SNP (Single Nucleotide Polymorphism) molecular marker located on porcine chromosome 14 and related to porcine reproductive traits and application of SNP molecular marker

Abstract

The invention relates to the technical field of molecular biology and molecular markers, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker located on a porcine chromosome 14 and related to porcine reproductive traits and application. The SNP site of the SNP molecular marker located on the No.14 chromosome of the pig and related to the reproductive traits of the pig corresponds to the Cgt at the 105043272th site on the No.14 chromosome of the international pig reference genome version 11.1; t mutation is carried out, and the polymorphism of the basic group at the site affects the porcine reproductive traits; wherein the reproductive performance of pigs with CC and TC genotypes is superior to that of pigs with TT genotypes. By optimizing the dominant alleles of the SNP molecular marker, the frequency of the dominant alleles can be increased generation by generation, the reproductive performance of pigs is improved, and the genetic improvement progress of the pigs is accelerated, so that the economic benefit of pig breeding is effectively improved.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology and molecular marker technology, and in particular to a SNP molecular marker located on pig chromosome 14 and associated with pig reproductive traits and its application. Background Art

[0002] The reproductive performance of pigs is one of the most important economic traits in pig production and is of great significance to improving breeding efficiency and economic benefits. Reproductive performance mainly includes multiple traits such as the number of sows born, the number of healthy piglets, and the birth litter weight, which are jointly affected by multiple genes and environmental factors. Since the heritability of reproductive traits is generally low, traditional selective breeding methods have limited effects in improving reproductive performance. Therefore, exploring genetic markers related to reproductive traits and providing a basis for molecular marker-assisted selection (MAS) have become a hot topic in pig breeding research.

[0003] In recent years, with the development of genomics and high-throughput sequencing technology, a large number of genetic markers related to pig economic traits have been discovered. The application of molecular markers can not only significantly shorten the breeding cycle, but also improve breeding accuracy, especially in reproductive traits that are difficult to improve through phenotypic selection. However, the number of molecular markers currently used to improve pig reproductive traits is limited, and some markers lack stability or are only applicable to specific breeds. Therefore, the development of stable and widely applicable molecular markers has important theoretical and practical value for improving reproductive performance and optimizing breeding strategies.

[0004] Although existing studies have identified some SNPs (single nucleotide polymorphisms) related to reproductive traits through genome-wide association studies (GWAS) and whole genome sequencing methods, there is still a lack of clear functional verification and commercial application examples. By studying SNP sites in specific regions of pig chromosomes, new tools can be provided for molecular marker-assisted selection of reproductive traits, filling the gap in related research fields and providing scientific basis and technical support for the development of modern pig farming. Summary of the invention

[0005] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present invention is to provide a SNP molecular marker located on pig chromosome 14 and associated with pig reproductive traits.

[0006] Another object of the present invention is to provide a primer pair for detecting the above-mentioned SNP molecular marker.

[0007] Another object of the present invention is to provide a kit for detecting the above-mentioned SNP molecular markers, wherein the kit comprises the above-mentioned primer pair.

[0008] The fourth object of the present invention is to provide applications of the above-mentioned SNP molecular markers, primer pairs and kits.

[0009] A fifth object of the present invention is to provide a method for screening pig breeds with high or excellent reproductive traits.

[0010] The sixth object of the present invention is to provide a method for genetic improvement of pigs.

[0011] The purpose of the present invention is achieved through the following technical solutions:

[0012] A SNP molecular marker located on chromosome 14 of pigs and related to pig reproductive traits, the SNP site of which corresponds to the C>T mutation at position 105043272 on chromosome 14 of the international pig reference genome version 11.1. The polymorphism of the base at this site affects pig reproductive traits; among them, the reproductive performance of pigs with CC and TC genotypes is better than that of pigs with TT genotypes;

[0013] The reproductive traits include, but are not limited to, litter size, number of healthy piglets, and litter weight at birth;

[0014] Preferably, the nucleotide sequence of the SNP molecular marker is preferably as shown in SEQ ID No: 2, wherein M in the sequence is C or T;

[0015] Preferably, the SNP site of the SNP molecular marker is the nucleotide mutation C171-T171 at position 171 of the sequence annotation of SEQ ID No: 2 (corresponding to position 105043272 on chromosome 14 of the international pig reference genome version 11.1, named g.105043272C>T);

[0016] Preferably, the pig is a Large White sow and its synthetic strain;

[0017] A primer pair for detecting the above-mentioned SNP molecular marker comprises primers P001-F and P001-R, and the nucleotide sequences thereof are as follows:

[0018] Primer P001-F: 5′-CTTGGGCCAGGTTTTTGAGC-3′;

[0019] Primer P001-R: 5′-GGCACCTTTACAGACACCGA-3′;

[0020] A kit for detecting the above-mentioned SNP molecular marker, comprising the above-mentioned primer pair;

[0021] Application of the SNP molecular marker, primer pair or kit in identifying pig reproductive-related traits, screening pig breeds with high or excellent reproductive traits, or genetic breeding of pig reproductive traits;

[0022] Preferably, the genetic breeding is pig molecular marker-assisted breeding;

[0023] Preferably, the pig is a Large White sow and its synthetic strain;

[0024] A method for detecting pig reproductive traits comprises the following steps:

[0025] Detect the SNP molecular marker on the pig chromosome 14, and judge the pig reproductive traits according to whether the single nucleotide at the SNP site of the SNP molecular marker is C or T; wherein the reproductive performance of pigs with CC and TC genotypes is better than that of pigs with TT genotypes;

[0026] Preferably, the pig is a Large White sow and its synthetic strain;

[0027] A method for screening pig breeds with high or excellent reproductive traits comprises the following steps:

[0028] Detect the above SNP molecular markers on chromosome 14 of pigs; according to the SNP sites of the SNP molecular markers, eliminate individuals with genotype TT and retain individuals with genotype CC and TC; wherein, the reproductive performance of pigs with CC and TC genotypes is better than that of pigs with TT genotype;

[0029] Preferably, the pig is a Large White sow and its synthetic strain;

[0030] The detection method comprises the following steps:

[0031] (1) Extracting genomic DNA from the pig to be tested;

[0032] (2) using the above primer pair or the primer pair in the above kit as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, to perform PCR amplification to obtain a PCR amplification product;

[0033] (3) sequencing the PCR amplification product to obtain sequencing results;

[0034] (4) determining the genotype of the SNP molecular marker based on the sequencing results;

[0035] A method for genetic improvement of pigs, comprising the following steps:

[0036] Determine the above-mentioned SNP molecular markers of pigs in the pig core group, and make corresponding selections based on the molecular markers: in the succession selection of breeding pigs, pig individuals with CC or TC genotype at the 105043272 nucleotide position on chromosome 14 of the international pig reference genome version 11.1 are selected, and pig individuals with TT genotype at the position are eliminated, so as to increase the frequency of allele C at the position from generation to generation, thereby improving the reproductive performance of offspring pigs;

[0037] Preferably, the pig is a Large White sow and its synthetic strain;

[0038] Compared with the prior art, the present invention has the following advantages and effects:

[0039] (1) The present invention determines that the SNP molecular marker associated with pig reproductive traits is located at nucleotide 105043272 on chromosome 14 of the international pig reference genome version 11.1, and the base of this site is C or T. The present invention verifies its effect on reproductive traits, and ultimately establishes efficient and accurate molecular marker-assisted breeding technology, which is applied to the genetic improvement of pig reproductive traits. The use of molecular breeding methods can solve the problem of genetic improvement of pig reproductive traits, thereby improving the reproductive performance of future generations of pigs, improving the economic benefits of enterprises, and increasing core competitiveness.

[0040] (2) The present invention provides a reagent (e.g., primer pair) and a kit for detecting the above-mentioned SNP molecular markers. Through the corresponding primer pairs and kits, etc., an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select reproductive traits and accelerate the breeding process.

[0041] (3) The present invention provides a method for genetic improvement of pigs. By optimizing the dominant allele of the SNP molecular marker, the dominant allele frequency can be increased from generation to generation, the reproductive performance of pigs can be improved, and the progress of genetic improvement of pigs can be accelerated, thereby effectively improving the economic benefits of pig breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 This is a phenotypic analysis chart of the litter size trait of pigs with different genotypes, where 14.31, 14.28 and 12.71 are the average litter sizes of pigs with corresponding genotypes.

[0043] Figure 2 This is a phenotypic analysis chart of the healthy piglet number trait of pigs with different genotypes, where 11.05, 10.91 and 9.00 are the average values ​​of the healthy piglet number of pigs with corresponding genotypes.

[0044] Figure 3 This is a phenotypic analysis chart of the litter weight at birth for pigs with different genotypes, where 15.52, 14.42 and 13.42 are the average litter weights of pigs with corresponding genotypes. DETAILED DESCRIPTION

[0045] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0046] Example 1

[0047] (1) Experimental animals

[0048] The experimental pig group used in the present invention is 1314 purebred large white sows from the pig farming experimental department of Wen's Food Group Co., Ltd., which is the core group of the pig farming division, and the herd genealogy is recorded in detail. The pigs are free to eat and drink, and the entire feeding method and feeding conditions are always consistent, which is a conventional method.

[0049] (2) Measurement and statistics of reproductive traits

[0050] The above-mentioned first-parity reproductive traits of purebred Large White sows were statistically analyzed by conventional methods, including phenotypic data such as litter size, healthy piglets, and litter weight at birth. Among them, litter size refers to the total litter size, which refers to the number of all piglets born in the same litter, which is equal to the sum of the number of live piglets, the number of dead piglets, and the number of mummies; the number of healthy piglets refers to the number of piglets with a birth weight of not less than 1.0 kg, no genetic defects, and good vitality; the litter weight at birth refers to the sum of the weight of all live piglets within 24 hours of birth, in kg.

[0051] (3) Sample collection

[0052] The tail-docked tissues and ear tissues of the sows were collected, immersed in a 75% ethanol solution, and stored in a -20°C refrigerator for later use.

[0053] (4) Pig whole genome resequencing

[0054] The tail or ear tissue collected from each individual of the 1314 purebred Large White sows in the above-mentioned experimental pig group was used to extract the whole genome DNA using the standard phenol-chloroform method, and the DNA concentration and OD ratio (OD260 / 280, OD260 / 230) of each sample were accurately measured by the Nanodrop2000 / 2000C nucleic acid protein detector, among which the A260 / 280 ratio was 1.8-2.0, and the A260 / 230 ratio was 1.7-1.9, which was judged to be qualified. The qualified DNA samples detected by the NanoDrop2000 / 2000C nucleic acid protein detector were diluted to about 50ng / μL according to the detection concentration. Then, 6 μL of the extracted DNA sample was mixed with 2 μL Loading Buffer, loaded into 1% agarose gel by mass volume ratio, electrophoresed at 150 V for 25 min, and observed and photographed under UV spectrophotometer and gel imaging equipment to observe the integrity of the DNA.

[0055] (5) Pig whole genome resequencing and quality control

[0056] The qualified DNA samples were randomly interrupted by enzyme digestion and Covaris crusher; then the library was constructed using TruSeqLibrary Construction Kit; the constructed library was then resequenced on the Illumina Hiseq platform according to the standard process in the operating manual. The raw sequencing data after the machine was subjected to standard quality control, and the specific filtering criteria are as follows:

[0057] ① Remove reads with adapters;

[0058] ② When the N (unknown base) content in the sequencing reads exceeds 1% of the number of bases in the reads, the reads are removed;

[0059] ③ When the number of low-quality (Q≤5) bases in the sequencing reads exceeds 50% of the total number of bases in the reads, the reads are removed;

[0060] ④ The effective sequencing reads were aligned to the international pig reference genome version 11.1 using BWA software, and the duplicate sequences were removed using samtools software.

[0061] (6) SNP detection

[0062] SNP detection is mainly implemented by GATK software's Haplotype Caller and Variant Filtration modules to obtain SNP valid genotype data covering the entire pig genome. The specific process is as follows:

[0063] ① Use the Haplotype Caller module to generate a SNP site file for the data after quality control in step (4);

[0064] ② Use the Variant Filtration module to strictly filter the above SNPs according to indicators such as QD (QualByDepth), FS (FisherStrand), MQ (RMSMappingQuality), SOR (StrandOddsRatio), and MQRankSum (MappingQualityRankSumTest);

[0065] ③SNP cluster filtering: no two SNPs can exist within 5bp.

[0066] (7) Analysis of the association between different genotypes and reproductive phenotypes

[0067] Based on the effective SNP genotype data of the whole pig genome in step (5) above, a non-coding lncRNA LNC_026212 anchored by previous analysis was used [Shang, Y.; Zhang, Q.; Ding, Y.; Wang, Y.; Gu, S.; Zang, X.; Xu, Z.; Huang, S.; Li, Z.; Wu, Z.; et al. The Expression Pattern and Functional Analysis of Extracellular Vesicle Long Non-Coding RNAs from Uterine Fluid During Implantation in Pig. Animals 2025,15,245.https: / / doi.org / 10.3390 / ani15020245】In the coverage area of ​​chromosome 14 of the international pig reference genome version 11.1 (chr14:105037474-chr14:105044981), 43 SNP loci data were obtained, and the genotype effects of the 43 SNP loci were analyzed for association with the reproductive trait phenotypes to estimate the least squares mean of the trait phenotype, where P<0.05 was significantly correlated and P<0.01 was extremely significantly correlated. The specific analysis method is: using SAS 9.4 software, the generalized linear model (GLM) was used for calculation, and the specific model is as follows:

[0068] y=μ+g+e

[0069] Note: In the model, y represents the observed value of traits (phenotypic value), mainly including litter size, number of healthy piglets and litter weight at birth; μ represents the population mean of the phenotype; g represents the genotype effect, which is a fixed effect; e represents the random residual effect, which is assumed to obey the N~(0,σ2) distribution.

[0070] The sequence information of the above non-coding lncRNA LNC_026212 is as follows:

[0071] ATACATATTTTAATAAATCAAAGTCTGGAATCCTAAGCCTCAAATGATTCCTTAGAAAACTCCAGGGAAGACATACATTTGAGTGCAAACAGATTCACTCATCCCCACATATATTTTTACATGTACTGAAGGTTTTGTTTCTGGAAAGGAGGGGAGGGGTGGGGGAAGGAGAGAGGGACAAACTAAACTCCTAGGAGTTTAGTTGAGGGCTGAAGGGGTTAATGGAAGTTTCCTAATGAAACATGACACCCTCCATGTTGCTACAAAATGTTTCTTTCCGATTTGCCATCACAGTAACCATTGTGAGTGATCAGCCGGTACTGCCTGGCCAGGCACAGCTCCTCCTGCCTCTGCCTCACAATTTTCTGCACTTCTGGGGAGAAGCCGTGGGGGTCTCGGGCAAACACGAAGGAGTAGCTGTCGGCGCAGGTGCCATCGAGGTTCTGGAGGCGGCAGGAGTACTGCACGGCGTAGGTGTCATAGTCCGTGTCGATGATCCAGTGGTCATCGTTTCCTTTCTGGAGGAAGGATGCTACGCCCCAGTACTTCATCTTGAACTTGGCAGGGTCCTCGGTGTCTGTAAAGGTGCCCACCATGTCTGCGCACACGTCCCAGTTATTTAAAAGACGGACTCGACCCTTGGCCGTGGCGCTCATGTGGCCATTCTCGTCCACGGAGAATTCGGCGACGATGTTGTCCTGCAGAAAGAGCCCCTCGGGGTCCTTCTTGGCCATGGCGTACCAGGTGCCGGAGAAACGAGCCTTGTCGAAGTTCTCTTTGACTCGGAAGCTGCTCACTCGGCAGTCGCGCTCTGCCTGGGCGCTGCCCAGCGCCGCCAGTAGCACGAGCGCCCAAACCCATTCCATCTTGCTCCGGAGTCCGCCCCCGTGGCACTTCGCTCAAACCGCTTTGAAACACACCTACCAATTGTTAATCCTGCAATTTTATT

[0072] After calculation, the molecular marker SNP site chr14:105043272 was significantly associated with piglet size, healthy piglet number and litter weight at birth in the Large White sow population.

[0073] According to Table 1 and Figure 1 It can be seen that the CC type and TC type of the molecular marker SNP site chr14:105043272C>T (the 171st nucleotide in SEQ ID No: 2, corresponding to the C>T mutation at position 105043272 on chromosome 14 of the international pig reference genome version 11.1) have a higher litter size than the TT type (P<0.05), among which the phenotypic average of the litter size of CC type individuals is 1.6 heads higher than the phenotypic average of TT type individuals.

[0074] According to Table 2 and Figure 2 It can be seen that the CC type and TC type with the molecular marker SNP site chr14:105043272C>T have a higher number of healthy offspring than the TT type (P<0.01), among which the phenotypic average value of the number of healthy offspring of CC type individuals is 2.05 heads higher than the phenotypic average value of TT type individuals.

[0075] According to Table 3 and Figure 3 It can be seen that the CC type and TC type of the molecular marker SNP site chr14:105043272C>T have higher litter weight at birth than the TT type (P<0.05), among which the average phenotypic value of litter weight at birth of CC type individuals is 2.1kg higher than the average phenotypic value of TT type individuals.

[0076] Therefore, gradually retaining Large White sows with CC and TC genotypes during breeding to gradually increase the frequency of allele C at this site can significantly improve the reproductive traits of sows and bring greater economic benefits to the enterprise.

[0077] Table 1 Correlation analysis between molecular marker locus chr14:105043272 and litter size

[0078]

[0079] Note: The litter size results are expressed as mean ± standard error (SEM), and * indicates that the analysis results of genotype and litter size traits are significant (P<0.05).

[0080] Table 2 Correlation analysis between molecular marker locus chr14:105043272 and healthy cub number

[0081]

[0082] Note: The results of healthy piglets are expressed as mean ± standard error (SEM), and ** indicates that the analysis results of genotype and healthy piglet number traits are extremely significant (P<0.01).

[0083] Table 3 Correlation analysis between molecular marker locus chr14:105043272 and litter weight at birth

[0084]

[0085] Note: The results of litter weight at birth are expressed as mean ± standard error (SEM), and * indicates that the analysis results of genotype and litter weight at birth are significant (P<0.05).

[0086] Example 2 Target DNA sequence amplification and sequencing

[0087] (1) Primer design

[0088] The DNA sequence of SEQ ID No: 2 on chromosome 14 of pig was downloaded from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). Primers were designed using Primer-BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). The DNA sequence of the designed primers is shown below:

[0089] Primer P001-F: 5′-CTTGGGCCAGGTTTTTGAGC-3′;

[0090] Primer P001-R: 5′-GGCACCTTTACAGACACCGA-3′;

[0091] (2) PCR amplification

[0092] 1 μL DNA template, 3.4 μL double distilled water, 5 μL 2×Tag PCR StanMix with Loading Dye, and 0.3 μL primers P001-F and P001-R were added to the 10 μL reaction system. The PCR reaction conditions were: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 45 s, 35 cycles, and finally 72°C extension for 5 min.

[0093] (3) DNA sequence determination

[0094] DNA sequence identification: It was carried out at Shenzhen BGI Genomics Co., Ltd., and the gene fragments were tested for both positive and negative reactions. The measured sequence was compared with the NCBI genome sequence to obtain the mutation of the corresponding SNP site. The sequencing results are shown below:

[0095]

[0096] Note: The M marked in the sequence table is the mutation site, which is displayed with underline + bold (the mutated base in brackets is the allele mutation). The underline + bold at the beginning and end of the sequence is the position of the designed primer sequence.

[0097] Example 3 Analysis of the effect of molecular markers on the SNP site chr14:105043272C>T

[0098] The present invention provides a SNP molecular marker that can significantly improve the reproductive traits of Large White pigs (including litter size, healthy piglets, and litter weight at birth, etc.). Using the SNP molecular marker for marker-assisted selection can greatly accelerate the breeding process of Large White sows with reproductive-related traits. Through molecular marker-assisted selection, if the present invention selects all TT-type individuals that affect the reproductive traits of Large White sows into CC-type individuals, the litter size of Large White sows will increase by 1.6 piglets, the healthy piglets will increase by 2.05 piglets, and the litter weight at birth will increase by 2.1 kg.

[0099] The present invention detects the 171st base mutation site in the SEQ ID NO: 2 sequence and preliminarily performs an application of association analysis between its genotype and reproductive traits, thereby providing a new molecular marker for molecular assisted selection of pigs.

[0100] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A SNP molecular marker located on chromosome 14 of pigs and associated with pig reproductive traits, characterized in that The SNP site corresponds to the C>T mutation at position 105043272 on chromosome 14 of the international pig reference genome version 11.

1. The polymorphism of the base at this site affects the reproductive traits of pigs; among them, the reproductive performance of pigs with CC and TC genotypes is better than that of pigs with TT genotype. The reproductive traits include, but are not limited to, litter size, number of healthy pups, and litter weight at birth; The pigs are large white sows and their synthetic strains.

2. The SNP molecular marker located on porcine chromosome 14 and associated with porcine reproductive traits according to claim 1, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID No: 2, wherein M in the sequence is C or T.

3. A primer pair for detecting a SNP molecular marker on chromosome 14 associated with pig reproductive traits, characterized in that The primer pair comprises primers P001-F and P001-R, and the nucleotide sequences thereof are as follows: Primer P001-F: 5′-CTTGGGCCAGGTTTTTGAGC-3′; Primer P001-R: 5′-GGCACCTTTACAGACACCGA-3′.

4. A kit for detecting SNP molecular markers on chromosome 14 of pigs and related to pig reproductive traits, characterized in that The kit comprises the primer pair described in claim 3.

5. Use of the SNP molecular marker according to claim 1 or 2, the primer pair according to claim 3 or the kit according to claim 4 in identifying pig reproductive-related traits, screening pig breeds with high or excellent reproductive traits, or genetic breeding of pig reproductive traits.

6. A method for detecting pig reproductive traits, characterized in that The following steps are included: Detect the SNP molecular marker described in claim 1 on chromosome 14 of pigs, and judge the reproductive traits of pigs according to whether the single nucleotide at the SNP site of the SNP molecular marker is C or T; wherein the reproductive performance of pigs with CC and TC genotypes is better than that of pigs with TT genotypes; The pigs are large white sows and their synthetic strains.

7. A method for screening pig breeds with high or excellent reproductive traits, characterized in that The following steps are included: Detect the SNP molecular marker described in claim 1 on chromosome 14 of pigs; according to the SNP site of the SNP molecular marker, eliminate individuals with genotype TT and retain individuals with genotype CC and TC; wherein the reproductive performance of pigs with CC and TC genotypes is better than that of pigs with TT genotype; The pigs are large white sows and their synthetic strains.

8. The method according to claim 6 or 7, characterized in that: The detection method comprises the following steps: (1) Extracting genomic DNA from the pig to be tested; (2) using the primer pair described in claim 3 or the primer pair in the kit described in claim 4 as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, to perform PCR amplification to obtain a PCR amplification product; (3) sequencing the PCR amplification product to obtain sequencing results; (4) Determine the genotype of the SNP molecular marker based on the sequencing results.

9. A method for genetic improvement of pigs, characterized in that The following steps are included: Determine the SNP molecular markers described in claim 1 of the pigs in the pig core group, and make corresponding selections based on the molecular markers: in the sub-breeding of the breeding pigs, the pig individuals with CC or TC genotype at the nucleotide position 105043272 on chromosome 14 of the international pig reference genome version 11.1 are eliminated, and the pig individuals with TT genotype at the position are eliminated, so as to increase the frequency of the allele C at the position from generation to generation, thereby improving the reproductive performance of the offspring pigs; The pigs are large white sows and their synthetic strains.

Images