Application of phosphodiesterase 6D as a drug guidance biomarker for prostate cancer

By using phosphodiesterase 6D (PDE6D) as a guide marker for prostate cancer, its expression level is detected to predict the sensitivity of patients to metformin, and the combination of metformin and TMX-4100 is guided, the problems of limited efficacy and major toxic side effects in CRPC treatment are solved, and the effect of improving drug sensitivity and reducing toxic side effects is achieved.

CN119932197BActive Publication Date: 2025-06-13GUANGZHOU FIRST PEOPLES HOSPITAL (GUANGZHOU DIGESTIVE DISEASE CENT GUANGZHOU FIRST PEOPLES HOSPITAL GUANGZHOU MEDICAL UNIV THE SECOND AFFILIATED HOSPITAL OF SOUTH CHINA UNIV OF TECH)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510437087.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-09
Publication Date
2025-06-13
Estimated Expiration
2045-04-09

AI Technical Summary

Technical Problem

The prior art has limited efficacy in the treatment of castration-resistant prostate cancer (CRPC), and lacks effective and individualized treatments, especially in improving drug sensitivity and reducing toxic side effects.

Method used

Phosphodiesterase 6D (PDE6D) was used as a guide marker for prostate cancer medication. By detecting the mRNA and protein expression levels of PDE6D, patients' sensitivity to metformin is predicted, and the combination of metformin and TMX-4100 was guided.

Benefits of technology

It improves the sensitivity of CRPC to metformin, enhances the anti-tumor effect, reduces the toxic and side effects of the drug, provides an individualized treatment plan, and improves the safety and effectiveness of the treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119932197B_ABST
    Figure CN119932197B_ABST
Patent Text Reader

Abstract

This application relates to the technical fields of biomedicine and cancer treatment, and specifically discloses the use of phosphodiesterase 6D as a guiding biomarker for prostate cancer medication. Phosphodiesterase 6D (PDE6D) can guide the use of medications for the treatment of prostate cancer, predict the therapeutic sensitivity of prostate cancer to the drug metformin, and also serve as a guiding biomarker for the combined use of metformin and TMX-4100. Different from the traditional way of blindly administering metformin as an adjuvant treatment, it provides a scientific basis for whether prostate cancer patients are suitable for using metformin and whether they need to be combined with TMX-4100.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the technical fields of biomedicine and cancer treatment, and in particular to the application of phosphodiesterase 6D as a biomarker for guiding prostate cancer medication. Background Art

[0002] Prostate cancer (PCa) is an epithelial malignant tumor that occurs in the prostate and is the most common malignant tumor in the male urogenital system. Although significant progress has been made in the treatment strategies for prostate cancer in the past decade or so, such as radical prostatectomy (RP), radiotherapy (RT), and androgen deprivation therapy (ADT), the clinical efficacy is limited. Especially in advanced patients, it is likely to transform into castration-resistant prostate cancer (CRPC), resulting in a median survival time of no more than two years for patients.

[0003] For patients with castration-resistant prostate cancer (CRPC), although chemotherapy drugs such as docetaxel and immune checkpoint inhibitors have shown efficacy in some cancers, their efficacy in the treatment of CRPC is limited. Currently, there is still a lack of effective and individualized treatment means for CRPC in clinical practice, and there is an urgent need for new treatment strategies and biomarkers to guide drug application and optimize treatment plans.

[0004] Metabolic therapy is a current research hotspot, and many clinical trials have also shown that interfering with tumor cell metabolism therapy has positive effects on patients. Among them, metformin, as a current first-line oral hypoglycemic drug, is widely used in the research of cancer treatment due to its effective ability to inhibit cell energy metabolism and low cost. Research has shown that metformin can inhibit tumor cell proliferation through AMPK-dependent and independent mechanisms, especially by interfering with tumor cell growth through metabolic pathway reprogramming. However, the specific anti-cancer effect of metformin in prostate cancer remains controversial. This controversy may be caused by various factors such as drug concentration, bioavailability, and individual differences. In addition, high-dose metformin is likely to cause lactic acid accumulation and lactic acidosis, increasing the treatment risk and limiting the clinical safety dose. Therefore, how to improve the sensitivity of CRPC to metformin within the safe dose range has become the research focus to reduce the toxic and side effects while ensuring the efficacy.

[0005] Cancer cell metabolic reprogramming is a key mechanism in tumor progression. Compared with normal cells, CRPC cells show significant metabolic abnormalities, including changes in pathways such as glucose, purine, and lipid metabolism. Therefore, based on the tumor metabolic characteristics, inhibiting tumor growth by regulating key metabolic pathways has become one of the potential treatment strategies. Summary of the Invention

[0006] The purpose of the present application is to overcome the deficiencies of the above-mentioned prior art and provide an application of phosphodiesterase 6D (PDE6D) as a drug guidance marker for prostate cancer. The phosphodiesterase 6D (PDE6D) of the present application can be used to predict the sensitivity to metformin at a conventional concentration and guide the combined use of metformin and TMX-4100 in prostate cancer.

[0007] To achieve the above purpose, the technical solution adopted by the present application is as follows:

[0008] The present application provides an application of a detection reagent for phosphodiesterase 6D in the preparation of a product for guiding the treatment of prostate cancer with drugs, and the drugs for treating prostate cancer include metformin.

[0009] Alternatively, the drugs for treating prostate cancer include metformin and TMX-4100.

[0010] PDE6D (phosphodiesterase 6D) is a regulatory subunit that was first discovered in the retina and participates in the signal transduction of photoreceptors. Recent studies have shown that PDE6D is abnormally expressed in various tumor cells such as breast cancer and prostate cancer, and is closely related to the proliferation, apoptosis, and metabolic abnormalities of tumor cells. By binding to the ras protein, PDE6D assists its intracellular transport and activates multiple tumor-related signal pathways, thereby supporting the growth and invasion ability of tumors. In addition, PDE6D is expressed in tissues of the non-visual system (such as the lung and kidney) and participates in the activation of the epidermal growth factor (EGF) pathway, further indicating its potential role in various types of tumors. Therefore, as a key factor regulating tumor metabolism and signal transduction, PDE6D is becoming an important target for a new type of anti-cancer therapy, bringing new hope for the treatment of various malignant tumors such as prostate cancer.

[0011] As a preferred embodiment of the application described in the present application, the drugs for treating prostate cancer further include TMX-4100.

[0012] The inventors of the present application have found through a large number of studies and experiments that phosphodiesterase 6D (PDE6D) can guide the treatment of prostate cancer with drugs, phosphodiesterase 6D can predict the therapeutic sensitivity of prostate cancer to the drug metformin, and phosphodiesterase 6D can also be used as a guiding marker for the combined use of metformin and TMX-4100. Different from the traditional way of blindly giving metformin adjuvant therapy, it provides a scientific basis for whether prostate cancer patients are suitable for using metformin and whether they need to be combined with TMX-4100.

[0013] As a preferred embodiment of the application described in the present application, the detection reagent for phosphodiesterase 6D includes a reagent for detecting the mRNA of phosphodiesterase 6D or a reagent for detecting the phosphodiesterase 6D protein.

[0014] As a preferred embodiment of the application described in the present application, the reagent for detecting the mRNA of phosphodiesterase 6D includes a detection primer for phosphodiesterase 6D, and the detection primer for phosphodiesterase 6D includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 2.

[0015] As a preferred embodiment of the application described in the present application, the reagent for detecting the phosphodiesterase 6D protein includes a primary antibody and a secondary antibody. The primary antibody is a rabbit-derived polyclonal antibody against phosphodiesterase 6D, and the secondary antibody is a goat anti-rabbit secondary antibody.

[0016] The present application detects the expression levels of the mRNA and protein of PDE6D to analyze whether it shows a high-expression state, thereby providing a basis for the medication guidance of prostate cancer.

[0017] As a preferred embodiment of the application described in the present application, the prostate cancer includes locally advanced prostate cancer or castration-resistant prostate cancer.

[0018] High expression of PDE6D in prostate cancer tissues indicates that the medication for treating prostate cancer is the combination of TMX-4100 and metformin.

[0019] The present application also provides the application of phosphodiesterase 6D in the preparation of a product for predicting the sensitivity of prostate cancer to metformin.

[0020] The present application discovers for the first time that metformin at a conventional concentration (conventional dose) can inhibit the progression of prostate cancer by regulating the PDE6D / cGMP / PKG signaling pathway, and an increase in the expression of phosphodiesterase 6D shows a decrease in the sensitivity of prostate cancer cells to metformin.

[0021] As a preferred embodiment of the application described in the present application, the human equivalent dose of metformin during application is 500 mg orally per day.

[0022] As a preferred embodiment of the application described in the present application, the product includes a kit.

[0023] The present application also provides the application of TMX-4100 and metformin in combination for the preparation of a drug for treating castration-resistant prostate cancer.

[0024] Experiments have shown that high expression of PDE6D reduces the sensitivity of castration-resistant prostate cancer to metformin. To address the low sensitivity caused by high expression of PDE6D, the use of the targeted PDE6D inhibitor TMX-4100 can significantly increase the sensitivity of prostate cancer tumor cells with high PDE6D expression to metformin. Therefore, this application uses PDE6D as a guiding biomarker for the combined use of TMX-4100 and metformin, which can provide a basis for whether prostate cancer patients need to use metformin combined with TMX-4100 for adjuvant endocrine therapy.

[0025] Moreover, the combined use of metformin and TMX-4100 helps to enhance the anti-tumor effect of metformin, thereby improving the drug use efficiency and significantly reducing the toxic side effects. This application has important clinical application value and broad promotion prospects in individualized cancer treatment.

[0026] This application also provides a detection kit for phosphodiesterase 6D, which is a reagent for detecting the mRNA expression level of phosphodiesterase 6D or a reagent for detecting the protein expression level of phosphodiesterase 6D;

[0027] The reagent for detecting the mRNA expression level of phosphodiesterase 6D includes detection primers for phosphodiesterase 6D, and the detection primers for phosphodiesterase 6D include an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 2;

[0028] The reagent for detecting the protein expression level of phosphodiesterase 6D includes a primary antibody and a secondary antibody. The primary antibody is a rabbit-derived polyclonal antibody against phosphodiesterase 6D, and the secondary antibody is a goat anti-rabbit secondary antibody.

[0029] The detection kit for phosphodiesterase 6D provided by this application can accurately detect the mRNA and protein expression levels and positive expression degrees of PDE6D in the tissues of prostate cancer patients in vitro.

[0030] The experimental results show that there is a negative correlation between the expression level of PDE6D and the sensitivity to metformin. By using this kit to detect the PDE6D protein, patients with stronger staining intensity usually have lower sensitivity to metformin. Therefore, it provides an important basis for whether prostate cancer patients need to be treated with the combination of TMX-4100 and metformin.

[0031] By detecting the positive expression levels of PDE6D mRNA and protein in prostate cancer tissues, this application can preliminarily evaluate whether prostate cancer patients need to use metformin combined with TMX-4100 as the basis for adjuvant endocrine therapy, providing a new therapeutic target for endocrine therapy other than anti-androgen therapy. This detection kit can be used for the detection of prostate cancer tissue samples obtained clinically, and the tissue samples can be obtained through diagnostic prostate puncture examination or surgery. This kit can be detected through in vitro experiments, with a low risk to patients and no toxic side effects.

[0032] In some specific embodiments, the primary antibody is a rabbit-derived polyclonal antibody against phosphodiesterase 6D, which has high specificity, and the experimental steps are simple and fast, enabling efficient detection. Through this kit, the positive expression intensity of PDE6D can be scored, thus providing a preliminary basis for predicting the efficacy of metformin combined with TMX-4100 in the treatment of castration-resistant prostate cancer patients.

[0033] The detection kit for phosphodiesterase 6D (PDE6D) provided by this application can accurately detect the expression of PDE6D mRNA and protein in prostate cancer tissues and their positive expression levels. Compared with the traditional method of blindly administering metformin as adjuvant therapy, detecting the expression level of PDE6D can provide an effective basis for whether to use metformin and TMX-4100 in combination, thereby improving the drug use efficiency. Therefore, the detection kit of this application not only helps to improve the effect of metformin treatment but also can expand the application scope of TMX-4100 in cancer treatment.

[0034] Compared with the prior art, this application has the following beneficial effects:

[0035] This application provides the application of phosphodiesterase 6D as a drug guidance biomarker for prostate cancer. Phosphodiesterase 6D (PDE6D) can guide the use of drugs in the treatment of prostate cancer. Phosphodiesterase 6D can predict the therapeutic sensitivity of prostate cancer to the drug metformin. Phosphodiesterase 6D can also be used as a guidance biomarker for the combined use of metformin and TMX-4100. Different from the traditional way of blindly administering metformin as adjuvant therapy, it can provide a scientific basis for whether castration-resistant prostate cancer patients need to use metformin combined with TMX-4100 as adjuvant therapy. This method helps to improve the drug use efficiency, and by selectively inhibiting prostate cancer cells with high PDE6D expression, it can enhance their sensitivity to metformin.

[0036] In addition, TMX-4100 and metformin are combined for the treatment of prostate cancer, especially progressive prostate cancer (such as locally advanced prostate cancer or castration-resistant prostate cancer). Combining TMX-4100 can reduce the side effects of metformin, especially the toxic and side effects on the gastrointestinal tract. This combined treatment can, to a certain extent, supplement the negative effects brought about by high expression of PDE6D and improve the treatment effect. In terms of economic benefits, the combined treatment of TMX-4100 and metformin has been proven to effectively inhibit tumor growth. Description of the Drawings

[0037] Figure 1 It is a result diagram of subcutaneous xenograft tumors of nude mice with conventional concentration of metformin constructed using human castration-resistant prostate cancer (CRPC) PC-3 cells;

[0038] Figure 2 It is a result diagram of orthogonal partial least squares discriminant analysis (OPLS-DA) after non-targeted metabolome sequencing using subcutaneous xenograft tumors of nude mice;

[0039] Figure 3 It is a bar chart of the enrichment analysis results of differential metabolite pathways of non-targeted metabolome sequencing;

[0040] Figure 4 It is a heat map of the content of differential metabolites in the enriched pathways of non-targeted metabolome sequencing;

[0041] Figure 5 It is a result diagram of differential gene analysis and qPCR verification experiment after transcriptomics sequencing using subcutaneous xenograft tumors;

[0042] Figure 6 It is a result diagram of immunohistochemistry of PDE6D and downstream pathway protein markers in subcutaneous xenograft tumors of nude mice;

[0043] Figure 7 It is a result diagram of immunoblotting of pcDNA3.1 overexpressing PDE6D cells constructed using human castration-resistant prostate cancer PC-3 cells;

[0044] Figure 8 It is a result diagram showing that increasing PDE6D can reduce the sensitivity of cells to metformin as discovered by plate cloning and CCK-8 experiments;

[0045] Figure 9 It is a result diagram showing that regulating PDE6D can reduce the sensitivity of cells to metformin as discovered by apoptosis flow cytometry experiments. At the same time, after whole transcriptome sequencing of the constructed metformin-resistant cells, it is found that the expression in resistant cells (MetR) is significantly higher than that in wild-type cells (WT), and thus the relationship between the expression level of PDE6D and the sensitivity to metformin is discovered;

[0046] Figure 10 Immunoblotting results showing the downregulation of PDE6D expression using RNAi technology;

[0047] Figure 11 Results of colony formation assay showing that reducing PDE6D enhances the sensitivity of CRPC cells to metformin;

[0048] Figure 12 Results of CCK-8 assay showing that reducing PDE6D enhances the sensitivity of CRPC cells to metformin;

[0049] Figure 13 Results of apoptosis assay showing that reducing PDE6D enhances the sensitivity of CRPC cells to metformin;

[0050] Figure 14 Results of ELISA showing that reducing PDE6D increases the relative content of intracellular cGMP;

[0051] Figure 15 Results of immunoblotting showing that downregulating PDE6D significantly activates PKG and the downstream apoptosis pathway;

[0052] Figure 16 Results showing that the combination of the PDE6D small molecule inhibitor TMX-4100 and metformin significantly enhances the sensitivity of CRPC cells to metformin's ability to inhibit colony formation;

[0053] Figure 17 Results showing that the combination of the PDE6D small molecule inhibitor TMX-4100 and metformin significantly enhances the sensitivity of CRPC cells to metformin's ability to inhibit cell proliferation;

[0054] Figure 18 Results showing that the combination of the PDE6D small molecule inhibitor TMX-4100 and metformin significantly enhances the sensitivity of CRPC cells to metformin's ability to promote apoptosis;

[0055] Figure 19 Results of animal experiments showing that the combination of the PDE6D small molecule inhibitor TMX-4100 and metformin significantly enhances the sensitivity of CRPC cells to metformin;

[0056] Figure 20 For Figure 19 Results of H&E staining and body weight of major organs of nude mice in different treatment groups in animal experiments;

[0057] Figure 21Survival analysis chart of patients divided into high-expression PDE6D and low-expression PDE6D by median in the Cancer Genome Atlas (TCGA) database;

[0058] Figure 22 Chart showing the comparison results of PDE6D expression levels in patients with different clinical stages and Gleason scores in the Cancer Genome Atlas (TCGA) database;

[0059] Figure 23 Survival analysis chart of patients with high-expression PDE6D and low-expression PDE6D in 7 public databases;

[0060] Figure 24 Chart showing the comparison results of PDE6D expression levels in patients with different Gleason scores in 6 public databases. Detailed implementation manners

[0061] To better illustrate the purpose, technical solutions, and advantages of the present application, the present application will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0062] In the following embodiments, unless otherwise specified, the experimental methods used are all conventional methods, and the materials, reagents, etc. used, unless otherwise specified, can all be obtained from commercial channels, and the component raw materials used in each parallel experiment are all of the same kind.

[0063] Example 1

[0064] Using a subcutaneous xenograft tumor of castration-resistant prostate cancer PC-3 cells constructed with conventional concentration metformin, sequencing analysis of metabolome and transcriptome was carried out, and the result chart is as Figures 1-6 shown.

[0065] Specific experimental steps:

[0066] To explore the anti-tumor effect of the conventional hypoglycemic metformin dose (500 mg / d) in the human body on castration-resistant prostate cancer (CRPC) and its effect on CRPC cells, the present application uses the wild-type cells of PC-3 (PC-3-WT) to construct a subcutaneous xenograft tumor model in nude mice.

[0067] Approximately 2 × 10 6 PC-3 cells were subcutaneously injected. The nude mice were randomly divided into a control group and a metformin treatment group (6 mice in each group). When the tumor volume reached 100 mm 3At that time, the mice in the metformin treatment group began to be treated with 102 mg / kg metformin in the drinking water (this concentration was calculated by the mouse-human equivalent dose conversion formula). The tumor volumes of the control group and the metformin-treated group were measured every two days starting from the 5th day. The results showed that the subcutaneous tumor volume of the cells in the metformin-treated group was significantly smaller than that of the control group after the 19th day of treatment, and the difference between the two was statistically significant ( Figure 1 ).

[0068] After 21 days of treatment, the nude mice were euthanized and the tumors were removed to measure the tumor weights of the two groups. The results showed that the subcutaneous tumor weight of the cells in the metformin-treated group was significantly smaller than that of the control group, and the difference between the two was statistically significant.

[0069] Subsequently, the present application performed untargeted metabolomics sequencing analysis on 5 tumor samples in each group. The sequencing analysis steps are as follows:

[0070] Metabolites were extracted from 10 tumor samples. 50 mg was taken from each tumor sample, washed 3 times with cold phosphate buffer (PBS), and then 1000 μL of extraction solvent (acetonitrile:methanol:water = 2:2:1, containing 1 μg / mL internal standard substance) was added, and ground with steel beads at a frequency of 40 Hz for 4 minutes, followed by sonication in an ice-water bath for 5 minutes. This grinding and sonication process was repeated 3 times, then incubated at -20°C for 1 hour, and then centrifuged at 4°C and 12,000 rpm for 15 minutes. The obtained supernatant was stored at -80°C for LC-MS analysis.

[0071] All samples were analyzed by uploading through a UHPLC system (1290, Agilent Technologies), using a UPLCHSST3 column (2.1 mm × 100 mm, 1.8 μm). The injected sample volume was 2 μL, and the flow rate was 0.5 mL / min. Mobile phase A was 0.1% formic acid in water (positive ion mode) or 5 mmol / L ammonium acetate in water (negative ion mode). Mobile phase B was acetonitrile. The gradient elution conditions were: 0 min, 1% B; 1 min, 1% B; 8 min, 99% B; 10 min, 99% B; 10.1 min, 1% B; 12 min, 1% B.

[0072] The first mass spectrometry (MS1) and the second mass spectrometry (MS2) data acquisitions were performed using a Q Exactive (Orbitrap MS, Thermo). The ESI source conditions were set as follows: sheath gas flow rate 45 Arb, auxiliary gas flow rate 15 Arb, capillary temperature 400 °C, full scan resolution 70000, MS / MS resolution 17500, collision energy 20 / 40 / 60 eV (NCE mode), spray voltage 4.0 kV for positive ions or -3.6 kV for negative ions.

[0073] The raw data were converted to the mzXML format using ProteoWizard software. Then, preprocessing was performed using the MAPS software, such as peak identification, peak extraction, and retention time correction. The metabolite annotation was carried out using the built-in MS2 database (BiotreeDB).

[0074] Orthogonal partial least squares discriminant analysis (OPLS-DA) was adopted in this application to find the differential metabolites in the sequencing results. The score plots of OPLS-DA in the positive ion mode and the negative ion mode showed a distinct separation between the two groups. Under both ion modes, significant changes occurred in the metabolite compositions of the xenograft tumors between the metformin treatment group and the control group (as Figure 2 shown).

[0075] In the positive ion mode, the metabolites are shown in Table 1:

[0076] Table 1

[0077]

[0078] In the negative ion mode, the metabolites are shown in Table 2:

[0079] Table 2

[0080]

[0081] Enrichment analysis was performed on the significantly different metabolites in the control group and the metformin-treated group, and the analysis process is as follows:

[0082] A two-tailed, equal-variance t-test was used to calculate the statistical significance and fold change of metabolites. Metabolites with P < 0.05 and VIP ≥ 1 were considered to be significantly different between groups. The VIP score was used to evaluate the relative importance of each metabolite in the OPLS-DA model. The enriched pathways of differential metabolites were analyzed through the enrichment analysis module of MetaboAnalyst 6.0, based on the KEGG database. Pathways with P < 0.05 were visualized using the "ggplot2" package in R. Differential metabolites were displayed through a heatmap.

[0083] The results showed that the differential metabolites in the cation mode and anion mode were mainly enriched in the purine metabolism pathway (as Figure 3 shown), and the heatmap of differential metabolites showed that the content of metformin increased in the treatment group, proving the reliability of model construction.

[0084] In addition, some important metabolites such as guanosine and adenosine were upregulated in the treatment group, while adenylic acid was downregulated in the treatment group (as Figure 4 shown). To explore the epigenetic changes underlying the metabolic differences, this application used 3 tumors in each group for transcriptome sequencing, and differential expression analysis was performed on the transcriptome sequencing results of the control group and metformin-treated group using the R language software package.

[0085] The results showed that compared with the control group, PDE6D was one of the genes with the most significant decrease in the metformin-treated group and the difference was statistically significant (as Figure 5 shown). Subsequently, this application used real-time fluorescence quantitative PCR (qPCR) experiments to verify the sequencing results and found that the expression level of the PDE6D gene decreased in the treatment group (as Figure 5 shown). The primer sequences used for qPCR are as follows:

[0086] PDE6D:

[0087] Forward primer(5'-3'): ATGTCAGCCAAGGACGAGC (SEQ ID NO: 1);

[0088] Reverse primer(5'-3'): CTTGGGAACACGGGCTTCAT (SEQ ID NO: 2).

[0089] ACTB:

[0090] Forward primer(5'-3'): GCTCACCATGGATGATGATATCGC (SEQ ID NO: 3);

[0091] Reverse primer(5'-3'): CCACATAGGAATCCTTCTGACCCAT (SEQ ID NO: 4);

[0092] PDE6D (phosphodiesterase 6D subunit) is one of the regulatory subunits of the cyclic guanosine monophosphate (cGMP) hydrolase PDE6 (phosphodiesterase 6). Abnormally low expression of PDE6D leads to the disintegration of PDE6 and subsequent accumulation of cGMP. Subsequently, immunohistochemical staining (IHC) was performed on the tumor tissues of two groups in this application. The results showed that the expression of PDE6D decreased in the treatment group, and the accumulation of cGMP in cells would activate the downstream cGMP / PRKG1 pathway, activating apoptosis. The IHC experiment showed that the up-regulation of PRKG1 expression was consistent with the scientific hypothesis of this application, and the apoptosis pathway was activated downstream of PRKG1. Bax (Bcl-2 associated X protein, an anti-apoptotic molecule) was down-regulated, and BCL2 (B-cell lymphoma-2, an apoptosis-promoting molecule) was up-regulated, proving the activation of the apoptosis pathway (as Figure 6 shown).

[0093] Results: It was found that metformin at conventional concentration inhibited the progression of prostate cancer by inhibiting the PDE6D / cGMP / PKG pathway, and a new mechanism of metformin treatment at conventional concentration was discovered.

[0094] Example 2

[0095] Using pcDNA3.1 to construct a PC-3 overexpression cell line, it was found by plate cloning, CCK-8, and apoptosis flow cytometry experiments that regulating PDE6D could reduce the sensitivity of cells to metformin. At the same time, whole transcriptome sequencing was performed on the constructed metformin-resistant cells.

[0096] Specific experimental steps: Cells were transfected with pcDNA3.1-PDE6D or pcDNA (from Beijing Tsingke Biotechnology Co., Ltd.) and TSnanofect V2 transfection reagent (TSV405, Tsingke Biotechnology Co., Ltd.) to construct a PC-3 cell line with high expression of PDE6D.

[0097] The protein expression level of PDE6D in PC-3 cell line was detected by Western blot. The operation method was as follows: First, extract proteins, prepare lysis buffer according to the ratio of RIPA: 100x PMSF: Loading buffer = 100: 1.25: 25, fully lyse the cells, heat them in a water bath at 100 °C for 20 minutes, separate the target protein by protein electrophoresis, prepare a transfer cassette, transfer buffer, sponge pads and filter papers. After electrophoresis, set the transfer current to 280 - 320 mA and the transfer time to 65 - 85 minutes. After protein transfer, wash three times, block with skim milk for 120 minutes, incubate overnight at 4 °C with rabbit-derived polyclonal antibody against PDE6D (28573-1-AP, proteintech). After incubation with the primary antibody, wash three times, incubate on a shaker at room temperature with goat anti-rabbit secondary antibody at 500 μg / ml (ab205718, abcam), and wash. Finally, prepare a chemiluminescent substrate solution for chemiluminescence. The results proved that the construction of PC-3 cells with high expression of PDE6D in prostate cancer was successful (as Figure 7 shown).

[0098] This application conducted colony formation assays on the empty vector group, the PDE6D overexpression group under metformin treatment, and the metformin treatment group.

[0099] 1000 cells were seeded into each well of a 12-well plate. The results showed that the number of cell clones in the empty vector group was the largest, followed by the PDE6D overexpression group under metformin treatment, and the number of cell clones in the metformin treatment group was the smallest (as Figure 8 shown).

[0100] This application conducted CCK-8 proliferation assays on the empty vector group, the PDE6D overexpression group under metformin treatment, and the metformin treatment group. Digest cells in the logarithmic growth phase, take a 96-well plate, and set the number of cells added to each well according to the cell type: 3000 cells / well; add 100 μL of complete serum medium to each well to dilute the cells to the required concentration. Generally, no cells are seeded in the cell wells in the outermost circle because of the large evaporation volume, and 200 μL of dPBS is used instead. After the cells adhered, add metformin for stimulation, and at the same time, supplement the medium volume to 200 μL. After the stimulation time ended, prepare the CCK 8 working solution: CCK 8: complete serum RPMI1640 = 1:9. Add the working solution, and after the reaction time ended, measure the OD value at 450 nm with an enzyme-linked immunosorbent assay (ELISA) reader. The results showed that the OD value of the metformin treatment group was the lowest, followed by the PDE6D overexpression group under metformin treatment, and the OD value of the empty vector group was the highest (as Figure 8 shown).

[0101] This application conducted apoptosis experiments on the empty vector group, the PDE6D overexpression group under metformin treatment, and the metformin treatment group. After collecting cells in the logarithmic growth phase, the cells were treated using an apoptosis kit (Linkage Biotechnology, AP105), and the samples were analyzed on a BD FACS flow cytometer, and statistical graphs were plotted. The results showed that the apoptosis rate was the highest in the metformin treatment group, followed by the PDE6D overexpression group under metformin treatment, and the lowest in the empty vector group (as Figure 9 shown). The transcriptome results of metformin-resistant cells constructed in previous research of this application showed that the expression level of PDE6D was upregulated in two castration-resistant prostate cancer metformin-resistant cells compared with the wild type (as Figure 9 shown).

[0102] As Figure 9 shown, it was found that the expression in drug-resistant cells (MetR) was significantly higher than that in wild-type cells (WT) (lower right), and then the relationship between the expression level of PDE6D and metformin sensitivity was discovered.

[0103] The results of the colony formation experiment, CCK-8 experiment, and apoptosis experiment together showed that overexpression of PDE6D could reverse the inhibitory effect of metformin on the proliferation of PC-3 cells. The research results of this application showed that PDE6D not only counteracted the effect of metformin on cell proliferation, but also activated the apoptosis pathway, thereby affecting the sensitivity of PC-3 cells to metformin treatment.

[0104] Example 3

[0105] Using RNAi technology to downregulate the expression level of PDE6D, it was found that the sensitivity of CRPC cells to metformin treatment increased. At the same time, the PKG and downstream apoptosis pathways were significantly activated, promoting cell apoptosis.

[0106] Specific experimental steps: This application constructed PDE6D low-expression cell lines of castration-resistant prostate cancer 22RV1 and PC-3 by inhibiting the expression of PDE6D through RNA interference. The RNA interference sequences are as described in Table 3 below:

[0107] Table 3

[0108]

[0109] Subsequently, the protein expression level of PDE6D in the PC-3 cell line was detected by Western blot, and the operation was the same as in Example 2 (as Figure 10 shown).

[0110] The results of the colony formation experiment showed that downregulating PDE6D reduced the colony formation ability of both 22Rv1 and PC-3 cells. This reduction was more obvious after metformin treatment (as Figure 11As shown). The results of the CCK-8 proliferation assay showed that downregulation of PDE6D decreased the proliferation ability of 22Rv1 and PC-3 cells (as Figure 12 shown).

[0111] Furthermore, the results of the apoptosis assay showed that downregulation of PDE6D led to an increase in the apoptosis rate, and treatment with metformin further enhanced the apoptosis rate (as Figure 13 shown).

[0112] In this application, the relative intracellular cGMP content in different treatment groups of two cell lines was detected. The results showed that metformin treatment significantly increased the relative intracellular cGMP content, and downregulation of PDE6D also led to an increase in the relative intracellular cGMP content (as Figure 14 shown). The results of the Western blot assay showed that downregulation of PDE6D led to the activation of PRKG1 in the cGMP / PKG pathway, initiating the downstream apoptotic pathway, in which the anti-apoptotic molecule Bax was downregulated and the apoptotic molecule BCL2 was upregulated, demonstrating the activation of the apoptotic pathway (as Figure 15 shown).

[0113] Example 4

[0114] The method of combining the PDE6D small molecule inhibitor TMX-4100 with metformin significantly improved the sensitivity of CRPC cells to metformin and was verified in animals.

[0115] Specific experimental procedures: In this application, the prostate cancer PC-3 and 22RV1 cell lines were used and treated with DMSO, metformin, and TMX-4100 respectively. The colony formation assay showed that single use of TMX-4100 had no significant inhibitory effect on the clonogenic ability of CRPC cells. However, when combined with metformin, it significantly enhanced the inhibitory effect on colony formation (as Figure 16 shown). Similar effects were also observed in the apoptosis assays of CCK-8 and flow cytometry (as Figures 17-18 shown). In vivo, the combined use of TMX-4100 and metformin also made CRPC cells more sensitive to the anti-tumor effect of metformin ( Figure 19 ).

[0116] Example 5

[0117] H&E staining of the major organs and body weight of mice in different treatment groups demonstrated the reliable biosafety of the combined treatment method.

[0118] Specific experimental procedures:

[0119] (I) Dewaxing:

[0120] 1. Take out the dried sections from the incubator and immediately immerse them in xylene for dewaxing for 5 - 10 minutes (this can be done in two bottles). The dewaxing time depends on whether the wax is completely dissolved. If the temperature is low, the time can be extended; if the temperature is high, the time can be appropriately shortened or dewaxing can be accelerated in the incubator.

[0121] 2. Transfer them to absolute alcohol (100%) (two bottles) for about 2 minutes.

[0122] 3. Transfer them to 90% alcohol (two bottles) for about 2 minutes.

[0123] 4. Transfer them to 80% alcohol (two bottles) for about 2 minutes.

[0124] 5. Transfer them to 70% alcohol for about 2 minutes.

[0125] 6. Transfer them to water to wash off the alcohol for about 2 - 3 minutes.

[0126] 7. Transfer them to distilled water for about 2 minutes.

[0127] (II) Staining:

[0128] 1. Transfer them to hematoxylin and stain for 8 - 15 minutes. Generally, it is better to stain slightly darker.

[0129] 2. Transfer them to water to wash off the hematoxylin and floating color for about 1 - 2 minutes.

[0130] 3. Transfer them to the differentiating solution (1% hydrochloric acid alcohol) and differentiate for several seconds to 30 seconds until the sections fade to light blue - red. The role of differentiation is to decolorize the cytoplasm and make the cell nucleus clearer and more vivid. When the differentiation is insufficient, the cytoplasm is blue - stained and the cell nucleus is over - stained. When the differentiation is excessive, the cell nucleus is too light to be recognized, and it can be returned to the hematoxylin staining solution to extend the staining time for a certain period.

[0131] 4. Transfer them to running water and wash for 30 - 60 minutes to make the tissue show bright blue or sky - blue (blueing).

[0132] 5. Transfer them to eosin solution and stain for 2 - 5 minutes. If the staining is slow, glacial acetic acid can be added to the eosin solution (add 1 - 2 drops of glacial acetic acid to 100 ml of eosin solution) to assist in staining.

[0133] 6. Transfer them to water to wash off the floating eosin solution and wipe off the excess dye on the glass slide with a gauze.

[0134] (III) Dehydration:

[0135] 1. After sucking off the water on the glass slide, transfer them to 80% alcohol (two bottles) for dehydration for about 1 - 2 minutes. If the color fades quickly in alcohol, they can be quickly transferred to 90% alcohol or returned to the eosin solution for restaining.

[0136] 2. Transfer to 90% alcohol (two bottles) for dehydration for about 2 - 4 minutes.

[0137] 3. Transfer to absolute alcohol (100% alcohol) (two bottles) for thorough dehydration for about 4 - 8 minutes.

[0138] (IV) Clearing:

[0139] 1. Transfer to xylene I for clearing for 3 - 5 minutes.

[0140] 2. Transfer to xylene II for clearing for 5 - 10 minutes.

[0141] (V) Mounting:

[0142] Mount with gum. First, take out the sections from xylene II, quickly wipe off the xylene around the tissue, drop a drop of gum on the tissue section, then take a clean coverslip and carefully place it on the mounting medium, slowly flatten it to make the coverslip in the proper position. After the sections are mounted, dry them in an incubator, or let them dry flat at room temperature and then put them in a box.

[0143] The results showed that the cell morphology and histological structure of the heart, liver, spleen, lung, and kidney remained normal. In addition, the combination treatment of TMX - 4100 and metformin did not significantly affect the body weight of the mice, indicating that the combination treatment of TMX - 4100 and metformin is safe in vivo. In summary, the combination treatment of TMX - 4100 and metformin has reliable biological safety (as Figure 20 shown).

[0144] Example 6

[0145] Comparison of the results of the overall survival without biochemical recurrence and the expression level of PDE6D in patients with high and low expression of PDE6D in 8 public databases, as well as in patients with different clinical stages and Gleason scores.

[0146] Specific experimental steps: In this application, bioinformatics analysis was used to compare the results of the overall survival without biochemical recurrence and the expression level of PDE6D in patients with high and low expression of PDE6D in 8 public databases (TCGA, CancerMap, GSE54460, CIT, CPC, Taylor, DKFZ, and Stockholm), as well as in patients with different clinical stages and Gleason scores. The results in the TCGA database showed that patients with high expression of PDE6D had a higher probability of biochemical recurrence (as Figure 21 shown), a higher pathological T stage, a higher pathological N stage, and a higher Gleason score (as Figure 22 shown). In the remaining 7 public databases, this application observed that patients with high expression of PDE6D had a higher Gleason score (as Figures 23-24 shown).

[0147] In summary, the research of this application shows that patients with high expression of PDE6D have a greater probability of biochemical recurrence and poorer clinical staging and Gleason scores.

[0148] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of this application rather than to limit the protection scope of this application. Although this application has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of this application can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of this application.

Claims

1. Use of a phosphodiesterase 6D detection reagent in the preparation of a product for guiding medication for the treatment of prostate cancer, characterized in that: The drugs for treating prostate cancer include metformin.

2. The use according to claim 1, characterized in that The drug for treating prostate cancer also includes TMX-4100.

3. The use according to claim 1, characterized in that The phosphodiesterase 6D detection reagent includes a reagent for detecting phosphodiesterase 6D mRNA or a reagent for detecting phosphodiesterase 6D protein.

4. The use according to claim 3, characterized in that The reagent for detecting phosphodiesterase 6D mRNA includes phosphodiesterase 6D detection primers, and the phosphodiesterase 6D detection primers include an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:

2.

5. The use according to claim 3, characterized in that The reagent for detecting phosphodiesterase 6D protein comprises a primary antibody and a secondary antibody, wherein the primary antibody is a rabbit-derived phosphodiesterase 6D polyclonal antibody, and the secondary antibody is a goat anti-rabbit secondary antibody.

6. The use according to claim 1, characterized in that The prostate cancer includes locally advanced prostate cancer or castration-resistant prostate cancer.

7. Application of a reagent for detecting phosphodiesterase 6D expression in the preparation of a product for predicting the sensitivity of prostate cancer to metformin.

8. The use according to claim 7, characterized in that The human equivalent dosage of metformin when used is 500 mg / day for oral administration.

9. The use of TMX-4100 and metformin in combination for the preparation of drugs for the treatment of castration-resistant prostate cancer.

Citation Information

Patent Citations

  • Novel biomarker signature and uses thereof

    WO2014162008A2