Nanoparticles loaded with NLRP3-sgRNA nucleic acid sequence targeting macrophages and application of nanoparticles in prevention and treatment of uveitis

Abstract

The invention provides nano-particles loaded with NLRP3-sgRNA (non-linear receptor protein 3-single guide ribonucleic acid) nucleic acid sequence targeting macrophages and application of the nano-particles to prevention and treatment of uveitis. The preparation method comprises the following steps: loading an NLRP3-sgRNA plasmid with a specific promoter, preparing a nanoparticle PLGA-sgNLRP3, and then coating the surface of the nanoparticle PLGA-sgNLRP3 with a macrophage membrane, so as to prepare the nanoparticle MM / PLGA-sgNLRP3 coated with the macrophage membrane. The PLGA-sgNLRP3 and MM / PLGA-sgNLRP3 can be recruited to a retinopathy site, so that accumulation of drugs in the lesion site is increased, the gene intervention effect is enhanced, the efficient endotoxin-induced uveitis lesion site targeting function is achieved, retinal injury and inflammatory response can be relieved, retinal barrier injury is prevented, good biological safety is achieved, and the application has a good application prospect. Side effects are small and curative effects are high.

Description

Technical Field

[0001] The present invention belongs to the technical field of new drug development, relates to the treatment of uveitis, and specifically relates to a nanoparticle loaded with an NLRP3-sgRNA nucleic acid sequence targeting macrophages and an application thereof in preventing and treating uveitis. Background Art

[0002] Uveitis is a series of inflammatory eye diseases involving the iris, ciliary body, vitreous body, choroid, retina and retinal blood vessels, manifested by clinical symptoms such as ciliary congestion or mixed congestion, posterior iris and pupillary synechiae, multiple exudative foci in the fundus, retinal edema and fundus hemorrhage. Uveitis is very easy to recur, especially when the autoimmune function is low. Once it is not treated or misdiagnosed, it can cause a variety of complications with very serious consequences. It is one of the main causes of visual impairment and blindness. Common complications of uveitis include cataracts, band corneal degeneration, glaucoma, fold-like changes on the surface of the macula, retinal detachment, corneal edema, macular and optic disc edema, etc.

[0003] Traditional treatments for uveitis are usually immunosuppressive therapy, including immunosuppressants such as corticosteroids, antimetabolites, and alkylating agents, which can cause significant toxic side effects if used for a long time. Therefore, seeking safe and effective clinical drugs for the prevention / treatment of uveitis is an important problem that needs to be solved urgently in the medical community. Summary of the invention

[0004] In order to solve the problems in the prior art, the present invention provides a nanoparticle loaded with NLRP3-sgRNA nucleic acid sequence targeting macrophages.

[0005] NLRP3 is NOD-like receptor thermal protein domain associated protein 3 (NLRP3), an important member of the NOD-like receptor family. Its inflammasome complex is composed of NLRP3, apoptosis-associated speck-like protein and caspase-1 precursor. NLRP3 is encoded by cold induced autoinflammatory syndrome 1 (CIAS1) gene and contains an N-terminal pyrin domain (PYD), a central nucleotide binding oligomerization domain (nucleosidetriphosphatase domain, NACTH domain) and a C-terminal leucine-rich repeat (LRR). NLRP3 is a sensor of the inflammasome and plays a vital role in systemic innate immunity and inflammation.

[0006] The nanoparticles loaded with NLRP3-sgRNA nucleic acid sequences targeting macrophages of the present invention use polylactic acid-glycolic acid copolymer PLGA as a nanocarrier, load NLRP3-sgRNA plasmids with specific promoters, prepare nanoparticles PLGA-sgNLRP3, and then coat macrophage membranes on the surface of PLGA-sgNLRP3 nanoparticles to prepare macrophage membrane-coated nanoparticles MM / PLGA-sgNLRP3. The present invention can not only reduce retinal damage and inflammatory response, and prevent retinal barrier damage, but also has good biosafety, small side effects, and high efficacy.

[0007] Unless otherwise specified, the parts described in the present invention are all parts by weight and the percentages described are all mass percentages.

[0008] The present invention adopts the following technical solution:

[0009] A nanoparticle loaded with an NLRP3-sgRNA nucleic acid sequence, characterized in that: polylactic acid-glycolic acid copolymer PLGA is used as a nanocarrier, and an NLRP3-sgRNA plasmid with a specific promoter is loaded to prepare the nanoparticle PLGA-sgNLRP3.

[0010] The macrophage membrane-coated NLRP3-sgRNA nucleic acid sequence loaded with a specific promoter targets macrophages (MM / PLGA-sgNLRP3), which is characterized in that the macrophage membrane is coated on the surface of the PLGA-sgNLRP3 nanoparticles to prepare the nanoparticles.

[0011] According to one embodiment of the present invention, the sequence of the specific promoter in the plasmid NLRP3-sgRNA is shown in SEQ ID NO.1:

[0012] CGCGTTCATTTCTTACCTCCCCTTCCCTCTCCCACCTGCTACTGGGTGCATC

[0013] TCTGCTCCCCCCTTCCCCAGCAGATGGTTACCTTTGGGCTGTTGCTTTCTTG

[0014] TCACCATCTGAGTTCTCAGACCGCTGGAAAGCCATGTTCTCGGCTCTGTGAA

[0015] TGACAATGCTGACTGGAGTGCTGCCCCTGTAAAGGGCTGGGTGTGGAT

[0016] GGTCACAAGCCCCTCACAGCCTCAGCCAAGAGGAAGTAGTACAGGGGTC

[0017] AGCCCAGAGGTCCAGGGGAAAGGAGTGGAAACCGATTTCCCCACCAAGG

[0018] GAGGGGCCTGTACCTCAGCTGTTCCCATAGCTACTTGCCACAACTGCCAA

[0019] GCAAGTTTCGCTGAGTTTGACACATGGATCCCTGTGGATCAACTGCCCTAG

[0020] GACTCCGTTTGCACCCATGTGACACTGTTGACTTTGCCCTGACGAAGCAGG

[0021] GCCAACAGTCCCCTAACTTAATTACAAAAACTAATGACTAAGAGAGAGGT

[0022] GGCTAGAGCTGAGGCCCCTGAGTCAGGCTGTGGGTGGGATCATCTCCAGT

[0023] ACAGGAAGTGAGACTTTCATTTCCTCCTTTCCAAGAGAGGGCTGAGGGAG

[0024] CAGGGTTGAGCAACTGGTGCAGACAGCCTAGCTGGACTTTGGGTGAGGCGGTTCAGCCTCGA.

[0025] According to one embodiment of the present invention, the NLRP3 nucleic acid sequence is a human or mouse NLRP3 nucleic acid sequence. Further, the mouse NLRP3 nucleic acid sequence is shown in SEQ ID NO.2: GACGAGTGTCCGTTGCAAGCTGG.

[0026] According to one embodiment of the present invention, the preparation method of the nanoparticle NLRP3-sgRNA is:

[0027] PLGA was dissolved in dichloromethane, and NLRP3-sgRNA plasmid and PEI were added, wherein the NLRP3-sgRNA plasmid and PEI were calculated at a transfection ratio of 1:2, and mixed evenly; the mixture was then added to a polyvinyl alcohol (PVA) aqueous solution, ultrasonicated in an ice bath for 3-8 minutes, stirred with a magnetic stirrer to evaporate the organic solvent for 3-5 hours, and then dialyzed in ultrapure water for 10-15 hours, and filtered through a 200 nm polycarbonate membrane to obtain PLGA-sgNLRP3 nanoparticles.

[0028] According to one embodiment of the present invention, the preparation method of the nanoparticle MM / PLGA-sgNLRP3 is as follows: PLGA-sgNLRP3 nanoparticles and extracted macrophage membranes are fully mixed in a ratio of 1:8-12, and water bath sonicated for 8-15 minutes; a micro membrane extruder is used to first pass through a 400nm polycarbonate membrane and then through a 200nm polycarbonate membrane to obtain MM / PLGA-sgNLRP3 nanoparticles.

[0029] According to one embodiment of the present invention, the method for extracting macrophage membrane is as follows: macrophages are crushed by gradient of hypotonic solution to obtain cell lysate; the hypotonic solution gradient is specifically a cell suspension added with 0.25X buffer solution containing protease inhibitors, lysed on ice for 1 to 3 hours, and then probe ultrasonicated for 3 to 7 minutes to fully lyse the cells, the cell lysate is collected, centrifuged at 900 to 1100 rpm and 3 to 5°C for 3 to 6 minutes, and the supernatant is carefully collected; then centrifuged at 13000 to 16000 rpm and 3 to 5°C for 9 to 13 minutes to remove cell debris and organelles in turn, and the precipitate is collected to obtain macrophage membrane; the obtained macrophage membrane is resuspended with ultrapure water, and then passed through a 400nm polycarbonate membrane using a micro membrane extruder, and extruded repeatedly 10-20 times to obtain a macrophage membrane.

[0030] According to one embodiment of the present invention, PLGA-sgNLRP3 nanoparticles are used in the preparation of a drug for preventing or treating uveitis.

[0031] According to one embodiment of the present invention, use of MM / PLGA-sgNLRP3 nanoparticles in the preparation of a drug for preventing or treating uveitis.

[0032] According to one embodiment of the present invention, the uveitis is autoimmune uveitis.

[0033] Beneficial effects:

[0034] The present invention provides a biomembrane nanoparticle loaded with NLRP3-sgRNA nucleic acid sequence targeting macrophages, using polylactic acid-glycolic acid copolymer PLGA as a nanocarrier, loading NLRP3-sgRNA plasmid with a specific promoter, preparing nanoparticles PLGA-sgNLRP3, and then coating the macrophage membrane on the surface of the PLGA-sgNLRP3 nanoparticles to prepare macrophage membrane-coated nanoparticles MM / PLGA-sgNLRP3. The present invention can recruit PLGA-sgNLRP3 and MM / PLGA-sgNLRP3 to the retinal lesion site, thereby increasing the accumulation of PLGA-sgNLRP37 and MM / PLGA-sgNLRP3 in the lesion site, enhancing the gene intervention effect, and realizing the high-efficiency endotoxin-induced uveitis lesion site targeting function, which can not only reduce retinal damage and inflammatory response, and prevent retinal barrier damage, but also has good biosafety, small side effects, and high efficacy. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is the expression map of plasmid YKO-LV019-CD68-mNLRP3-sgRNA.

[0036] Figure 2 are transmission electron microscopy images of PLGA-sgNLRP3 and MM / PLGA-sgNLRP3 nanoparticles.

[0037] Figure 3 It is the Zeta potential result diagram of PLGA-sgNLRP3 and MM / PLGA-sgNLRP3 nanoparticles.

[0038] Figure 4 is the particle size diagram of PLGA-sgNLRP3 and MM / PLGA-sgNLRP3 nanoparticles.

[0039] Figure 5 These are the results of PLGA-sgNLRP3, MM / PLGA-sgNLRP3, macrophage membrane, and macrophage Coomassie Brilliant Blue.

[0040] Figure 6 This is a graph showing the stability investigation results of PLGA-sgNLRP3 and MM / PLGA-sgNLRP3 nanoparticles.

[0041] Figure 7 These are the results of investigating the particle size and PDI of PLGA-sgNLRP3 nanoparticles and the particle size and PDI of MM / PLGA-sgNLRP3 nanoparticles at 7 days.

[0042] Figure 8This is a graph showing the experimental results of cellular uptake of PLGA-sgNLRP3 and MM / PLGA-sgNLRP3 nanoparticles. Fig. 9 This is a diagram showing the results of evaluating the ocular targeting ability of cy5-labeled PLGA-sgNLRP3 and MM / PLGA-sgNLRP3 nanoparticles.

[0043] Fig.10 This is a graph showing the results of MM / PLGA-sgNLRP3 nanoparticles alleviating anterior segment inflammation in EIU mice.

[0044] Fig.11 It is a statistical chart of the clinical score of the anterior segment.

[0045] Fig.12 This is a diagram showing the results of MM / PLGA-sgNLRP3 nanoparticles alleviating retinal inflammation in EIU mice.

[0046] Fig.13 It is a statistical chart of fundus clinical scoring.

[0047] Fig.14 This is a diagram showing the results of MM / PLGA-sgNLRP3 nanoparticles alleviating retinal vascular leakage in EIU mice. DETAILED DESCRIPTION

[0048] In order to further illustrate the present invention and its advantages, the technical solution of the present invention is further illustrated by specific implementation methods below. It should be understood that these embodiments are only to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0049] The raw materials and reagents used in the present invention are all commercially available products, some of which are as follows:

[0050]

[0051]

[0052] Example 1: Construction of plasmid mNLRP3-sgRNA.

[0053] The sequence of the specific promoter in the plasmid NLRP3-sgRNA is shown in SEQ ID NO.1:.

[0054] The mouse NLRP3 nucleic acid sequence in the plasmid mNLRP3-sgRNA is shown in SEQ ID NO.2: GACGAGTGTCCGTTGCAAGCTGG.

[0055] like Figure 1 The mNLRP3-sgRNA plasmid was constructed as shown.

[0056] Example 2: Preparation of PLGA-sgNLRP3 and MM / PLGA-sgNLRP3 nanoparticles.

[0057] (1) Extraction of macrophages: Macrophages were disrupted by gradient of hypotonic solution to obtain cell lysate, which was obtained by differential centrifugation and ultrasonic extraction; the hypotonic solution gradient was specifically a cell suspension with 0.25X buffer solution containing protease inhibitors added, and the cells were lysed on ice for 2 hours and then ultrasonicated for 5 minutes to fully lyse the cells, and the cell lysate was collected, centrifuged at 1000 rpm and 4°C for 5 minutes, and the supernatant was carefully collected; the cell debris and organelles were removed by centrifugation at 14000 rpm and 4°C for 10 minutes, and the precipitate was collected to obtain macrophage membrane; the obtained macrophage membrane was resuspended in ultrapure water, and then passed through a 400 nm polycarbonate membrane using a micro membrane extruder, and extruded repeatedly 10-20 times to obtain macrophage membrane vesicles for subsequent coating of PLGA nanoparticles.

[0058] (2) Preparation of PLGA-sgNLRP3 nanoparticles: Weigh 10 mg of PLGA, add 1 ml of dichloromethane, sonicate for 60 seconds to fully dissolve PLGA, then add 1 mg of NLRP3-sgRNA plasmid and 2 ml of PEI (calculated according to the transfection ratio of plasmid: PEI = 1:2 mass ratio, the concentration of PEI is 1 mg / ml), and mix well. The above solvent was slowly added dropwise to 3 ml of 1% polyvinyl alcohol (PVA) aqueous solution, and sonicated on ice for 5 minutes with an interval of 5 seconds. The organic solvent was stirred with a magnetic stirrer for 4 hours, then dialyzed in ultrapure water for 12 hours, and passed through a 200 nm polycarbonate membrane to obtain PLGA-sgNLRP3 nanoparticles.

[0059] (3) The prepared PLGA-sgNLRP3 nanoparticles were fully mixed with the extracted macrophage membranes in a ratio of 1:10 and ultrasonicated in a water bath for 10 min. The nanoparticles were first passed through a 400 nm polycarbonate membrane and then through a 200 nm polycarbonate membrane using a micro membrane extruder to obtain MM / PLGA-sgNLRP3 nanoparticles.

[0060] (4) PLGA-sgNLRP3 nanoparticles and MM / PLGA-sgNLRP3 nanoparticles were diluted 10 times with PBS and their microscopic morphology was observed using a transmission electron microscope. Figure 2 Shown: MM / PLGA-sgNLRP3 nanoparticles have a clear "core-shell" structure.

[0061] (5) PLGA-sgNLRP3 nanoparticles and MM / PLGA-sgNLRP3 nanoparticles were diluted 20 times with PBS and their particle sizes were measured using a Malvern laser particle size analyzer; they were diluted 200 times with ddH2O and their zeta potential was measured using a Malvern laser particle size analyzer. Figure 3 , Figure 4As shown: the particle size of the nanoparticles is about 200 nm, and the particle size of MM / PLGA-sgNLRP3 nanoparticles is larger than that of PLGA-sgNLRP3 nanoparticles, and the potential is lower than that of PLGA-sgNLRP3 nanoparticles.

[0062] (6) After macrophages, macrophage membranes, MM / PLGA-sgNLRP3 nanoparticles, and PLGA-sgNLRP3 nanoparticles were extracted with protein lysate, the integrity of membrane proteins was characterized by SDS-PAGE gel electrophoresis and the classic Coomassie brilliant blue staining method. The results are as follows: Figure 5 shown.

[0063] Example 3: Stability detection of PLGA-sgNLRP3 and MM / PLGA-sgNLRP3 nanoparticles.

[0064] MM / PLGA-sgNLRP3 nanoparticles and PLGA-sgNLRP3 nanoparticles were photographed for 7 consecutive days and their particle size and zeta potential were measured. Figure 6 , Figure 7 As shown, MM / PLGA-sgNLRP3 nanoparticles and PLGA-sgNLRP3 nanoparticles are relatively stable, the particle size and PDI values ​​fluctuate within a small range, and there is no precipitation.

[0065] Example 4: Cellular uptake experiment of PLGA-sgNLRP3 and MM / PLGA-sgNLRP3 nanoparticles.

[0066] (1) Raw264.7 cells were plated and divided into three groups (Blank group, PLGA-sgNLRP3 group, and MM / PLGA-sgNLRP3 group), and intervention was performed after the cells adhered to the wall.

[0067] (2) After the cells adhered, 100 μL of PLGA-sgNLRP3 and MM / PLGA-sgNLRP3 nanoparticles were added at 3 h, 6 h, and 12 h.

[0068] (3) After the intervention time point, the cells were resuspended in PBS and collected. After filtering impurities with a cell strainer, the cells were tested on a flow cytometer. Figure 8 As shown: The uptake rate of MM / PLGA-sgNLRP3 nanoparticles in Raw264.7 cells is higher than that of PLGA-sgNLRP3, and the uptake rate of nanoparticles increases over time.

[0069] Example 5: Cy5-labeled PLGA-sgNLRP3 and MM / PLGA-sgNLRP3 nanoparticles were used to evaluate their ocular targeting ability.

[0070] (1) PLGA-sgNLRP3 and MM / PLGA-sgNLRP3 nanoparticles were labeled with Cy5.

[0071] (2) Wild-type mice (WT mice) were divided into two groups (cy5-PLGA-sgNLRP3 group: 2 μL of cy5-PLGA-sgNLRP3 was injected into the vitreous of the right eye of mice; cy5-MM / PLGA-sgNLRP3 group: 2 μL of cy5-MM / PLGA-sgNLRP3 was injected into the right eye of mice).

[0072] (3) The results are as follows Fig. 9 As shown: MM / PLGA-sgNLRP3 nanoparticles have a longer in vivo action time than PLGA-sgNLRP3.

[0073] Example 6: Establishment and treatment of endotoxin-induced uveitis (EIU).

[0074] The endotoxin-induced uveitis (EIU) model simulates the immune pathogenic mechanism associated with human uveitis. The EIU animal model has similar clinical manifestations and histopathological features to human uveitis, making it an ideal model for assessing the degree of inflammation in uveitis and guiding drug treatment strategies.

[0075] (1) Eight-week-old C57BL / 6J female mice (purchased from the Animal Experiment Center of Chongqing Medical University) were selected and anesthetized with sodium pentobarbital. Wild-type mice (WT mice) were divided into four groups (Blank group, MM / PLGA-sgNLRP3 group, PLGA-sgNLRP3 group, and EIU group).

[0076] (2) The PLGA-sgNLRP3 group and the MM / PLGA-sgNLRP3 group were injected intravitreally with 2 μL of PLGA-sgNLRP3 and MM / PLGA-sgNLRP3 nanoparticles.

[0077] (3) Weigh 1 mg of LPS (Sigma, USA) powder into a 15 mL centrifuge tube without enzyme, add 1 mL of PBS and shake to mix, to prepare a 1 mg / mL LPS solution. Three days later, the solution was intraperitoneally injected at a concentration of 10 mg / kg to establish the model.

[0078] (4) 24 hours after immunization, the conjunctiva of the mice was observed by anterior segment photography. Mice with conjunctival inflammation symptoms (conjunctival congestion) were marked as successful modeling mice, and mice without inflammation symptoms were eliminated.

[0079] Example 7: Clinical scoring of anterior segment inflammation in the EIU model

[0080] 24 hours after immunization, the degree of anterior segment inflammation was examined by slit lamp and clinical scoring was performed in a double-blind method. The clinical scoring of anterior segment inflammation was based on the severity of five signs: corneal opacity, conjunctival congestion or ciliary congestion, mixed congestion, anterior chamber inflammatory cells, and posterior synechiae, with a score of 0-5. Fig.10 , Fig.11 As shown, compared with the PLGA-sgNLRP3 group, the MM / PLGA-sgNLRP3 group could significantly improve inflammatory conditions such as anterior segment congestion in mice.

[0081] Example 8: Clinical Scoring of Retinal Inflammation in the EIU Model

[0082] 24 hours after immunization, the degree of retinal inflammation was observed by fundus photography and clinical scoring was performed in a double-blind method. The clinical scoring of fundus retinal inflammation was based on the severity of five signs, namely, macular soft exudates, linear vasculitis, macular edema, retinal hemorrhage, and retinal detachment, with a score of 0-5. Fig.12 , Fig.13 As shown, the MM / PLGA-sgNLRP3 group could significantly improve fundus inflammation in mice compared with the PLGA-sgNLRP3 group.

[0083] Example 9: Evans blue staining of retinal flat mounts

[0084] 20 hours after modeling, wipe the mouse tail vein with an alcohol cotton ball to fully dilate it. After fixing the mouse tail, inject 100 μl of 2% Evans Blue (Sigma, USA) into the tail vein. After successful injection, the mouse hands and feet can be observed to turn blue rapidly. Two hours later, the mice were anesthetized with sodium pentobarbital and killed. The eyeballs were removed and fixed in 4% paraformaldehyde for 3 hours. Under a microscope, a circular cut was made along the corneal margin 1-2 mm inward to remove the anterior segment tissues such as the cornea, iris, and vitreous body. The retina was cut radially in 4 quadrants, separated bluntly and spread on a clean glass slide, facing the vitreous surface directly upward, and the remaining vitreous fibers were picked out. After sealing with glycerol, the leakage of the mouse retina was observed under a fluorescence microscope. The results are shown as follows: Fig.14 As shown, compared with the PLGA-sgNLRP3 group, the MM / PLGA-sgNLRP3 group could significantly improve the retinal vascular leakage in mice.

Claims

1. A nanoparticle loaded with NLRP3-sgRNA nucleic acid sequence, characterized in that: Poly(lactic-co-glycolic acid) copolymer PLGA was used as a nanocarrier to load the NLRP3-sgRNA plasmid of the specific promoter to prepare nanoparticles PLGA-sgNLRP3; wherein the sequence of the specific promoter is shown in SEQ ID NO.1:.

2. The nanoparticle according to claim 1, characterized in that: The NLRP3 nucleic acid sequence is a human or mouse NLRP3 nucleic acid sequence.

3. The nanoparticle according to claim 2, characterized in that: The mouse NLRP3 nucleic acid sequence is shown in SEQ ID NO.2: GACGAGTGTCCGTTGCAAGCTGG.

4. The nanoparticle according to any one of claims 1 to 3, characterized in that: The preparation method of the nanoparticle NLRP3-sgRNA is as follows: dissolving PLGA with dichloromethane, adding NLRP3-sgRNA plasmid and PEI, wherein the NLRP3-sgRNA plasmid and PEI are calculated at a transfection ratio of 1:2, and mixing them evenly; The mixed solution was then added to a polyvinyl alcohol (PVA) aqueous solution, ultrasonicated in an ice bath for 3-8 minutes, stirred with a magnetic stirrer to volatilize the organic solvent for 3-5 hours, and then dialyzed in ultrapure water for 10-15 hours, and filtered through a 200 nm polycarbonate membrane to obtain PLGA-sgNLRP3 nanoparticles.

5. Macrophage membrane-coated NLRP3-sgRNA nucleic acid sequence loaded with a specific promoter targeting macrophages (MM / PLGA-sgNLRP3), characterized by: The macrophage membrane is coated on the surface of the PLGA-sgNLRP3 nanoparticles according to any one of claims 1 to 4 to prepare the nanoparticles.

6. The biofilm nanoparticle (MM / PLGA-sgNLRP3) according to claim 5, characterized in that: The preparation method of the nanoparticle MM / PLGA-sgNLRP3 is as follows: PLGA-sgNLRP3 nanoparticles and extracted macrophage membranes are fully mixed in a ratio of 1:8-12, and water bath ultrasonication is performed for 8-15 minutes; a micro membrane extruder is used to first pass through a 400nm polycarbonate membrane and then through a 200nm polycarbonate membrane to obtain MM / PLGA-sgNLRP3 nanoparticles.

7. The biofilm nanoparticle (MM / PLGA-sgNLRP3) according to claim 5 or 6, characterized in that: The method for extracting the macrophage membrane comprises: crushing the macrophages with a hypotonic solution gradient to obtain a cell lysate; the hypotonic solution gradient is specifically a cell suspension added with a 0.25X buffer solution containing a protease inhibitor, lysing on ice for 1 to 3 hours, ultrasonicating the cell for 3 to 7 minutes, collecting the cell lysate, centrifuging at 900 to 1100 rpm and 3 to 5° C. for 3 to 6 minutes, and carefully collecting the supernatant; centrifuging at 13000 to 16000 rpm and 3 to 5° C. for 9 to 13 minutes to sequentially remove cell debris and organelles, and collecting the precipitate to obtain the macrophage membrane; resuspending the obtained macrophage membrane with ultrapure water, and then passing the macrophage membrane through a 400 nm polycarbonate membrane using a micro membrane extruder, and repeatedly extruding 10 to 20 times to obtain the macrophage membrane.

8. Use of the PLGA-sgNLRP3 nanoparticles according to any one of claims 1 to 4 in the preparation of a drug for preventing or treating uveitis.

9. Use of the biofilm nanoparticles (MM / PLGA-sgNLRP3) according to any one of claims 5 to 7 in the preparation of a drug for preventing or treating uveitis.

10. The use according to claim 9, characterized in that: The uveitis is autoimmune uveitis.

Images