Chromatin open site marker related to colorectal cancer high-risk group identification and early screening and application of chromatin open site marker

Abstract

The invention relates to a chromatin open site marker related to colorectal cancer high-risk group identification and early screening and application of the chromatin open site marker. The marker is rs10871066. Large-scale population data and biofunctional experiments prove that the rs10871066 site has function regulation activity, an individual carrying the rs10871066 [A] genotype can be combined with a transcription factor FOXP1 more easily, and an individual carrying the rs10871066 [G] genotype can be combined with a transcription factor TCF7L2 more easily, so that the chromatin interaction between the region and a promoter of a target gene is influenced, the expression level of the target genes PIBF1 and KLF5 is promoted, and the expression level of the target genes PIBF1 and KLF5 is improved. Therefore, cancer cell proliferation is promoted, and the colorectal cancer risk of an individual is increased. The rs10871066 dangerous site of normal people is detected, so that high-risk people of the colorectal cancer are identified, and the diagnosis of patients with the colorectal cancer is assisted.

Description

Technical Field

[0001] The present invention relates to the fields of genetic engineering and tumor medicine, and in particular to a chromatin open site marker related to the identification and early screening of a high-risk population for colorectal cancer and an application thereof. Background Art

[0002] Colorectal cancer is one of the common malignant tumors of the digestive tract, which seriously threatens human life and health. Its incidence rate ranks third among malignant tumors in my country. With the development of the country's economic level and the changes in residents' lifestyle and dietary structure, the incidence and mortality of colorectal cancer in my country have shown an increasing trend year by year. Colorectal cancer has become a major public health problem that needs to be solved urgently in China and even in the world. At present, the most effective screening method for colorectal cancer is fecal occult blood test (FIT) combined with colonoscopy. However, this method also has problems such as low detection rate and low patient acceptance. Therefore, if early screening and early diagnosis can be carried out more accurately for high-risk individuals for colorectal cancer, it can make patients more accepting and save a lot of medical expenses for the country.

[0003] In recent years, individualized screening programs based on molecular genetics have become the focus of screening for high-risk populations for colorectal cancer. Single nucleotide polymorphism (SNP) is the most common genetic variation and a type of molecular marker that has been proven to be associated with the risk of tumor occurrence, reflecting differences in individual genetic background. To date, Genome-Wide Association Study (GWAS) has identified more than 200 genetic susceptibility SNPs for colorectal cancer. Among the susceptibility SNPs found by GWAS, more than 90% are located in the non-coding regions of the genome, which can affect the risk of colorectal cancer by participating in gene expression regulation. With the rapid development of GWAS, with the support of high-throughput genome detection technology, researchers have found that non-coding regions contain many cis-regulatory elements (CRE), such as promoters, enhancers and insulators, which can play a huge role in gene expression regulation, thereby affecting the occurrence and susceptibility of tumors. With the rise of epigenomics and three-dimensional genomics, researchers have become more and more clear about the characteristics and mechanisms of CREs. For example, through the Assay for Transposase Accessible Chromatin with high-throughput sequencing (ATAC-seq) technology, it was found that CREs are often enriched in open chromatin regions, and the exposed DNA makes it easier for it to bind to transcription factors (TF), thereby participating in gene expression regulation. Through the Chromatin Immunoprecipitation and high-throughput sequencing (ChIP-seq) technology, it was found that nucleosomes near CREs often have specific histone modifications. These special epigenetic marks can help predict the activity state of CREs and distinguish different CREs. In addition, with the continuous maturity of high-throughput chromatin three-dimensional conformation capture technology (High-Through Chromosome Conformation Capture, Hi-C). Researchers have found that chromatin can form a ring structure (Chromatin Looping) through three-dimensional folding, which spatially shortens the distance between enhancers and promoters, thereby activating gene transcription.

[0004] Integrating histone modification information to analyze the chromatin activity state and identifying genetic susceptibility loci for colorectal cancer on this basis can achieve fine positioning of pathogenic loci and accurately explain the susceptibility mechanism behind statistical associations. We collected tissue samples from three stages of colorectal normal, precancerous lesions, and cancer for multi-omics analysis including ATAC-seq, ChIP-seq, RNA-seq, and Hi-C, thereby constructing a multi-stage cis-regulatory element map for colorectal cancer and discovered regulatory elements CRE:chr13:73,990,100-73,990,450 with significant differences in colorectal cancer progression. Among them, the genetic locus rs10871066 located in this region has the strongest gene expression regulation effect. Compared with rs10871066 [A] individuals, individuals carrying the [G] allele have a significantly increased risk of colorectal cancer. Mechanistically, we found that rs10871066 promotes the expression of PIBF1 and KLF5 in an allele-specific manner through long-range chromatin loop interactions. Moreover, TCF7L2 specifically binds to the rs10871066[G] allele, and FOXP1 specifically binds to the rs10871066[A] allele, thereby affecting the expression levels of the target genes PIBF1 and KLF5. KLF5 is involved in multiple pathogenic pathways such as NF-κB, Wnt, and Apoptosis, while PIBF1 promotes the risk of colorectal cancer by inhibiting NK cell activity. Therefore, the rs10871066 variant located in the non-coding region is closely related to the risk of colorectal cancer, and is expected to be used clinically to assist in the early diagnosis of colorectal cancer and early detection of colorectal cancer patients. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and to provide a chromatin open site marker related to the identification and early screening of a high-risk population for colorectal cancer and its application.

[0006] The technical solution of the present invention to solve the above technical problems is as follows:

[0007] A chromatin open site marker associated with the identification and early screening of high-risk populations for colorectal cancer, the marker being rs10871066.

[0008] The specific amplification primer sequences of the chromatin open site marker rs10871066 related to the identification and early screening of high-risk populations for colorectal cancer are SEQ ID NO: 1 and SEQ ID NO: 2.

[0009] The probe sequences of the chromatin open site marker rs10871066 related to the identification and early screening of high-risk populations for colorectal cancer are SEQ ID NO: 3 and SEQ ID NO: 4.

[0010] The use of the detection reagent for the chromatin open site marker rs10871066 related to the identification and early screening of high-risk populations for colorectal cancer in the preparation of a colorectal cancer auxiliary diagnosis kit.

[0011] A colorectal cancer early screening and auxiliary diagnosis kit for detecting rs10871066 in peripheral blood DNA.

[0012] The colorectal cancer early screening and auxiliary diagnosis kit comprises the specific amplification primers of the above-mentioned SNP markers and the specific probes of the SNP markers.

[0013] The beneficial effects of the present invention are: from the molecular biology and gene diagnosis level, a technical method for screening a high-risk group for colorectal cancer is provided. This method is based on our previous integration of multi-omics technology to show that the rs10871066 site is related to the susceptibility to colorectal cancer in the Chinese population. By cleverly designing primers and probes for the rs10871066 site, it is possible to rely on fluorescent quantitative PCR to detect the rs10871066 risk site in the normal population, thereby identifying the high-risk group for colorectal cancer, and assisting in the early screening and diagnosis of colorectal cancer. The technical method is cleverly designed, simple and feasible, and the results are accurate and reliable. It can be promoted in hospitals at all levels, and it provides help for assessing the risk of colorectal cancer, and it is helpful to perform colorectal cancer screening and early intervention on this type of population clinically. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Flow chart of integrating multi-omics to identify the colorectal cancer susceptibility locus rs10871066;

[0015] Figure 2 AUC curve of colorectal cancer risk prediction model based on SNP site rs10871066;

[0016] Figure 3 Schematic diagram of the results of the rs10871066 dual luciferase reporter gene experiment;

[0017] Figure 4 Schematic diagram of the regulation of rs10871066 genotype on the expression levels of target genes KLF5 and PIBF1;

[0018] Figure 5 Schematic diagram of the specific binding of rs10871066 genotype with transcription factors FOXP1 and TCF7L2;

[0019] Figure 6 Schematic diagram of the effect of overexpression of the target gene KLF5 on the proliferation ability of colorectal cancer cell lines;

[0020] Figure 7 Schematic diagram of the effect of overexpression of the target gene PIBF1 on the proliferation ability of colorectal cancer cell lines. DETAILED DESCRIPTION

[0021] The principles and features of the present invention are described below. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0022] The technical solution of the present invention to solve the above technical problems is as follows:

[0023] A chromatin open site marker associated with the identification and early screening of high-risk populations for colorectal cancer, the marker being rs10871066.

[0024] The specific amplification primer sequences of rs10871066 are SEQ ID NO: 1 and SEQ ID NO: 2.

[0025] The specific probe of the chromatin open site marker related to the identification and early screening of high-risk population for colorectal cancer, the probe sequence of rs10871066 is SEQ ID NO: 3 and SEQ ID NO: 4.

[0026] The use of the detection reagent for chromatin open site markers related to the identification and early screening of high-risk populations for colorectal cancer in the preparation of a colorectal cancer auxiliary diagnosis kit.

[0027] A colorectal cancer early screening and auxiliary diagnosis kit, the kit is used to detect rs10871066 in peripheral blood DNA.

[0028] The kit comprises the specific amplification primers for the above-mentioned SNP markers and the specific probes for the above-mentioned SNP markers.

[0029] Specifically, the technical solutions to the problems of the present invention include: (1) Establishing a specimen library and database with unified standards: Collecting blood samples of subjects that meet the standards according to standard operating procedures (SOPs), and systematically collecting complete demographic and clinical data. (2) Genotype detection: Selecting colorectal cancer cases and healthy controls, combining ATAC-seq, ChIP-seq, RNA-seq, Hi-C and other multi-omics, more accurately find the SNP marker rs10871066 associated with the onset of colorectal cancer. (3) The screened positive association markers are verified in independent large population samples to determine the stability of their association. (4) Development of auxiliary diagnosis kits for colorectal cancer: Develop early screening and auxiliary diagnosis kits based on genetic markers with significant differences in genotype distribution frequencies between colorectal cancer cases and healthy controls.

[0030] Specifically, the experimental method of the present invention mainly includes the following contents:

[0031] First, we collected colorectal normal, precancerous lesions, and cancer tissue samples removed by colorectal cancer surgery from Zhongnan Hospital Affiliated to Wuhan University and Tongji Hospital Affiliated to Huazhong University of Science and Technology, and performed ATAC-seq, H3K27ac ChIP-seq, and RNA-seq experiments and analyses, and then mapped multi-stage cis-regulatory elements across the genome, and discovered regulatory elements with significant differences in colorectal cancer progression. Among them, we found that the regulatory element region where rs10871066 is located: chr13:73,990,100-73,990,450, changed most significantly during the multi-stage progression of colorectal cancer. We then annotated the variations in this region (MAF>0.01) and obtained the candidate variation site rs10871066. Figure 1 We speculated that rs10871066 could serve as the causal variant within the reported GWAS locus because it is closely related to the tag variant rs1886450 (r 2 ≥0.8) showed high linkage disequilibrium. We recruited 1,524 colorectal cancer patients with complete medical records and 1,522 normal controls with no history of tumor from Beijing, China, and performed genotyping. Patients were diagnosed by histopathology without age restrictions; normal controls had no history of tumors and no signs of tumors after physical examination. At the same time, information such as gender, age, smoking and drinking of the subjects was collected. Each subject gave informed consent to participate in this study and donated 2 ml of peripheral venous blood for the isolation and preparation of lymphocyte genomic DNA. At the same time, the European population colorectal cancer genotype and phenotype dataset from the GECCO project was downloaded from the dbGaP database, which included 17,789 colorectal cancer cases and 19,951 control samples. The basic demographic characteristics of the subjects are shown in Table 1.

[0032] Table 1. Basic information of the Chinese and European colorectal cancer case-control studies used in this study

[0033]

[0034] We used the unconditional logistic regression model to calculate the association between SNP locus rs10871066 and colorectal cancer susceptibility for the population samples included in the study, and corrected for gender, age, smoking, and drinking. The case-control study results showed that in the European population sample, individuals carrying the rs10871066 risk genotype had a 5% increased risk of colorectal cancer compared with normal people (OR = 1.05, 95% CI: 1.02-1.09, P = 6.65×10 -4Detailed results are shown in Table 2. In the Chinese population sample, individuals carrying the rs10871066[G] risk genotype had a 21% increased risk of colorectal cancer (OR = 1.21, 95% CI: 1.09-1.36, P = 6.92×10 -4 ). Detailed results are shown in Table 3.

[0035] Table 2. Results of association analysis of rs10871066 in colorectal cancer risk in case-control study samples from European population

[0036]

[0037] *Calculated using logistic regression model, adjusted for gender and age.

[0038] Table 3. Results of association analysis of rs10871066 in colorectal cancer risk in case-control study samples of Chinese population

[0039]

[0040] *Calculated using logistic regression model, adjusted for sex, age, smoking and drinking status.

[0041] The results of the previous large-sample population association analysis showed that this site is a risk site for colorectal cancer, so we used this risk SNP site to establish a risk prediction model for colorectal cancer. We constructed a formula that comprehensively considers the three genotypes of SNP and gender, age, smoking and drinking conditions. Among them, for SNP genotyping, wild homozygous type = "1", heterozygous type = "2", and mutant homozygous type = "3"; for gender, male is "1" and female is "0"; for age, greater than or equal to 60 years old is "1", and less than 60 years old is "0". During the analysis, the multivariate logistic regression coefficient β was used as the weight, and the formula for the risk score based on rs10871066 typing was obtained as follows:

[0042] The risk score for the Chinese population = (0.1914 × gender score) + (-0.0407 × age score) + (0.8557 × smoking score) + (-0.4465 × drinking score) + (0.1895 × rs10871066 typing score).

[0043] European population risk score = (-0.1985 × gender score) + (0.4778 × age score) + (0.0563 × rs10871066 typing score)

[0044] By drawing the ROC curve, we can find that the area under the curve of this model is 0.595 for the Chinese population and 0.572 for the European population. Figure 2 shown.

[0045] In order to functionally analyze the colorectal cancer risk association of the rs10871066 marker, the mechanism by which this SNP site affects the occurrence and development of colorectal cancer was explored.

[0046] First, we used reporter gene experiments to verify the functional regulatory function of the region where rs10871066 is located. DNA fragments containing different alleles of rs10871066 were constructed in the forward or reverse direction into reporter gene plasmid vectors, and co-transfected with the internal control plasmid pRL-SV40 into two human colorectal cancer cell lines, SW480 and HCT116. The expression of dual luciferase genes was then detected, and the relative luciferase activity differences between different groups were compared. We found that regardless of the direction of DNA fragment insertion, the reporter gene activity of the rs10871066[G] genotype group was significantly increased compared with the rs10871066[A] genotype group. The results showed that the transcriptional activation effect of the enhancer of the rs10871066[G] site was stronger than that of rs10871066[A]. The results are as follows Figure 3 At the same time, the eQTL analysis results showed that the rs10871066 locus with enhancer activity was closely related to the expression levels of the target genes PIBF1 and KLF5 in CRC tissues of population samples. Figure 4 Then we used the JASPAR website prediction and EMSA experiments to verify that individuals with the rs10871066[A] genotype are more likely to bind to the transcription factor FOXP1, and individuals with the rs10871066[G] genotype are more likely to bind to the transcription factor TCF7L2. The results are as follows Figure 5 shown.

[0047] To explore the mechanism by which target genes affect the occurrence and development of colorectal cancer, we verified the biological functions of the target genes KLF5 and PIBF1 through in vitro cell experiments.

[0048] KLF5 is an important transcription factor and oncogene, and its expression activity is regulated by multiple signaling pathways, including Ras / MAPK, PKC, TGFβ, and multiple post-transcriptional regulatory pathways such as phosphorylation, acetylation, and ubiquitination. The effects of target genes on the proliferation ability of colorectal cancer cells were detected through cell proliferation and clone formation experiments. The results showed that compared with the blank control group cells, the clone formation ability of the KLF5 overexpressing cell line was significantly enhanced. The experimental results showed that KLF5 can play a certain role in promoting the proliferation of colorectal cancer cells. The results are as follows Figure 6 shown.

[0049] PIBF1 encodes a protein induced by the steroid hormone progesterone that regulates multiple aspects of the immune system, including cytokine synthesis, natural killer (NK) cell activity, and arachidonic acid metabolism to promote normal pregnancy. In an in vitro co-culture environment of tumor cells and NK cells, we found that overexpression of PIBF1 resulted in a higher tumor cell mortality rate through cell proliferation and clone formation experiments, such as Figure 7 shown.

[0050] Combining the above large-scale population analysis, bioinformatics analysis and rigorous experimental design, the results showed that the rs10871066 risk site located in the regulatory element region chr13:73,990,100-73,990,450 significantly increased the risk of colorectal cancer in individuals carrying the [G] allele variant relative to individuals carrying rs10871066[A]. And its mechanism of action is to affect the specific binding of the transcription factor TCF7L2 to the rs10871066[G] allele, and the specific binding of FOXP1 to the rs10871066[A] allele, thereby affecting the expression levels of the target genes PIBF1 and KLF5, thereby promoting the risk of colorectal cancer. Therefore, the rs10871066 risk site located in the non-coding region is closely related to the risk of colorectal cancer, and is expected to be used in clinical practice to assist in the early diagnosis of colorectal cancer and early detection of high-risk populations for colorectal cancer.

[0051] Experimental methods:

[0052] 1. Peripheral blood DNA extraction:

[0053] We used the conventional phenol-chloroform method to extract DNA. The specific steps are as follows:

[0054] 1) Take about 3 ml of anticoagulated blood, centrifuge at 5,000×g for 15 min at room temperature, discard the upper layer, and keep about 0.3 ml of blood cells. Add 0.5 ml of freshly prepared extraction buffer with a final concentration of 20 μg / ml RNase, mix well, and incubate at 37°C for 1 hour.

[0055] 2) Add proteinase K at a final concentration of 100 μg / ml, mix well and incubate at 37°C overnight.

[0056] 3) Add 0.7 ml of phenol (pH = 7.0) equilibrated with Tris buffer to each tube, mix thoroughly, and centrifuge at 8,000 × g for 15 min at room temperature.

[0057] 4) Transfer the upper layer of liquid to another 1.5 ml centrifuge tube, add an equal volume of 0.7 ml of phenol-chloroform (1:1), mix thoroughly for 15 minutes; and centrifuge at 8,000 × g for 15 minutes at room temperature.

[0058] 5) Transfer the upper liquid to another clean 1.5 ml centrifuge tube, add 10% volume of 10 M ammonium acetate solution, add 2 volumes of pre-cooled anhydrous ethanol, and let stand at –20°C for 2 hours to precipitate DNA.

[0059] 6) The precipitated DNA was washed with 75% ethanol, centrifuged at 12,000×g for 15 min, and the supernatant was discarded; then washed with 75% ethanol, centrifuged at 12,000×g for 15 min, and the supernatant was discarded.

[0060] 7) Place the tube upside down on absorbent paper. After the ethanol has evaporated, add appropriate TE buffer to each tube. Place at 4°C for one week and then store at –20°C for later use.

[0061] 2. Genotyping

[0062] The typing platform used was TaqMan genotyping technology (ABI 7900HT Real Time PCR system, Applied Biosystems), and the 5 μl PCR reaction system was shown in Table 4:

[0063] Table 4. TaqMan genotyping system preparation

[0064]

[0065] The reaction conditions were: pre-denaturation at 95°C for 10 min, followed by 45 cycles of 95°C for 15 sec and 60°C for 1 min, and cooling to 4°C.

[0066] The primers and probes used in the reaction are as follows:

[0067] rs10871066 Primers:

[0068] Forward primer: AGCCCTTAGAGAGCATGCAAGA (SEQ ID NO: 1)

[0069] Reverse primer: AGAATGGAGGCAGCAAGGAAG (SEQ ID NO: 2)

[0070] rs10871066 probe:

[0071] Forward probe: FAM-CATTAGCTACTCCTTCTC-MGB (SEQ ID NO: 3)

[0072] Reverse probe: VIC-CATTAGCTACTCTTTCTC-MGB (SEQ ID NO: 4)

[0073] 3. Cell Proliferation Assay

[0074] 1) Cell counting

[0075] Before conducting CCK-8 proliferation experiments and clone formation experiments, cell counting is required to ensure that the appropriate number of cells are inoculated in the wells of different groups. This experiment uses a blood cell counting plate for cell counting. The counting plate consists of two counting pools of the same size, each of which consists of nine 1mm×1mm squares. Each square can accommodate 0.1mm 3 Liquid volume. The specific counting steps are as follows:

[0076] ① Digest the cell wells that have been cultured for a period of time to obtain a cell suspension and mix as thoroughly as possible to break up the cells.

[0077] ②Disinfect the counting plate and cover it with a coverslip.

[0078] ③ Pipette 10mL of cell suspension and slowly drip it into the counting plate along the edge of the glass slide, making sure there are no bubbles between the coverslip and the counting plate).

[0079] ④ Leave it for 1 minute, observe the counting plate under a microscope, and count the squares in the four corners according to the following principles: a. For cells pressing the edge of the square, only count the cells on the top and left sides; b. If the cells are in clumps, count them as one cell.

[0080] ⑤Cell suspension concentration = total number of cells in the four-corner grid / 4×10 4 Pieces / mL.

[0081] 2) CCK-8 cell proliferation assay

[0082] In this study, CCK-8 kit (Dojindo, Japan) was used to detect the proliferation ability of colorectal cancer cells.

[0083] ①Pipette 100 mL of cell suspension and dilute to about 2,000 cells according to the counting concentration, and inoculate into a 96-well plate.

[0084] ② Perform cell activity detection at four time points: 24h, 48h, 72h and 96h. Add 10mL CCK-8 reagent to each well, shake it up and down to mix gently, and return it to the cell culture incubator to continue culturing for 1.5h.

[0085] ③Use an enzyme-labeled instrument to measure absorbance with the wavelength set at 450 nm. Draw cell proliferation curves of different experimental groups based on the absorbance values ​​at four time points to compare their differences.

[0086] 3) Clone formation experiment

[0087] ① 36 hours after transfection, count the cells and dilute to an appropriate concentration. Add 2 mL of cell suspension to each well of a 6-well plate to make the cell count about 1,000 and continue culturing for about 2 weeks.

[0088] ② During this period, observe the cell morphology and replace fresh culture medium every 2 to 3 days. If cell clones are observed under a microscope, fixation and staining can be performed.

[0089] ③ Take out the 6-well plate from the incubator, remove the waste liquid and slowly add PBS to wash twice. After aspirating PBS from each well, add 2 mL of methanol solution and place at room temperature for 30 minutes.

[0090] ④ After absorbing the methanol, add 0.25% crystal violet solution and place in the dark for 30 minutes for staining.

[0091] ⑤After staining is completed, remove the waste liquid from the wells, wash the well plate with double distilled water until the field of vision is clear, and take photos for preservation.

[0092] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A chromatin open site marker associated with the identification and early screening of high-risk populations for colorectal cancer, the marker is rs10871066.

2. The chromatin open site marker associated with identification of high-risk populations and early screening for colorectal cancer according to claim 1, characterized in that: The specific amplification primer sequences of rs10871066 are SEQ ID NO: 1 and SEQ ID NO:

2.

3. The chromatin open site marker associated with identification of high-risk populations and early screening for colorectal cancer according to claim 1, characterized in that: The probe sequences of rs10871066 are SEQ ID NO: 3 and SEQ ID NO:

4.

4. Application of detection reagents for the chromatin open site marker rs10871066, which is associated with the identification of high-risk populations and early screening for colorectal cancer, in the preparation of auxiliary diagnostic kits for colorectal cancer.

5. A kit for early screening and auxiliary diagnosis of colorectal cancer, characterized in that: Used to detect rs10871066 in peripheral blood DNA.

6. The kit for early screening and auxiliary diagnosis of colorectal cancer according to claim 5, characterized in that: The specific amplification primers with the sequences of SEQ ID NO: 1 and SEQ ID NO: 2 and the specific probes with the sequences of SEQ ID NO: 3 and SEQ ID NO: 4 are included.

Images