Exosome-based protein delivery system and use thereof

By designing a cargo loading subsystem and an unloading subsystem, and utilizing the cleavage of CD63 peptide and enterokinase light chain under hypoxic conditions, the reproducibility and stability issues of exosome drug delivery systems were solved. This enabled the encapsulation and delivery of specific proteins or peptides, especially CDNF, by exosomes during cell generation, thus overcoming the shortcomings of existing exosome drug delivery systems.

CN119824020BActive Publication Date: 2026-06-26FOSHAN ZHONGKE RHYTHM BIOTECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411992925.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-31
Publication Date
2026-06-26
Estimated Expiration
2044-12-31

AI Technical Summary

Technical Problem

Existing exosome-based drug delivery systems suffer from difficulties in maintaining the repeatability and stability of the drug loading process, the risk of microbial contamination, and the inability to directly secrete exosomes that encapsulate specific proteins or peptides.

Method used

Design an exosome-based protein delivery system that uses a loading subsystem and an unloading subsystem to encapsulate and deliver specific proteins or peptides during cell generation. The delivery of proteins or peptides is achieved by cleaving CD63 peptides and enterokinase light chains under hypoxic conditions, thus avoiding manual drug loading operations.

Benefits of technology

It improves the repeatability and stability of drug delivery, protects internal proteins or peptides from degradation, prolongs the half-life in vivo, and enables efficient cytoplasmic delivery of specific proteins such as CDNF.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119824020B_ABST
    Figure CN119824020B_ABST
Patent Text Reader

Abstract

The application discloses an exosome-based protein delivery system and application thereof. The exosome-based protein delivery system comprises a loading subsystem and / or an unloading subsystem, the polypeptide peptide segment expressed by the nucleotide sequence of the loading subsystem comprises CD63, a connecting peptide, an enterokinase cleavage site and a delivered protein or polypeptide, and the polypeptide peptide segment expressed by the nucleotide sequence of the unloading subsystem comprises CD63, a connecting peptide, enterokinase or enterokinase light chain. The application also constructs a human umbilical cord mesenchymal stem cell strain hUC-MSC CDNF‑exo on November 13, 2024 in the Guangdong Provincial Microbial Culture Collection Center, and the preservation number is GDMCC NO:65478. The human umbilical cord mesenchymal stem cell strain hUC-MSC CDNF‑exo The purpose of delivering CDNF into the cytoplasm of target cells is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of drug delivery systems, and particularly to an exosome-based protein delivery system and its applications. Background Technology

[0002] Exosomes are lipid-containing, bilayered membrane structures secreted by cells and containing biomolecules such as proteins, nucleic acids, and lipids. They are primarily produced by exocytosis, the release of multiple vesicles formed by the invagination of intracellular lysosomal microparticles into the extracellular environment. As messengers for intercellular communication, exosomes, relying on their unique lipid bilayer structure and carrying signaling molecules, can communicate over long distances between different cells, thereby influencing cellular gene expression and function. Due to their low immunogenicity and good biocompatibility, exosomes can cross the blood-brain barrier, target specific cells or tissues, and prolong the half-life of encapsulated drugs in vivo, making them increasingly suitable as drug delivery carriers.

[0003] However, the current development of exosome-based drug delivery systems still has the following shortcomings: (1) The drug loading process of exosomes requires secondary artificial intervention: Currently, the process of loading drugs (such as curcumin, dopamine, paclitaxel, doxorubicin, etc.) onto exosomes first requires obtaining exosomes with high purity, and then mixing the exosomes and the above drugs in a certain proportion under certain conditions. Since this process involves two steps, the following hidden dangers may occur: a. It is difficult to maintain good reproducibility in the drug loading process, and it is difficult to ensure the stability of drug loading and release performance between different batches; b. The drug loading process increases the risk of microbial contamination. (2) There is currently no method to make cells directly secrete an exosome that encapsulates a specific protein or polypeptide.

[0004] Mesenchymal stem cell (MSC) exosomes are a type of exosome secreted by MSCs, possessing a typical lipid bilayer structure and function. Furthermore, due to the biological characteristics of MSCs, their secreted exosomes are richer in bioactive macromolecules such as cytokines and growth factors compared to exosomes secreted by other cells. Therefore, MSC exosomes play an important role in cardioprotection, tissue regeneration, immune regulation, and anti-inflammation, and are expected to replace stem cells as a new treatment method for diseases of organs such as wound repair, skin regeneration, heart, liver, kidney, and nerves in the future. Summary of the Invention

[0005] This invention constructs an exosome-based protein delivery system based on human umbilical cord mesenchymal stem cell exosomes. This delivery system can secrete a specific exosome that can encapsulate artificially designed proteins or peptides with specific functions. Cells deliver the proteins or peptides encapsulated by the exosomes into the cytoplasm through endocytosis, plasma membrane fusion, phagocytosis, and other methods to achieve the purpose of protein delivery.

[0006] This protein delivery system has the following characteristics: (1) Theoretically, it can encapsulate and deliver any protein or polypeptide (except transmembrane proteins). (2) Drug loading on exosomes is completed during the process of cell-generated exosomes, that is, the exosomes secreted by the cells are already drug-loaded exosomes. They can be used after enrichment and purification, without the need for artificial drug loading, thus greatly improving the reproducibility and stability of drug loading. (3) Since the delivered protein or polypeptide is located inside the exosome, this system mainly delivers proteins or polypeptides that act on the cytoplasm. Proteins or polypeptides that act on receptors on the cell membrane are not delivered using this system. (4) The lipid bilayer structure of exosomes can protect the internal proteins or polypeptides from degradation by the external environment and prolong the half-life of proteins or polypeptides in vivo.

[0007] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0008] An exosome-based protein delivery system includes a cargo delivery subsystem and / or an unloading subsystem, which are expression elements of two different peptides. The peptide expressed by the cargo delivery subsystem comprises four parts, from N-terminus to C-terminus: CD63, a linker peptide, an enterokinase cleavage site, and the delivered protein or peptide, i.e., a "CD63-target protein" fusion protein. The cDNA sequence encoding this peptide is artificially designed and synthesized. To facilitate future modifications, restriction enzyme sites are introduced at both ends of the corresponding cDNA sequences of these four parts. Specifically, as one embodiment, the cDNA sequence of the cargo delivery subsystem is shown below (5'-3'):

[0009]

[0010]

[0011] (In the above sequences, the underlined italic lowercase indicates the restriction enzyme sites, and the rest of the sequences are in uppercase; the cDNA sequence of the delivered protein or polypeptide is loaded into the expression vector via the 3' BamHI restriction site "ggatcc" and the SalI restriction site "gtcgac")

[0012] (2) The polypeptide expressed by the unloading subsystem consists of three parts, from N-terminus to C-terminus: CD63, a linker peptide, and enterokinase or an enterokinase light chain. The cDNA sequence encoding this peptide was artificially designed and synthesized. To facilitate future modifications, restriction enzyme sites were introduced at both ends of the corresponding cDNA sequences of these three parts. The cDNA sequence of the unloading subsystem is shown below (5'-3'):

[0013]

[0014]

[0015] (In the sequences above, underlined italicized lowercase letters indicate restriction enzyme sites, while the rest of the sequences are in uppercase.)

[0016] In practice, the choice of restriction enzyme sites “gctagc”, “atgcat”, and “cctagg” for the cargo-carrying subsystem is not unique and can be changed. Therefore, this invention can obtain different cargo-carrying subsystem sequences by changing the sequences of different restriction enzyme sites. Moreover, the design of each restriction enzyme site in the same cargo-carrying subsystem sequence needs to be different to facilitate precise control of the digested fragments. If the same restriction enzyme sites are designed, the enzyme recognition point cannot be precisely located on a certain segment during digestion. Similarly, the choice of restriction enzyme sites “tctaga”, “gctagc”, “accggt”, and “gcggccgc” for the unloading subsystem is not unique and can be changed. The nucleotide sequence of the linker peptide “GGCTCTGGCTCTGGCTCGAGC” is also not unique and can be replaced with other suitable sequences with linking functions.

[0017] (3) Promoter design of the unloading subsystem. In order to enable the system to highly express the CD63-enterokinase light chain fusion protein under hypoxic conditions and not express or express a small amount of the CD63-enterokinase light chain fusion protein under normoxic conditions, the promoter of the system was designed as a hypoxia-responsive promoter.

[0018] (4) Principles of protein delivery systems.

[0019] a. CD63 is a four-transmembrane protein widely distributed in the lipid bilayer of exosomes and is one of the classic markers of exosomes. Both the N-terminus and C-terminus of CD63 are located on the inner side of the exosome membrane. Therefore, the peptide expressed by the delivery subsystem can be fused with other proteins or peptides at its C-terminus or N-terminus to "carry" these proteins or peptides into the exosome (in practical applications, it is preferred to fuse other proteins or peptides at the C-terminus of CD63, because when fused at the C-terminus, enzyme digestion will cleave after the K of DDDDK, thus the protein or peptide will not have an extra DDDDK portion when cleaved; while if the protein or peptide is fused at the N-terminus of CD63, enzyme digestion will cleave before the D of DDDDK, resulting in an extra "DDDDK" impurity when the delivered protein or peptide is cleaved). Both the delivery and unloading subsystems utilize the characteristics of CD63 to localize the delivered protein or peptide, as well as the enterokinase light chain, inside the exosome, respectively. Similarly, the peptide segments expressed by the unloading subsystem may have enterokinase or enterokinase light chains fused to their C-terminus or N-terminus.

[0020] b. Enterokinase is a heterodimeric serine protease found in the duodenum of mammals, consisting of a heavy chain and a light chain linked by disulfide bonds. It exhibits specific protein-hydrolyzing capabilities within a pH range of 4.5–9.5 and a temperature range of 4–45°C. It can efficiently and specifically recognize the DDDDK sequence in proteins and cleave it at the C-terminus of a lysine residue. It has also been reported that the enterokinase light chain can recognize and cleave the DDDDK sequence. Therefore, this invention preferably incorporates the enterokinase light chain into the unloading subsystem to recognize and cleave the DDDDK sequence. Under certain conditions (hypoxia), the enterokinase light chain expressed in the unloading subsystem can recognize and cleave the DDDDK sequence in the cargo subsystem, thereby separating the protein or polypeptide to be delivered from CD63 in the cargo subsystem, converting it into a free protein or polypeptide within the exosome, thus achieving the purpose of "unloading".

[0021] c. Since enterokinase is a proteolytic enzyme capable of cleaving proteins with specific sequences, it is necessary to design a "switch" for its expression to ensure safety, so that its high expression can only be promoted under specific conditions. We designed the promoter element of the "CD63-enterokinase light chain" fusion protein gene as a hypoxia-responsive promoter, which causes mesenchymal stem cells to not express or express a small amount of the "CD63-enterokinase light chain" fusion protein under normoxic conditions, and to highly express the "CD63-enterokinase light chain" fusion protein only under hypoxic conditions.

[0022] d. In a hypoxic environment, if the CD63-target protein fusion protein inside the exosome and the CD63-enterokinase light chain fusion protein expressed under hypoxia are at a suitable distance, the target protein will be cleaved into a free protein by the enterokinase light chain. After enriching and purifying these exosomes, they can be applied to cells or tissues. The cells will then release the target protein from the exosome into the cytoplasm through endocytosis, plasma membrane fusion, phagocytosis, etc., thus achieving the purpose of delivery.

[0023] (5) Application of the protein delivery system. The delivery system of this invention delivers brain dopamine neurotrophic factor (CDNF) into the cytoplasm. CDNF is a neurotrophic factor mainly found in the endoplasmic reticulum (ER) of cells, possessing significant neuroprotective and neurorepair functions. CDNF may function through the following mechanisms: a. By regulating the unfolded protein response (UPR) signaling pathway, it alleviates endoplasmic reticulum (ER) stress, thereby providing cellular protection. b. By regulating the Raf-JNK-c-Jun pathway through the RTK-PI3K-Akt axis, it inhibits excessive activation and inflammatory responses of microglia, improves the local microenvironment of injury, and promotes axonal regeneration and spinal cord function recovery. c. By enhancing the functional activity of the proteasome system, CDNF can reverse the degeneration process of dopaminergic neurons. Currently, no membrane receptors for CDNF have been identified. Therefore, CDNF mainly functions inside the cell, and how exogenous CDNF enters the cell is a problem that must be solved for the clinical application of CDNF.

[0024] This invention enables the delivery of CDNF into the cytoplasm of cells. First, lentiviruses carrying a cargo delivery subsystem and an unloading subsystem were constructed, with the cargo delivery subsystem expressing the CDNF protein. Then, human umbilical cord mesenchymal stem cells were infected using these two lentiviruses, and monoclonal cell lines simultaneously expressing both the cargo delivery and unloading subsystems were screened. This human umbilical cord mesenchymal stem cell line was named hUC-MSC. CDNF-exo It was deposited at the Guangdong Provincial Center for Microbial Culture Collection on November 13, 2024, with accession number GDMCC NO:65478. An appropriate amount of hUC-MSC was then... CDNF-exo After hypoxic culture, the secreted exosomes CDNF-exo were enriched and purified. CDNF-exo contains abundant free CDNF, and when CDNF-exo is incubated with cells, CDNF can enter the cytoplasm. Attached Figure Description

[0025] Figure 1 This is a schematic diagram of the structural design of the cargo-carrying subsystem.

[0026] Figure 2 Schematic diagram of the structural design of the unloading subsystem;

[0027] Figure 3 This is a schematic diagram of the invention;

[0028] Figure 4 Plasmid map of the cargo subsystem;

[0029] Figure 5 Plasmid map of the unloading subsystem;

[0030] Figure 6 The Western spectral analysis results for Example 6 are shown below:

[0031] Figure 7 This is an immunofluorescence image of exosomes incubated with cells in Example 7. Detailed Implementation

[0032] To enable those skilled in the art to understand the present invention more clearly and intuitively, the present invention will be further described below with reference to the accompanying drawings.

[0033] Example 1: Design of the Cargo Subsystem

[0034] like Figure 1 As shown, the polypeptide expressed by the cargo delivery subsystem comprises the following four parts: from the N-terminus to the C-terminus, they are: CD63, a linker peptide, an enterokinase cleavage site, and the delivered protein or polypeptide, i.e., the "CD63-target protein" fusion protein. The cDNA sequence encoding this peptide is artificially designed and synthesized. To facilitate future modifications, restriction enzyme sites are introduced at both ends of the corresponding cDNA sequences of these four parts. Specifically, as one embodiment, the cDNA sequence of the cargo delivery subsystem is shown below (5'-3'):

[0035]

[0036]

[0037] (In the above sequences, the underlined italic lowercase indicates the restriction enzyme sites, and the rest of the sequences are in uppercase; the cDNA sequence of the delivered protein or polypeptide is loaded into the expression vector via the 3' BamHI restriction site "ggatcc" and the SalI restriction site "gtcgac")

[0038] Example 2: Design of the unloading subsystem

[0039] like Figure 2 As shown, the polypeptide expressed by the unloading subsystem consists of three parts, from the N-terminus to the C-terminus: CD63, a linker peptide, and enterokinase or an enterokinase light chain. The cDNA sequence encoding this peptide was artificially designed and synthesized. To facilitate future modifications, restriction enzyme sites were introduced at both ends of the corresponding cDNA sequences of these three parts. The cDNA sequence of the unloading subsystem is shown below (5'-3'):

[0040]

[0041]

[0042] (In the sequences above, underlined italicized lowercase letters indicate restriction enzyme sites, while the rest of the sequences are in uppercase.)

[0043] Protein delivery principle as follows Figure 3 As shown, cells are co-infected with lentiviruses expressing the cargo delivery subsystem and lentiviruses expressing the unloading subsystem. The exosomes secreted by the cells express the cargo delivery subsystem, and under certain conditions (such as hypoxia), the unloading subsystem is expressed. After the enterokinase light chain in the unloading subsystem is expressed, it recognizes and cleaves the "DDDDK" sequence expressed by the cargo delivery subsystem, thereby converting the protein or peptide expressed in the cargo delivery subsystem into a free state. Finally, the free protein or peptide is released into the target cell in the exosome to complete the delivery purpose.

[0044] Example 3: Constructing a lentivirus expressing a cargo delivery subsystem (CDNF)

[0045] The plasmid pCDH-EF1-MCS-T2A-Puro (HonorGene, HG-VMS0752) was modified using commercially available technology. All restriction endonucleases and T4 ligases were purchased from Thermo Fisher Scientific. The plasmid mini-extraction and purification kit and the DNA gel recovery and purification kit were purchased from Axygen. The DH5α chemically competent cells were purchased from Shanghai Sangon Biotech Co., Ltd.

[0046] 3.1 An artificially synthesized DNA fragment containing a cargo carrier system (SEQ ID NO.1), CDNF (NM_001029954), and EGFP (green fluorescent protein) cDNA; the fragment between CDNF and EGFP is a T2A linker peptide, and the nucleotide sequence of CDNF-T2A-EGFP (SEQ ID NO.3) is loaded into the cargo carrier system through the restriction enzyme sites “ggatcc” of BamHI and “gtcgac” of SalI.

[0047] The nucleotide sequence of CDNF-T2A-EGFP is as follows (5'-3'):

[0048]

[0049]

[0050] (In the sequences above, underlined italicized lowercase letters indicate restriction enzyme sites, lowercase letters indicate the cDNA sequence of the T2A linker peptide, and the rest of the sequences are in uppercase.)

[0051] 3.2 Modification of pCDH-EF1-MCS-T2A-Puro

[0052] After amplification of the pCDH-EF1-MCS-T2A-Puro vector, the plasmid was extracted. The 6.4 kb fragment was recovered after double digestion with NheI and SalI. The artificially synthesized DNA fragment from step 3.1 was then double-digested with NheI and SalI. The synthesized DNA fragment was cloned into the digested vector pCDH-EF1-MCS-T2A-Puro through the same restriction sites. Ligation was performed using T4 DNA ligase. The ligation product was transformed into competent DH5α cells, plated onto ampicillin-resistant solid agar plates, and several single colonies were picked and inoculated into ampicillin-resistant liquid agar. The cells were incubated overnight at 37°C with shaking at 200 rpm. A small amount of plasmid was extracted and sequenced. The results were confirmed by alignment using SnapGene software, yielding the recombinant plasmid vector pCDH-EF1-carrier subsystem-CDNF-T2A-EGFP. Figure 4 ).

[0053] 3.3 Packaging of the vector pCDH-EF1-cargo subsystem-CDNF-T2A-EGFP lentivirus

[0054] HEK293T cells were seeded into six-well plates and cultured in DMEM medium containing 10% fetal bovine serum. Transfection was performed when the cell confluence reached 70%-80%.

[0055] Following the instructions of EZ Trans cell transfection reagent (high efficiency) (Shanghai Liji, AC04L092), pCDH-EF1-cargo subsystem-CDNF-T2A-EGFP (20 μg), pVSVG (10 μg), and psPAX2 (15 μg) were co-transfected into HEK293T cells.

[0056] After 6 hours, the culture medium was replaced with DMEM containing 10% fetal bovine serum. After another 60 hours of culture, the culture medium was centrifuged at 3000 rpm for 10 minutes at 4°C to remove cell debris. The supernatant was filtered through a 0.45 μm low protein binding filter membrane (Millipore Steriflip HV / PVDF) to remove cell debris. The virus-containing culture medium was mixed with a lentivirus concentration kit (Jiman Biotechnology, GM-040801) at a volume ratio of 4:1, incubated overnight at 4°C, and then centrifuged at 4000g for 25 minutes at 4°C. The supernatant was carefully removed, and the virus was resuspended in an appropriate volume of DMEM to obtain concentrated virus solution, which was stored at -80°C.

[0057] Example 4: Constructing a lentivirus expressing an unloading subsystem

[0058] 4.1 A DNA fragment was artificially synthesized containing the nucleotide sequence of a hypoxia-responsive promoter (SEQ ID NO.4) and the nucleotide sequence of an unloading subsystem (SEQ ID NO.2). The 5' end of the hypoxia-responsive promoter is a SpeI restriction enzyme site, and the 3' end is an XbaI restriction enzyme site.

[0059] The nucleotide sequence of the hypoxia response promoter is as follows (5'-3'):

[0060]

[0061] (In the above sequences, the underlined italicized lowercase indicates the restriction site, and the remaining sequences are uppercase hypoxia response promoter sequences.)

[0062] 4.2 Modification of pCDH-EF1-MCS-T2A-Puro

[0063] After amplification of the pCDH-EF1-MCS-T2A-Puro vector, the plasmid was extracted. The 6.5 kb fragment was recovered after double digestion with SpeI and NotI. The artificially synthesized DNA fragment from step 4.1 was then double-digested with SpeI and NotI. The synthesized DNA fragment was cloned into the digested vector pCDH-EF1-MCS-T2A-Puro through the same restriction sites. Ligation was performed using T4 DNA ligase. The ligation product was transformed into competent DH5α cells, plated onto ampicillin-resistant solid agar plates, and several single colonies were picked and inoculated into ampicillin-resistant liquid agar. The cells were incubated overnight at 37°C with shaking at 200 rpm. A small amount of plasmid was extracted and sequenced. The results were confirmed by alignment using SnapGene software, yielding the recombinant plasmid vector pCDH-hypoxia-response-unloading subsystem-T2A-Puro. Figure 5 ).

[0064] 4.3 Vector pCDH-Hypoxia Response-Unloading Subsystem-T2A-Puro Lentiviral Packaging

[0065] HEK293T cells were seeded into six-well plates and cultured in DMEM medium containing 10% fetal bovine serum. Transfection was performed when the cell confluence reached 70%-80%.

[0066] Following the instructions of EZ Trans cell transfection reagent (high efficiency) (Shanghai Liji, AC04L092), pCDH-hypoxia response-unloading subsystem-T2A-Puro (20 μg), pVSVG (10 μg), and psPAX2 (15 μg) were co-transfected into HEK293T cells.

[0067] After 6 hours, the culture medium was replaced with DMEM containing 10% fetal bovine serum. After another 60 hours of culture, the culture medium was centrifuged at 3000 rpm for 10 minutes at 4°C to remove cell debris. The supernatant was filtered through a 0.45 μm low protein binding filter membrane (Millipore Steriflip HV / PVDF) to remove cell debris. The virus-containing culture medium was mixed with a lentivirus concentration kit (Jiman Biotechnology, GM-040801) at a volume ratio of 4:1, incubated overnight at 4°C, and then centrifuged at 4000g for 25 minutes at 4°C. The supernatant was carefully removed, and the virus was resuspended in an appropriate volume of DMEM to obtain concentrated virus solution, which was stored at -80°C.

[0068] Example 5: Construction of a human umbilical cord mesenchymal stem cell line simultaneously expressing the cargo delivery subsystem (CDNF) and the unloading subsystem.

[0069] 5.1 Human umbilical cord mesenchymal stem cells (MSCs) are isolated using conventional and recognized methods or obtained through other means.

[0070] 5.2 Cell Infection: MSC cells were seeded into six-well plates and cultured in DMEM / F12 medium containing 10% fetal bovine serum. When the cell confluence reached 70%-80%, lentiviruses from both the carrier subsystem (CNDF) and the unloading subsystem were added for infection. 24 hours after infection, the cells were cultured in a hypoxic environment (1% O2 concentration). 48-72 hours after infection, the culture medium was replaced with fresh medium (containing 4 μg / ml puromycin) for selection. 2-3 days after selection, the expression of green fluorescence was observed using an inverted fluorescence microscope, and cells exhibiting green fluorescence were sorted using a flow cytometer (FACSAria IIU, BD Biosciences). The resulting human umbilical cord mesenchymal stem cell line was named hUC-MSC. CDNF-exo The cell line was deposited at the Guangdong Provincial Center for Microbial Culture Collection on November 13, 2024, with accession number GDMCC NO:65478.

[0071] Example 6: Enrichment and analysis of exosome CDNF-exo

[0072] 6.1 Vaccinate with commercially available hUC-MSCs and hUC-MSCs respectively. CDNF-exo Cell lines were transferred to 15cm culture dishes. When cell confluence reached 70%-80%, the culture medium was removed, and the cells were washed once with PBS. The medium was then replaced with serum-free DMEM / F12 for hypoxic culture. The culture medium was collected after 48 hours of culture. The hypoxic environment was simulated using a three-gas incubator (ESCO, CLL-170T-8) with 95% N2, 1% O2, and 4% CO2.

[0073] 6.2 After pre-cooling the culture medium at -80℃, freeze-dry it for 5 hours using a vacuum freeze dryer (Scientz-50F / A) and concentrate the culture medium to half its volume. Extract exosomes according to the instructions of the exosome extraction and purification kit (Shanghai Yumeibo Biotechnology, UR52121) and store them in a -80℃ freezer.

[0074] 6.3 Western Identification: The extracted exosomes were detected by Western blotting for hUC-MSCs. exo (Control) and hUC-MSC CDNF-exo The expression levels of CDNF and CD63 were determined. The specific steps included: separating an equal volume of exosomes via SDS-PAGE and transferring them to a polyvinylidene fluoride membrane (PVDF, Merck Millipore, ISEQ00010). The membrane was blocked with 5% skim milk at room temperature for 1 hour. Then, it was incubated overnight at 4°C with CDNF antibody (Abcam, ab253238) and CD63 antibody (Proteintech, 25682-1-AP), and finally incubated with HRP-conjugated affinipure goat anti-rabbit IgG (H+L) secondary antibody. Applications... Protein expression levels were detected using Plus high-sensitivity chemiluminescence reagent (Shanghai Qinxiang, 1810212), and bands were observed using a ChemiScope 6100 chemiluminescence plate imaging system. The results showed that both groups of samples expressed CD63, but hUC-MSCs… CDNF-exo The secreted exosomes are rich in CDNF, while the exosomes secreted by hUC-MSCs do not contain CDNF. Figure 6 ).

[0075] Example 7: CDNF-exo was incubated with cells to analyze the expression and localization of CDNF in cells.

[0076] 7.1 Seed 4000 hUC-MSC cells into a glass-bottomed culture dish (Jet, BDD011035). After the cells adhered, add an equal volume of hUC-MSCs. exo (Control) or hUC-MSC CDNF-exo Observe after overnight incubation.

[0077] 7.2 Immunofluorescence Identification: Cells were fixed by soaking in 4% paraformaldehyde (PFA) at room temperature for 20 min. The fixative was removed, and the cells were washed three times with PBS. Cells were then soaked in 0.25% Triton X-100 at room temperature for 20 min. The 0.25% Triton X-100 was removed, and the cells were washed three times with PBS. Cells were incubated with 10% blocking serum (goat serum) at 37°C for 1 h. Cells were then incubated overnight at 4°C with CDNF antibody (Abcam, ab253238) or endoplasmic reticulum marker Calnexin antibody (Invitrogen, MA5-31501). Cells were washed three times with 0.1% Triton X-100 at 80 rpm for 2 min each time. Secondary antibody Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluoride TM Plus 488 (Invitrogen, A32723, 1:500), Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor TM Incubate with Plus555 (Invitrogen, A21428, 1:500) at 37°C for 1 hour. Wash three times with 0.1% Triton X-100 at 80 rpm for 2 minutes each time. Stain with DAPI for 10 minutes, then wash three times with PBS. Imaging and photography are performed using an inverted fluorescence microscope. The green fluorescent marker is CDNF, and the red fluorescent marker is the endoplasmic reticulum. Figure 7 Add hUC-MSC CDNF-exo In these cells, CDNF is expressed and located in the endoplasmic reticulum; hUC-MSCs were added. exo CDNF was not expressed in hUC-MSCs. This result indicates that hUC-MSCs... CDNF-exo It can deliver the CDNF it encapsulates into the cell interior, primarily located in the endoplasmic reticulum. Scale bar: 10 micrometers. Figure 7 The white dashed lines in the image represent the cell outlines.

[0078] The above description of the embodiments is provided to enable those skilled in the art to understand and apply the present invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the embodiments described herein, and any improvements and modifications made to the present invention by those skilled in the art based on the disclosure thereof should be within the scope of protection of the present invention.

Claims

1. An exosome-based protein delivery system, characterized in that, It includes a cargo loading subsystem and a cargo unloading subsystem, among which, The fusion protein expressed by the nucleotide sequence of the cargo delivery subsystem includes CD63, a linker peptide, an enterokinase cleavage site, and the delivered protein in sequence. In the cDNA sequence encoding the fusion protein, there are enzyme cleavage sites at both ends corresponding to CD63, the linker peptide, the enterokinase cleavage site, and the delivered protein. The fusion protein expressed by the nucleotide sequence of the unloading subsystem includes CD63, a linker peptide, and enterokinase or enterokinase light chain in sequence. In the cDNA sequence encoding the fusion protein, there are enzyme cleavage sites at both ends of the cDNA sequence corresponding to CD63, the linker peptide, and the enterokinase or enterokinase light chain. The promoter of the unloading subsystem is an anoxic response promoter; The enterokinase cleavage site is the DDDDK sequence in the amino acid sequence.

2. The exosome-based protein delivery system as described in claim 1, characterized in that, The cDNA sequence encoding the cargo delivery subsystem that does not contain a cDNA sequence encoding the delivery protein is shown in SEQ ID NO.

1.

3. The exosome-based protein delivery system as described in claim 1, characterized in that, The cDNA sequence encoding the unloading subsystem is shown in SEQ ID NO.

2.

4. The exosome-based protein delivery system as described in claim 1, characterized in that, The nucleotide sequence of the promoter of the unloading subsystem is: CCTCACTCCACCCCCATCCTAGCTTTGGTATGGGGGAGAGGGCACAGGGCCAGACAAACCTGTGAGACTTTGGCTCCATCTCTGCAAAAGGGAGCTCTGTGAGTCAGCCTGCTCCCCTCCAGGCTTGCTCCTCCCCCACCCAGCTCTCGTTTCCAATGCACGTACTGCACGTACTGCACGTACTGCACGTACAGCCCGTACACACCGTGTGCTGGGACACCCTATATATAGCCGC.

5. The exosome-based protein delivery system as described in claim 1, characterized in that, CD63, linker peptide, enterokinase cleavage site, and the delivered protein are arranged sequentially from N-terminus to C-terminus or from C-terminus to N-terminus in the fusion protein expressed by the nucleotide sequence of the cargo carrier system.

6. The exosome-based protein delivery system as described in claim 5, characterized in that, CD63, linker peptide, enterokinase cleavage site, and delivered protein are arranged sequentially from the N-terminus to the C-terminus in the fusion protein expressed by the nucleotide sequence of the cargo carrier system.

7. The exosome-based protein delivery system as described in claim 1, characterized in that, CD63, linker peptide, enterokinase, or enterokinase light chain are arranged sequentially from N-terminus to C-terminus or from C-terminus to N-terminus in the fusion protein expressed by the nucleotide sequence of the unloading subsystem.

8. The exosome-based protein delivery system as described in claim 7, characterized in that, CD63, linker peptide, enterokinase, or enterokinase light chain are arranged sequentially from the N-terminus to the C-terminus in the fusion protein expressed by the nucleotide sequence of the unloading subsystem.

9. The exosome-based protein delivery system as described in claim 1, characterized in that, The linker peptide expressed by the nucleotide sequences of the cargo loading subsystem and the unloading subsystem is the T2A linker peptide.

10. The use of the exosome-based protein delivery system as described in claim 1 in the preparation of cell lines for delivering proteins to the cytoplasm of target cells.

11. A human umbilical cord mesenchymal stem cell line hUC-MSC CDNF-exo It was deposited at the Guangdong Provincial Center for Microbial Culture Collection on November 13, 2024, with accession number GDMCC NO:65478.

Citation Information

Patent Citations

  • Membrane protein engineered exosome and preparation method thereof

    CN114807046A

  • Targeting exosome, preparation method, application, medicine and medicine delivery system

    CN115975051A