

[0977] Step 2 – Synthesis of 3-bromo-6-[(6-bromo-3-morpholinosulfonyl-4-quinolinyl)amino]-2-hydroxy-benzoic acid: To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolinyl)amino]-6-methoxy-benzoic acid (60 mg, 114.86 μmol, 1 eq) in DCM (0.5 mL) was added BBr (86.33 mg, 344.58 μmol, 33.20 μL, 3 eq) dropwise at -78°C. The reaction mixture was stirred at 20°C under N for 3 hours. LCMS showed the desired MS was detected. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters Xbridge Prep OBD C18 150×40 mm×10 μm column; 15%-45% acetonitrile in an 10 mM aqueous NH 4 HCO 3 solution, 8 min gradient) to give 3-bromo-6-[(6-bromo-3-morpholinosulfonyl-4-quinolinyl)amino]-2-hydroxy-benzoic acid (5.7 mg, 9.59 μmol, 8.35% yield, 98.76% purity) as a reddish-brown solid. 1 H NMR(400MHz,DMSO-d6)δ11.37(br s,1H),9.12(s,1H),8.06(d,J=0.9Hz,2H),7.89(s,1H),7.42(d,J=8.9Hz,1H),6.09 (d,J=8.8Hz,1H),3.62-3.54(m,2H),3.53-3.46(m,2H),3.22-3.08(m,4H).MS(M+H) + =585.9.

[0978] Example 38 - Preparation of Compounds 79A-INT and 79A

[0979]

[0980] Step 1 - Synthesis of 6-chloro-3-morpholinosulfonyl-quinolin-4-ol: To a solution of 6-chloro-4-hydroxy-quinoline-3-sulfonyl chloride (650 mg, 2.34 mmol, 1 eq) in CHCl₃ (7 mL) was added morpholine (407.23 mg, 4.67 mmol, 411.35 μL, 2 eq) and TEA (709.50 mg, 7.01 mmol, 975.93 μL, 3 eq) at 0°C. The mixture was stirred at 20°C for 1 hour. LCMS indicated the reaction was complete. The suspension was filtered to obtain a filter cake, which was dried under vacuum to afford 6-chloro-3-morpholinosulfonyl-quinolin-4-ol (930 mg, crude) as an off-white solid, which was used directly in the next step. 1H NMR (400MHz, DMSO-d6) δ8.52(s,1H),8.16-8.05(m,1H),7.86-7.76(m,2H),3.19(br s,4H),3.11-3.02(m,4H).

[0981]

[0982] Step 2 – Synthesis of 4-[(4,6-dichloro-3-quinolinyl)sulfonyl]morpholine: A solution of 6-chloro-3-morpholinosulfonyl-quinolin-4-ol (800 mg, 2.43 mmol, 1 eq) in POCl₃ (8 mL) was stirred at 110°C for 14 h. LCMS indicated the detection of the desired MS. The reaction mixture was concentrated in vacuo to remove excess POCl₃. Ethyl acetate (10 mL) was added dropwise to the residue. The solution was added to ice water (10 mL), separated, and extracted with ethyl acetate (10 mL x 2). The combined organic layers were dried over Na₂SO₄ and concentrated in vacuo. The crude product was purified by flash column chromatography (ISCO 10 g silica, 0-30% ethyl acetate / petroleum ether gradient over 30 min) to afford 4-[(4,6-dichloro-3-quinolinyl)sulfonyl]morpholine (380 mg, 1.09 mmol, 44.98% yield) as an off-white solid. MS(M+H) + =347.0.

[0983]

[0984] Step 3 – Synthesis of 2-[(6-chloro-3-morpholinosulfonyl-4-quinolinyl)amino]-6-methoxy-benzoic acid: A solution of 4-[(4,6-dichloro-3-quinolinyl)sulfonyl]morpholine (120 mg, 345.61 μmol, 1 eq), HCl (7.00 mg, 69.12 μmol, 6.86 μL, 36% purity, 0.2 eq), and 2-amino-6-methoxy-benzoic acid (69.33 mg, 414.73 μmol, 1.2 eq) in EtOH (7.5 mL) and CHCl₃ (1.5 mL) was stirred at 70°C for 0.5 h. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Phenomenex luna C18 80×40 mm×3 μm column; 30%-55% acetonitrile / 0.04% aqueous HCl, 7 min gradient) to afford 2-[(6-chloro-3-morpholinosulfonyl-4-quinolinyl)amino]-6-methoxy-benzoic acid (50.6 mg, 98.11 μmol, 28.39% yield, 99.73% purity, HCl) as a yellow solid. 5.6 mg of the desired product was obtained. 1H NMR (400MHz, DMSO-d6) δ9.16-8.89(m,2H),8.14-8.01(m,1H),7.85(brd,J=8.6Hz,1H),7.53(s,1H),7.24(t,J=8.2Hz,1H),6.89(br d,J=8.6Hz,1H),6.39(d,J=8.1Hz,1H),3.86(s,3H),3.59-3.42(m,4H),3.20-2.95(m,4H).MS(M+H) + =478.0.

[0985]

[0986] Step 4 - Synthesis of 2-[(6-chloro-3-morpholinosulfonyl-4-quinolinyl)amino]-6-hydroxy-benzoic acid: To a solution of 2-[(6-chloro-3-morpholinosulfonyl-4-quinolinyl)amino]-6-methoxy-benzoic acid (50 mg, 104.62 μmol, 1 eq) in DCM (1 mL) was added BCl₃ (1 M, 418.48 μL, 4 eq) dropwise at 0°C. The reaction mixture was stirred at 25°C under N₂ for 2 hours. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters Xbridge BEH C₁₈ column, 100 × 25 mm × 5 μm; 20% to 44% acetonitrile / 10 mM aqueous NH₄HCO₃, 10 min gradient). Secondary purification: The crude product was purified by preparative HPLC (Phenomenex luna C18 80×40 mm×3 μm column; 10%-70% acetonitrile / 0.04% aqueous HCl, 7 min gradient) to give 2-[(6-chloro-3-morpholinosulfonyl-4-quinolinyl)amino]-6-hydroxy-benzoic acid (12.9 mg, 27.45 μmol, 26.24% yield, 98.71% purity) as a brown solid. 1 HNMR (400MHz, DMSO-d6) δ10.23-10.07(m,1H),9.03(s,1H),8.08(d,J=9.0Hz,1H),7.89(dd,J=2.2,9.0Hz,1H),7.58(d,J=2.2Hz,1H), 7.17(t,J=8.2Hz,1H),6.64(d,J=8.6Hz,1H),6.22(d,J=7.9Hz,1H),3.62-3.50(m,2H),3.48-3.38(m,2H),3.18-2.99(m,4H).MS(M+H) + =464.1.

[0987] Example 39 - Preparation of Compound 80A

[0988]

[0989] Synthesis of 2-[(6-chloro-3-morpholinosulfonyl-4-quinolinyl)amino]benzoic acid: A solution of 4-[(4,6-dichloro-3-quinolinyl)sulfonyl]morpholine (100 mg, 288.00 μmol, 1 eq) and 2-aminobenzoic acid (47.39 mg, 345.61 μmol, 1.2 eq) in ACN (1 mL) was stirred at 90 ° C for 4 hours. LCMS showed that the reaction was complete. TEA (0.1 mL) was added to the above mixture and filtered to obtain a filtrate. The crude product was purified by preparative HPLC (Phenomenex Gemini-NX C18 75×30 mm×μm column; 10%-40% acetonitrile / 10 mM aqueous NH4HCO3, 8 min gradient) to give 2-[(6-chloro-3-morpholinosulfonyl-4-quinolinyl)amino]benzoic acid (38.3 mg, 84.67 μmol, 29.40% yield, 99.01% purity) as a pale yellow solid. 1 H NMR(400MHz,DMSO-d6)δ10.55(br s,1H),9.11(s,1H),8.17(d,J=9.0Hz,1H),8.02(dd,J=1.4,7.9Hz,1H),7.94(dd,J=2.3,9.1Hz,1H),7.57(d,J=2.3Hz,1H),7.4 5-7.31(m,1H),7.14(t,J=7.4Hz,1H),6.81(d,J=8.3Hz,1H),3.54-3.47(m,2H),3.44-3.34(m,2H),3.15-3.01(m,4H).MS(M+H) + =448.1.

[0990] Example 40 - Preparation of Compounds 81A-INT and 81A

[0991]

[0992] Step 1 - Synthesis of 6-bromo-4-hydroxy-quinoline-3-carboxylic acid: A solution of ethyl 6-bromo-4-hydroxy-quinoline-3-carboxylate (3 g, 10.13 mmol, 1 eq) in 2N NaOH (30 mL) was stirre...

Claims

1. A compound of formula (III): or a pharmaceutically acceptable salt thereof, wherein: X 1 CR 1 ; R 1 , R 2 , R 3 , R 4 and R 6 are each independently selected from H, halogen and OR a1 ; R 5 Cy 1 ; Each Cy 1 Independently selected from C 3-10 Cycloalkyl, 4-7 membered heterocycloalkyl and 5-10 membered heteroaryl, each of which is optionally substituted with 1, 2 or 3 substituents independently selected from R Cy ; R 7 is H; W is C(O)OR a2 ; R Cy Selected from halogen, C 1-6 Alkyl, C 1-6 Haloalkyl, OR a2 and NR c2 R d2 ; R a1 , R a2 , R c2 and R d2 Each independently selected from H, C 1-6 Alkyl and C 1-4 Halogenated alkyl.

2. The compound according to claim 1, wherein the compound of formula (III) is selected from any one of the following compounds: or a pharmaceutically acceptable salt thereof.

3. The compound according to claim 1, wherein the compound of formula (III) is selected from any one of the following compounds: or a pharmaceutically acceptable salt thereof.

4. The compound according to claim 1, wherein the compound of formula (III) is selected from any one of the following compounds: or a pharmaceutically acceptable salt thereof.

5. A pharmaceutical composition comprising the compound according to claim 1 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.

6. A method for treating or preventing a disease or condition selected from the group consisting of a disorder associated with telomere or telomerase dysfunction, a disorder associated with aging, a preleukemic or precancerous condition, HBV infection, a neurodevelopmental disorder, and an acquired or inherited disease or condition associated with RNA alterations, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound according to claim 1 or a pharmaceutically acceptable salt thereof.

7. The method of claim 6, wherein the disorder associated with telomere or telomerase dysfunction is dyskeratosis congenita, aplastic anemia, pulmonary fibrosis, myelodysplastic syndrome, idiopathic pulmonary fibrosis, a blood disorder, or liver fibrosis.

8. The method of claim 6, wherein the aging-related condition is macular degeneration, diabetes, osteoarthritis, rheumatoid arthritis, sarcopenia, cardiovascular disease, hypertension, atherosclerosis, coronary artery disease, ischemia / reperfusion injury, cancer, premature death, or age-related decline in cognitive function, cardiopulmonary function, muscle strength, vision, or hearing.

9. The method of claim 6, wherein the neurodevelopmental disorder is pontocerebellar dysgenesis. 10 . A method for expanding cells, comprising culturing the cells in the presence of an effective amount of the compound according to claim 1 or a pharmaceutically acceptable salt thereof.

11. The method of claim 10, wherein the cells are selected from the group consisting of stem cells, pluripotent stem cells, hematopoietic stem cells, and embryonic stem cells.

12. The method of claim 10, wherein the cells are collected from a subject suffering from a disease or condition selected from the group consisting of a disorder associated with telomere or telomerase dysfunction, a disorder associated with aging, a preleukemic or precancerous disorder, and a neurodevelopmental disorder.

13. The method of claim 10, wherein the cell is a chimeric antigen receptor (CAR) T-cell.

14. The method of claim 10, wherein the cell is a T cell, an engineered T cell, or a natural killer (NK) cell.

Images