Small nucleic acids targeting androgen receptor, pharmaceutical compositions thereof and uses

Abstract

The present invention discloses small nucleic acids targeting androgen receptor (AR), provides a variety of modification methods. After modification, the sequence stability is enhanced, and the AR mRNA is effectively knocked down, with remarkable curative effects, and it can be used together with a variety of delivery formulations. The small nucleic acids provided by the present invention can be efficiently delivered to the target through lipid nanoparticles, or the small nucleic acids can be effectively delivered into cells without other delivery carriers by coupling an alkyl chain structure in the sequence. The small nucleic acids provided by the present invention and their preparation methods can be used as a technical means for treating diseases caused by abnormal androgen expression or treating diseases related to androgen receptor, and its indications include but are not limited to androgenetic alopecia, alopecia areata, alopecia neurotica, cicatricial alopecia, diffuse alopecia, and acne, etc.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and specifically relates to small nucleic acids targeting androgen receptors, pharmaceutical compositions thereof, and uses thereof. Background Art

[0002] Androgenetic alopecia (AGA) is a progressive hair loss disease characterized by follicular miniaturization starting from puberty or late puberty. AGA is a polygenic recessive genetic disease with a genetic predisposition.

[0003] Current research shows that androgens play a decisive role in the pathogenesis of AGA; other factors such as perifollicular inflammation, increased life stress, tension and anxiety, and poor lifestyle and eating habits may all exacerbate the symptoms of AGA. Although androgens are the key factors in the pathogenesis of AGA, the androgen levels in the blood circulation of almost all AGA patients remain normal. Research has shown that due to the increased expression of androgen receptor gene (AR) or type II 5α-reductase gene in the hair follicles of the alopecia area, the effect of androgens on susceptible hair follicles is increased. For AGA, the dermal cells in the susceptible hair follicles contain specific type II 5α-reductase, which can catalyze the conversion of the androgen testosterone circulating in the blood to dihydrotestosterone (DHT), and cause a series of reactions by binding to the androgen receptor in the cells, thereby leading to progressive miniaturization and hair loss of the hair follicles until baldness.

[0004] The main treatment methods for AGA include systemic medication and topical treatment, etc. Among them, the common drugs in systemic medication are finasteride and spironolactone, and the common drug in topical treatment is minoxidil topical preparation. These drugs need to be taken daily, and the patient compliance still needs to be improved.

[0005] Androgen receptor (AR) is a popular target for drug research in the field of alopecia. There have been many research reports on RNA therapies targeting AR. The results of these studies still have some deficiencies. For example, patent CN118726351A discloses a functional small interfering RNA and its product, and this patent only reflects the in vitro experimental results of the small interfering RNA, lacking in vivo experimental data support. Patent CN118421625A discloses an antisense oligonucleotide and an androgen receptor inhibitor and their uses, and only the in vitro experimental results are disclosed in the text, without reflecting the in vivo experimental results. It can be seen that there is still a need to develop an effective RNA therapy targeting AR. Summary of the Invention

[0006] In view of the deficiencies of the prior art, the present invention provides a siRNA targeting AR, as well as a corresponding modified siRNA, which can effectively reduce the expression level of AR mRNA, and thus can be used to treat diseases caused by abnormal androgen expression or diseases related to androgen receptor.

[0007] In one aspect, the present invention provides a small nucleic acid targeting androgen receptor, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 1, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 2; the small nucleic acid targeting androgen receptor comprises one or more modifications; the sequence of the sense strand is t*t*AmUmUm(C16-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am (SEQ ID NO: 13), and the sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um (SEQ ID NO: 14),

[0008] wherein, u or U represents uridine nucleotide, g or G represents guanine nucleotide, c or C represents cytosine nucleotide, a or A represents adenine nucleotide, t represents thymidine deoxynucleotide, φ represents pseudouridine, m represents 2'-O-methyl modification, Cm-CH3 represents cytosine nucleotide containing 2'-O-methyl modification and 5-methyl modification, φm represents pseudouridine containing 2'-O-methyl modification and N1-methyl modification, m represents 2'-O-methoxyethyl modification, f represents 2'-fluoro modification, L represents locked nucleic acid modification, GNA represents glycol nucleic acid modification, VP represents 5'-phosphorylation modification of ribose, * represents thiophosphate modification of a non-bridging oxygen atom of the α-position phosphate group of the nucleotide, and C16- represents 2'-O-n-hexadecyl modification.

[0009] In another aspect, the present invention provides a method for preparing the small nucleic acid targeting androgen receptor as described in any one of the embodiments herein.

[0010] Preferably, the method for preparing the small nucleic acid targeting androgen receptor is the phosphoramidite triester method.

[0011] In another aspect, the present invention provides a pharmaceutical composition, which comprises a therapeutically effective amount of the small nucleic acid targeting androgen receptor as described in any one of the embodiments herein, and a pharmaceutically acceptable carrier, solvent or excipient.

[0012] In one or more embodiments, the carrier is a lipid nanoparticle or an exosome.

[0013] Preferably, the carrier is a lipid nanoparticle.

[0014] In one or more embodiments, the lipid nanoparticles are composed of an aqueous phase and an organic phase, and the volume ratio of the aqueous phase to the organic phase is 10:1 to 1:10.

[0015] Preferably, the volume ratio of the aqueous phase to the organic phase is 3:1 to 1:1. More preferably, the volume ratio of the aqueous phase to the organic phase is 3:1, 2:1 or 1:1. Even more preferably, the volume ratio of the aqueous phase to the organic phase is 3:1.

[0016] In one or more embodiments, the organic phase is composed of cationic lipid, co-lipid, steroid, and PEG-lipid, wherein the molar ratio of cationic lipid, co-lipid, steroid, and PEG-lipid is 40-60:3-20:25-55:0.1-10; the cationic lipid is selected from dimethyldilinoleoyl methylammonium butyrate (Dlin-M-C3-DMA), 9A1P9, trimethyl-2,3-dioleyloxypropylammonium chloride (DOTAP), trimethyl-2,3-dioleyloxypropylammonium bromide (DTOPA), dimethyl-2,3-dioleyloxypropyl-2-(2-sperminecarbamoyl amino)ethylammonium trifluoroacetate (DOSPA), dioleylpropyltrimethylammonium chloride (DOTMA), C12-200, ATX-100, 98N 12-5, FTT5, 9-heptadecanyl 8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), ((4-hydroxybutyl)azaalkanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), bis((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (Lipid-319), bis(2-butyl octyl) 10-(1-(3-(dimethylamino)propyl)-3-octylureido)nonadecanoate (OT13), Dlin-KC2-DMA, Lipid 29, 9-heptadecanyl 8-((2-hydroxyethyl)(8-(nonyloxy)octan-8-yl)amino)octanoate (Lipid5), Lipid A6, YSK12-C4, and CL4H6; the co-lipid is selected from one or more of 1,2-distearoyl-sn-glycero-3-phosphocholine (1,2-DSPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), and dioleoylphosphatidylethanolamine (DOPE); the sterol lipid is selected from phytosterol or cholesterol; the PEG-lipid is selected from one or more of 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG2000), (DPG-PEG 2000), polyethylene glycol-distearoylphosphatidylethanolamine (PEG2000-DSPE), distearoyl-rac-glycero-polyethylene glycol 2000 (DSG-PEG 2000), and methoxypolyethylene glycol ditetradecylacetamide (ALC-0159).

[0017] Preferably, the molar ratio of the cationic lipid, co-lipid, sterol, and PEG-lipid is 40-55:9-12:35-41:1-2.

[0018] Preferably, the aqueous phase is acetic acid-sodium acetate buffer or citric acid-sodium citrate buffer. More preferably, the aqueous phase is acetic acid-sodium acetate buffer with a pH of 3.0-5.0. More preferably, the aqueous phase is citric acid-sodium citrate buffer with a pH of 3.0-5.0. Further preferably, the aqueous phase is acetic acid-sodium acetate buffer with a pH of 4.0-5.0. Further preferably, the aqueous phase is citric acid-sodium citrate buffer with a pH of 4.0-5.0. Further preferably, the aqueous phase is acetic acid-sodium acetate buffer with a pH of 4.5. Further preferably, the aqueous phase is citric acid-sodium citrate buffer with a pH of 4.5.

[0019] In another aspect, the present invention provides a method for preparing a pharmaceutical composition as described in any embodiment herein, the method comprising adding a small nucleic acid targeting androgen receptor as described in any embodiment herein, and a pharmaceutically acceptable carrier, solvent or excipient to a solvent.

[0020] Preferably, the method is ethanol injection method.

[0021] In another aspect, the present invention provides the use of a small nucleic acid targeting androgen receptor or a pharmaceutical composition as described in any embodiment herein in the preparation of a medicament for treating diseases related to abnormal androgen expression.

[0022] Preferably, the diseases related to abnormal androgen expression are selected from androgenetic alopecia, alopecia areata, telogen effluvium, cicatricial alopecia, diffuse alopecia or acne. More preferably, the disease related to abnormal androgen expression is androgenetic alopecia.

[0023] In another aspect, the present invention provides a small nucleic acid targeting androgen receptor, the sense strand of which comprises the nucleotide sequence shown in SEQ ID NO: 1, and the antisense strand of which comprises the nucleotide sequence shown in SEQ ID NO: 2;

[0024] The small nucleic acid targeting androgen receptor comprises one or more modifications; the small nucleic acid targeting androgen receptor comprises one or more modifications; each modification is independently located at any nucleotide of the sense strand or the antisense strand; each modification is independently selected from thymidine substitution, pseudouridine substitution, 2'-O-methyl modification, 2'-O-methyl modification and 5-methyl modification, 2'-O-methyl modification and N1-methyl modified pseudouridine substitution, 2'-O-methoxyethyl modification, 2'-fluoro modification, locked nucleic acid modification, glycol nucleic acid modification, 5'-phosphorylation modification, 2'-O-Cn alkyl modification, thiolation modification, GalNAc modification, spherical nucleic acid modification cholesterol modification, polyethylene glycol modification, cyclodextrin modification, cell-penetrating peptide modification, antibody conjugation, aptamer conjugation and polypeptide conjugation.

[0025] In one or more embodiments, the sequence of the sense strand is t*t*AmUmUmCfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um; the small nucleic acid targeting androgen receptor further comprises 2'-O-Cn alkyl modification, where n = 16-22 in Cn alkyl;

[0026] Among them, u or U represents uridine nucleotide, g or G represents guanine nucleotide, c or C represents cytosine nucleotide, a or A represents adenine nucleotide, t represents thymidine monophosphate, φ represents pseudouridine, m represents 2'-O-methyl modification, Cm-CH3 represents cytosine nucleotide with 2'-O-methyl modification and 5-methyl modification, φm represents pseudouridine with 2'-O-methyl modification and N1-methyl modification, m represents 2'-O-methoxyethyl modification, f represents 2'-fluoro modification, L represents locked nucleic acid modification, GNA represents glycol nucleic acid modification, VP represents 5'-phosphorylation modification of ribose, Cn- represents 2'-O-Cn alkyl modification, and * represents thiophosphorylation modification of a non-bridging oxygen atom of the phosphate group at the α-position of the nucleotide.

[0027] Preferably, the Cn alkyl is a C16-C22 saturated alkyl or unsaturated alkyl. More preferably, the Cn alkyl is a C16-C22 saturated alkyl. Further preferably, the Cn alkyl is a C16-C22 saturated normal alkyl.

[0028] In one or more embodiments, the nucleotide sequence of the sense strand of the small nucleic acid targeting the androgen receptor is t*t*AmUmUm(Cn-c) CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um; the nucleotide sequence of the sense strand is tta*u*u*c*c*a*gu*gga*u*gggc*u*ga, and the nucleotide sequence of the antisense strand is uuucagcccauccacuggaau; the nucleotide sequence of the sense strand is t*t*AmφφccAmgφggAmφgggcuga, and the nucleotide sequence of the antisense strand is (VPu)*uucagccca(φm-CH3)(Cm-CH3)(Cm-CH3)a(Cm-CH3) (φm-CH3)gga*a*(φm-CH3); the nucleotide sequence of the sense strand is tt(Cn-a)uuCLCLaguggaugggCLu*g*a, and the nucleotide sequence of the antisense strand is (VPu)uu(GNA-G)cc(GNA-C)au(GNA-C)ca(GNA-C)ug(GNA-G)aa(Cn-u); the nucleotide sequence of the sense strand is tt*a*u*u*(Cn-c)*c*a*gu*gga*u*gggcuga; the nucleotide sequence of the antisense strand is uuucagcccauccacuggaau; the nucleotide sequence of the sense strand is t*t*auuccaguggaugggcu*g*a, and the nucleotide sequence of the antisense strand is u*Uf*UmCmAmGmCmCfcauccacugga*a*u; or, the nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um.

[0029] Preferably, the Cn alkyl group is a saturated alkyl group or an unsaturated alkyl group. More preferably, the Cn alkyl group is a saturated alkyl group. Further preferably, the Cn alkyl group is a saturated straight-chain alkyl group.

[0030] Preferably, the Cn alkyl group is n-hexadecyl.

[0031] In one or more embodiments, the nucleotide sequence of the sense strand of the small nucleic acid targeting the androgen receptor is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, where n is 16; the nucleotide sequence of the sense strand is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, where n is 18; the nucleotide sequence of the sense strand is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, where n is 20; the nucleotide sequence of the sense strand is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, where n is 22; the nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUfGfGmAmUmGmGmGmCmUm*(Cn-g)*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, where n is 16; the nucleotide sequence of the sense strand is t*t*AmUmUmCmCmAmGf(Cn-u)GfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, where n is 16; the nucleotide sequence of the sense strand is t*t*(Cn-a)UmUmCmCfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, where n is 16;The nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUf GfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*(Cn-u), where n is 16; the nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUf GfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGm(Cn-g) Am*Am*Um, where n is 16; the nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUf GfGmAmUmGmGmGmCmUm*Gm*Am; the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCm(Cn-a)CmUfGmGmAm*Am*Um, where n is 16; or, the nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUfGfGmAmUm GmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUm(Cn-c) AmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, where n is 16.;

[0032] Preferably, the Cn alkyl group is a saturated alkyl group or an unsaturated alkyl group. More preferably, the Cn alkyl group is a saturated alkyl group. Even more preferably, the Cn alkyl group is a saturated normal alkyl group.

[0033] Preferably, the nucleotide sequence of the sense strand is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, where n = 16, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um.

[0034] In another aspect, the present invention provides a method for preparing a small nucleic acid targeting the androgen receptor as described in any one of the embodiments herein.

[0035] Preferably, the method for preparing the small nucleic acid targeting the androgen receptor is the phosphoramidite triester method.

[0036] In another aspect, the present invention provides a pharmaceutical composition, which comprises a therapeutically effective amount of a small nucleic acid targeting the androgen receptor as described in any one of the embodiments herein, and a pharmaceutically acceptable carrier, solvent or excipient.

[0037] In one or more embodiments, the carrier is a lipid nanoparticle or an exosome.

[0038] Preferably, the carrier is a lipid nanoparticle.

[0039] In one or more embodiments, the lipid nanoparticle is composed of an aqueous phase and an organic phase, and the volume ratio of the aqueous phase to the organic phase is 10:1 to 1:10.

[0040] Preferably, the volume ratio of the aqueous phase to the organic phase is 3:1 to 1:1. More preferably, the volume ratio of the aqueous phase to the organic phase is 3:1, 2:1 or 1:1. Even more preferably, the volume ratio of the aqueous phase to the organic phase is 3:1.

[0041] In one or more embodiments, the organic phase is composed of a cationic lipid, a co-lipid, a steroid, a PEG-lipid and an aqueous phase, wherein the molar ratio of the cationic lipid, the co-lipid, the steroid and the PEG-lipid is 40-60:3-20:25-55:0.1-10; the cationic lipid is selected from dimethyldilinoleylammonium butyrate (Dlin-M-C3-DMA), 9A1P9, trimethyl-2,3-dioleyloxypropylammonium chloride (DOTAP), trimethyl-2,3-dioleyloxypropylammonium bromide (DTOPA), dimethyl-2,3-dioleyloxypropyl-2-(2-sperminecarboxamido)ethylammonium trifluoroacetate (DOSPA), dioleylpropyltrimethylammonium chloride (DOTMA), C12-200, ATX-100, 98N 12-5, FTT5, 9-heptadecanyl 8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), ((4-hydroxybutyl)azaalkanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), bis((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (Lipid-319), bis(2-butyl octyl) 10-(1-(3-(dimethylamino)propyl)-3-octylureido)nonadecanoate (OT13), Dlin-KC2-DMA, Lipid 29, 9-heptadecanyl 8-((2-hydroxyethyl)(8-(nonyloxy)octan-8-yl)amino)octanoate (Lipid5), Lipid A6, YSK12-C4, and CL4H6; the co-lipid is selected from one or more of 1,2-distearoyl-sn-glycero-3-phosphocholine (1,2-DSPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), and dioleoylphosphatidylethanolamine (DOPE); the steroid lipid is selected from phytosterol or cholesterol; the PEG-lipid is selected from one or more of 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG2000), (DPG-PEG 2000), polyethylene glycol-distearoylphosphatidylethanolamine (PEG2000-DSPE), distearoyl-rac-glycero-polyethylene glycol 2000 (DSG-PEG 2000), and methoxypolyethylene glycol ditetradecylacetamide (ALC-0159).

[0042] Preferably, the molar ratio of the cationic lipid, co-lipid, steroid, and PEG-lipid is 40-55:9-12:35-41:1-2.

[0043] Preferably, the aqueous phase is an acetic acid-sodium acetate buffer or a citric acid-sodium citrate buffer. More preferably, the aqueous phase is an acetic acid-sodium acetate buffer with a pH of 3.0-5.0. More preferably, the aqueous phase is a citric acid-sodium citrate buffer with a pH of 3.0-5.0. Further preferably, the aqueous phase is an acetic acid-sodium acetate buffer with a pH of 4.0-5.0. Further preferably, the aqueous phase is a citric acid-sodium citrate buffer with a pH of 4.0-5.0. Further preferably, the aqueous phase is an acetic acid-sodium acetate buffer with a pH of 4.5. Further preferably, the aqueous phase is a citric acid-sodium citrate buffer with a pH of 4.5.

[0044] In another aspect, the present invention provides a method for preparing a pharmaceutical composition as described in any one of the embodiments herein, the method comprising adding a small nucleic acid targeting the androgen receptor as described in any one of the embodiments herein, and a pharmaceutically acceptable carrier, solvent or excipient to a solvent.

[0045] Preferably, the method is the ethanol injection method.

[0046] In another aspect, the present invention provides the use of a small nucleic acid targeting the androgen receptor or a pharmaceutical composition as described in any one of the embodiments herein in the preparation of a medicament for treating a disease related to abnormal androgen expression.

[0047] Preferably, the diseases related to abnormal androgen expression are selected from androgenetic alopecia, alopecia areata, telogen effluvium, cicatricial alopecia, diffuse alopecia or acne. More preferably, the disease related to abnormal androgen expression is androgenetic alopecia.

[0048] The present invention provides siRNAs targeting AR, and corresponding siRNA sequences containing modifications, which can effectively reduce the expression level of AR mRNA, thereby being used for treating diseases caused by abnormal androgen expression or treating diseases related to androgen receptors, and the indications include but are not limited to androgenetic alopecia, alopecia areata, telogen effluvium, cicatricial alopecia, diffuse alopecia and acne, etc. The present invention provides a variety of siRNA modification methods, and the sequence stability is enhanced after modification and AR mRNA is effectively knocked down. The siRNAs provided by the present invention can be efficiently delivered to the target by lipid nanoparticles, or can be effectively delivered into cells without other delivery vectors by adding alkyl chain modifications to the sequence, and it has been verified in cell experiments. Compared with the existing small molecule drugs, the siRNAs of the present invention have a longer drug efficacy duration, the frequency of medication is reduced, patients do not need to take medicine daily, and the patient compliance is effectively improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 It is a result diagram of the effect of naked sequence siRNA on the expression level of AR mRNA in cells.

[0050] Figure 2 It is a result diagram of the serum enzymatic hydrolysis of siRNA containing modifications.

[0051] Figure 3 It is a result diagram of the effect of siRNA containing modifications on the expression level of AR mRNA in cells.

[0052] Figure 4 It is a result diagram of the effect of siRNA containing modifications with different delivery methods on the expression level of AR mRNA in cells.

[0053] Figure 5 The figure shows the results of the effect of siRNAs modified with alkyl chains Cn containing different numbers of carbon atoms on the expression level of AR mRNA in cells.

[0054] Figure 6 The figure shows the results of the effect of siRNAs modified with alkyl chains Cn at different sites on the expression level of AR mRNA in cells.

[0055] Figure 7 The figure shows the results of the effect of modified siRNAs on hair growth in male mice.

[0056] Figure 8 The figure shows the results of the effect of modified siRNAs on various phenotypes of hair growth in male mice. Among them, Figure 8 a in [the figure] is the result figure for the effect on hair length; Figure 8 b in [the figure] is the result figure for the effect on hair shaft diameter; Figure 8 c in [the figure] is the result figure for the effect on follicle length; Figure 8 d in [the figure] is the result figure for the effect on follicle density; Figure 8 e in [the figure] is the result figure for the effect on follicle diameter; Figure 8 f in [the figure] is the result figure for the effect on the ratio of the number of follicles in the growth / resting phase; Figure 8 g in [the figure] is the result figure for the effect on the area of the hair bulb covered by melanin.

[0057] Figure 9 The figure shows the results of the effect of modified siRNAs on the expression level of AR mRNA in the skin of male mice.

[0058] Figure 10 The figure shows the content of various factors in the serum of male mice treated with modified siRNAs.

[0059] Figure 11 The figure shows the results of the effect of modified siRNAs on hair growth in female mice.

[0060] Figure 12 The figure shows the results of the effect of modified siRNAs on various phenotypes of hair growth in female mice. Among them, Figure 12 a in [the figure] is the result figure for the effect on hair length; Figure 12 b in [the figure] is the result figure for the effect on hair shaft diameter; Figure 12 c in [the figure] is the result figure for the effect on follicle length; Figure 12 d in [the figure] is the result figure for the effect on follicle density; Figure 12 e in [the figure] is the result figure for the effect on follicle diameter; Figure 12 f in [the figure] is the result figure for the effect on the ratio of the number of follicles in the growth / resting phase; Figure 12 g in [the figure] is the result figure for the effect on the area of the hair bulb covered by melanin.

[0061] Figure 13 It is a graph showing the results of the effect of modified siRNA on the expression level of AR mRNA in the skin of female mice. Detailed implementation manners

[0062] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0063] Unless otherwise specified, the reagents used in the following examples are all commercially available.

[0064] In the present invention, RNA can play the role of one or more molecules among siRNA, ASO, saRNA, sgRNA, miRNA, etc. to achieve a therapeutic effect.

[0065] In the present invention, the RNA delivery methods include but are not limited to self-delivery, GalNAc, lipid nanoparticles, alkyl chains, cholesterol, phosphate groups, phosphate analogs, polyethylene glycol groups, cyclodextrin groups, cell-penetrating peptides, exosomes, antibody conjugates, nucleic acid aptamers, polypeptide conjugates, spherical nucleic acids (SNA), DNA nanostructures, etc.

[0066] In the present invention, the preparation methods of lipid nanoparticles include but are not limited to ethanol injection method, microfluidic mixing method, thin film hydration method, T-junction mixing method, etc.

[0067] In the present invention, the preparation methods of some buffers are as follows:

[0068] Sodium acetate solution (0.2 mol / L): Weigh 0.272 g of sodium acetate trihydrate and dissolve it in 10 g of water, and mix well to obtain.

[0069] Acetic acid solution (0.3 mol / L): Pipette 0.172 g of acetic acid into 9.828 g of water for injection, and mix well to obtain.

[0070] Acetic acid-sodium acetate buffer (room temperature pH 4.5, 0.1368 mol / L): Pipette 2.65 mL of sodium acetate solution (0.2 mol / L) and 7.35 mL of acetic acid solution (0.3 mol / L) into a 50 ml centrifuge tube, add 10 mL of water for injection, mix well, and the pH value is about 4.5.

[0071] Citric acid-sodium citrate buffer (pH 4.0, 0.01 mol / L): Add 0.114 g of citric acid and 0.104 g of trisodium citrate to water for injection, and make up the volume to 100 mL with water for injection and mix well to obtain.

[0072] Citrate - Sodium Citrate Buffer (pH 4.5, 0.14 mol / L): Add 1.223 g of citric acid and 1.968 g of trisodium citrate to water for injection, and make up the volume to 100 mL with water for injection and mix well.

[0073] HEPES Dilution Buffer (containing 30 mM HEPES, 30 mM sodium chloride, 6% sucrose): Weigh 0.715 g of HEPES, 0.175 g of sodium chloride and 6.0 g of sucrose respectively, add 95.0 g of water for injection, mix and dissolve, and adjust the pH to 7.4 with 0.5 M sodium hydroxide.

[0074] Example 1: siRNA Sequence Design and Verification

[0075] This example discloses the design and screening of naked siRNA sequences targeting the mRNA of the AR gene.

[0076] (1) siRNA Sequence Design

[0077] The NCBI gene ID of human AR (androgen receptor) is 367. Using its transcript NM_000044.6 as a template, while avoiding the sequences in the 5'untranslated region (5'UTR) and 3'untranslated region (3'UTR) and the sequences near its start codon, siRNA was designed. The 5' and 3' ends of the sense strand and / or antisense strand of the siRNA may not carry hanging nucleotides or may carry several hanging nucleotides, and the bases of the hanging nucleotides do not participate in base complementary pairing between the sense strand and the antisense strand; the 5' end of the sense strand, the 5' end of the antisense strand, the 3' end of the sense strand, and the 3' end of the antisense strand can independently carry or not carry hanging nucleotides. The number of hanging nucleotides is preferably 0 - 10, more preferably 2 - 4, and further preferably 2. Each hanging nucleotide is independently selected from adenosine ribonucleotide, guanosine ribonucleotide, cytidine ribonucleotide, uridine ribonucleotide, thymidine ribonucleotide, deoxyadenosine, deoxyguanosine, deoxycytidine, deoxyuridine, and thymidine deoxyribonucleotide.

[0078] According to the above principles, several pairs of siRNA (hereinafter referred to as siAR) sequences targeting the mRNA of the AR gene were designed, and the sequence details are shown in Table 2.

[0079] Table 1 shows the representation methods of some special nucleotide monomers. In oligonucleotides, these special nucleotide monomers are connected to other nucleotide monomers through 5'-3'-phosphodiester bonds. All the special nucleotide monomers in Table 1 can be obtained commercially.

[0080] Table 1: Representation and Meaning of Special Nucleotide Monomers

[0081]

[0082] Table 2: siRNA Sequences Targeting AR

[0083]

[0084] (2)Synthesis of siRNA

[0085] The siRNA sequences were synthesized by the phosphoramidite triester method, which repeated 5 procedures of "deprotection - activation - coupling - capping - oxidation". After each round of repetition, the oligonucleotide chain was extended by one nucleotide, and finally a crude synthetic product of the target length was obtained. The deprotection reagent was TCA Deblock, the activator was 5-benzylthiotetrazole, the capping reagents were CAPA and CAPB, and the oxidant was iodine solution or (E)-N,N-dimethyl-N'-(3-thioxo-3H-1,2,4-dithiazol-5-yl)formamidine.

[0086] The crude synthetic product was deprotected, annealed and purified to obtain different siRNA sequences; among them, the HPLC method was used to purify the annealed product.

[0087] Purification materials: Anion exchange column Diamond Q Mustang (purchased from Bio-Gelon Co., Ltd.) and eluent (a mixture of different ratios of Solution A and Solution B, Solution A: 100 mM Tris, 10 mM EDTA, 300 mM NaCl, pH 9.0; Solution B: 100 mM Tris, 10 mM EDTA, 1000 mM NaCl, pH 9.0).

[0088] Purification procedure: Elute with 5 CV (column volume) of Solution A; elute with 50 CV of eluent (containing 0%-100%B); elute with 5 CV of Solution B. The product of the target elution peak was desalted with a G25M column (purchased from Bio-Gelon Co., Ltd.). The desalted product was concentrated by ultrafiltration to obtain a purified product, which was vacuum-packed after lyophilization and stored at -20°C for later use.

[0089] (3)Verification of the Effect of siRNA on the Expression Level of Cellular AR mRNA

[0090] Verification process: Dissolve and dilute siRNA to 100 μM for standby. Seed HaCat cells in a 12-well plate, and perform siRNA transfection 24 h after seeding. The transfection reagent is Lip3000 (i.e., Lipofectamine 3000, purchased from Thermo Fisher). The final concentrations of siRNA after transfection are 30 nM and 100 nM. Culture the cells in a CO2 incubator for 48 h. Additionally, set up a control group without adding siRNA. Collect the cells to extract RNA, reverse transcribe the RNA into cDNA, and perform qPCR detection.

[0091] Verification results:

[0092] The cell verification results of each siRNA sequence are as Figure 1 shown, where the ordinate is the relative expression level of AR mRNA compared with the control group. Except that siAR-Luo5 and siAR-Luo6 have poor knockdown effects on AR mRNA, the relative expression levels of AR mRNA corresponding to the other 4 sequences are all less than 0.6. Among them, at concentrations of 30 nM or 100 nM, siAR-Luo1, siAR-Luo2, and siAR-Luo3 all showed good knockdown effects.

[0093] Example 2: Preparation of delivery vector LNP

[0094] This example discloses an LNP for delivering siRNA and its preparation method.

[0095] (1) Composition of LNP

[0096] LNP consists of an aqueous phase and an organic phase. The organic phase includes cationic lipid, co-lipid, steroid, and PEG-lipid, and the molar ratio of the four lipids is 40 - 60:3 - 20:25 - 55:0.1 - 10. The aqueous phase buffer is selected from acetic acid-sodium acetate buffer and citric acid-sodium citrate buffer. The volume ratio of the aqueous phase to the organic phase is 1 - 100:1 - 100. Non-limiting examples of the composition of some LNP are shown in Table 3.

[0097] Cationic lipids include but are not limited to dimethyldioctadecylammonium butyrate (Dlin-M-C3-DMA), 9A1P9, trimethyl-2,3-dioleyloxypropylammonium chloride (DOTAP), trimethyl-2,3-dioleyloxypropylammonium bromide (DTOPA), dimethyl-2,3-dioleyloxypropyl-2-(2-sperminecarboxamido)ethylammonium trifluoroacetate (DOSPA), dioleylpropyltrimethylammonium chloride (DOTMA), C12-200, ATX-100, 98N 12-5, FTT5, heptadec-9-yl 8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), ((4-hydroxybutyl)azaalkanediyl)bis(hexane-6,1-diyl) bis(2-hexyldecanoate) (ALC-0315), bis((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (Lipid-319), bis(2-butyl octyl) 10-(1-(3-(dimethylamino)propyl)-3-octylureido) nonadecanoate (OT13), Dlin-KC2-DMA, Lipid 29, heptadec-9-yl 8-((2-hydroxyethyl)(8-(nonyloxy)octan-8-yloxy)octanoate) (Lipid5), Lipid A6, YSK12-C4, and CL4H6.

[0098] Co-lipids include, but are not limited to, 1,2-distearoyl-sn-glycero-3-phosphocholine (1,2-DSPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), dioleoylphosphatidylethanolamine (DOPE).

[0099] Steroid lipids include, but are not limited to, phytosterols (such as campesterol, sitostanol, stigmasterol, spinasterol, β-sitosterol, etc.), cholesterol.

[0100] PEG-lipids include, but are not limited to, 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG2000), (DPG-PEG 2000), polyethylene glycol-distearoylphosphatidylethanolamine (PEG2000-DSPE), distearoyl-rac-glycero-polyethylene glycol 2000 (DSG-PEG 2000), and methoxypolyethylene glycol ditetradecylacetamide (ALC-0159).

[0101] Table 3: LNP composition

[0102]

[0103] (2) LNP preparation method

[0104] Taking LNP-001 as an example, the process of preparing small-scale LNP by ethanol injection method is as follows:

[0105] S1: Preparation of lipid ethanol solution

[0106] Weigh 34.4 mg of SM-102, 7.2 mg of DSPC, 16.0 mg of cholesterol, and 4.0 mg of DMG-PEG2000, respectively, add them to a 2 mL cryovial, add 1 mL of anhydrous ethanol, and vortex and shake to dissolve with a vortexer to obtain a lipid ethanol solution. Pipette each lipid ethanol solution in the required amount into a 1.5 mL centrifuge tube and mix evenly to obtain a final volume of 500 μL of an organic phase solution for standby use.

[0107] S2: Aqueous solution preparation

[0108] 0.4 mL of water for injection was used to dissolve 2 mg of siRNA lyophilized powder to obtain a 5000 ng / μL siRNA solution.

[0109] Take 1423 μL of acetic acid-sodium acetate buffer and 77 μL of siRNA solution into a 10 mL cryovial, slowly stir and mix to obtain an aqueous solution for later use.

[0110] Among them, V 水相 (Volume of aqueous solution) = V 缓冲液 (Volume of acetic acid-sodium acetate buffer) + V siRNA (siRNA solution volume), the volume ratio of aqueous phase to organic phase is 3:1; the mass of siRNA required is calculated to be 0.385 mg, and the volume of siRNA solution required in the aqueous phase solution can be calculated by the formula V siRNA = 385000 / C (μL), where C is the concentration of siRNA in the siRNA solution (ng / μL); the volume of acetic acid-sodium acetate buffer V required is calculated from this 缓冲液 = 1500-385000 / C (μL).

[0111] S3: Preparation of LNP-siRNA

[0112] About 500 μL of lipid ethanol solution was drawn and quickly injected into the aqueous solution to obtain LNP-001-siRNA. 50 μL of LNP solution was sampled and the particle size of the sample was measured using a Malvern particle size analyzer.

[0113] S4: Concentration and medium exchange

[0114] Add 3 times the volume of HEPES buffer to the sample and slowly invert to mix. Pour the diluted LNP solution into an ultrafiltration centrifuge tube, centrifuge and concentrate to 1.0-1.5 mL, fill with HEPES buffer, invert and mix, centrifuge and concentrate again to 0.3-0.5 mL, collect the sample and place it at 4°C for later use.

[0115] The formulations of LNP-002-siRNA to LNP-005-siRNA were carried out according to steps S1 to S4 and Table 3 respectively. The physicochemical data are shown in Table 4, with good particle size and uniform particle distribution (PDI < 0.1) and high encapsulation efficiency (> 90%).

[0116] Table 4: Physicochemical data of each LNP-siRNA

[0117]

[0118] Example 3: Design, synthesis and verification of modified siRNA

[0119] (1) Design and synthesis of modified siRNA

[0120] RNA modifications in the present invention include but are not limited to phosphate backbone modification, base modification, ribose modification, 5'-end modification, 3'-end modification and bioconjugation modification, etc.

[0121] Phosphate backbone modifications include but are not limited to phosphorothioate, dithiophosphate, peptide nucleic acid (PNA) and morpholinos (PMOs) modifications.

[0122] Base modifications include but are not limited to pseudouracil (φ), 2-thiouracil (s2U), 5-methyl-cytosine, 2,6-diaminopurine, 2-thio-thymine.

[0123] Ribose modifications include but are not limited to 2'-O-methyl, 2'-O-methoxyethyl, 2'-F, locked nucleic acid (LNA), constrained ethyl (cEt), ENA (ethylene-bridged nucleic acid) and GNA (glycerol nucleic acid), etc.

[0124] 5'-end conjugation includes but is not limited to conjugation with cholesterol, 5'-Vp (5'-vinylphosphonate), antibody, polysaccharide, sterol, phospholipid or polypeptide, etc.

[0125] The 3'-end conjugation includes, but is not limited to, conjugation with cholesteryl, polyethylene glycol, N-acetylglucosamine derivatives, biotin, polypeptides, phospholipids, etc.

[0126] The bioconjugation modifications include, but are not limited to, one or more combinations of N-acetylgalactosamine (GalNAc), cholesterol, aptamers, and peptides.

[0127] The isomers of sequence modifications include, but are not limited to, the isomers introduced by different configurations of monomers or obtained from synthetic reactions, including but not limited to the isomerism introduced by phosphorothioate (R / S) and GNA (R / S).

[0128] According to the above sequence modification principle, the siAR-Luo1 obtained in Example 1 was further modified, that is, the siRNA sequence containing modifications was synthesized with reference to the siRNA synthesis method in Example 1, and the special nucleotide monomers containing modifications can all be obtained commercially. The sequence of the modified siAR-Luo1 is shown in Table 5.

[0129] Table 5: siRNA sequences containing modifications

[0130]

[0131] (2) Serum enzymatic hydrolysis experiment

[0132] Under normal circumstances, the degradation rate of siRNA in the blood is relatively fast. According to the reference (doi: 10.1038 / mt.2009.91), in the blood, unmodified siRNA can be degraded within 1 minute. The effects of different modification schemes on the stability of siRNA were detected by the serum enzymatic hydrolysis experiment. Take multiple PCR tubes with a specification of 0.2 mL, add 800 ng of each modified siRNA and 1 μL of fetal bovine serum respectively, and make up to 10 μL with DEPC water, and place them at 37 °C for 0 h or 24 h to obtain serum enzymatic hydrolysis samples. The siRNA content in the serum enzymatic hydrolysis samples was detected by agarose gel electrophoresis, and the electrophoresis conditions were 140 V, 15 min.

[0133] After electrophoresis detection, clear bands were visible for siAR-1-mode1, siAR-1-mode2, siAR-1-mode3, and siAR-1-mode6 under both 0 h and 24 h conditions, indicating that the stabilities of siAR-1-mode1, siAR-1-mode2, siAR-1-mode3, and siAR-1-mode6 are relatively good. Among them, the stabilities of siAR-1-mode1 and siAR-1-mode2 are relatively better, and their electrophoresis results are as Figure 2 shown.

[0134] (3)Verification of the effect of modified siRNA on the expression level of AR mRNA in cells

[0135] HaCat cells were used to evaluate the knockdown effect of modified siRNA on AR mRNA, and the verification method can refer to Example 1. As can be seen from Figure 3 compared with the control group, the expression levels of AR mRNA corresponding to siAR-1-mode1, siAR-1-mode2, siAR-1-mode3, and siAR-1-mode6 were relatively low.

[0136] Example 4: Carrier-free delivery effect of siRNA modified with alkyl chain Cn

[0137] Adding alkyl chain modification to siRNA can effectively improve the lipophilicity of siRNA, achieve the effect of delivering siRNA into cells and successfully knocking down the target mRNA without other delivery carriers, and further reduce the adverse reactions caused by the delivery carrier. In this example, the effect of alkyl chain Cn on the delivery of siRNA into cells was investigated, taking n-hexadecyl (Cn, n = 16) in the alkyl chain as an example. siAR-1 selected in Example 3 was modified for the experiment. siAR-1-mode1a and siAR-1-mode1b were the experimental groups, and a control group without siRNA was set up, and no delivery carrier was used. The sequences are shown in Table 6 below. The Cn modification in siAR-1-mode1a was replaced with Cm modification; the same position in siAR-1-mode1b was Cn modification.

[0138] Table 6: siRNA names and their sequences

[0139]

[0140] Effect of siRNA Modified with Cn (n = 16) on the Expression Level of Cellular AR mRNA

[0141] HaCat cells were used to evaluate the knockdown effect of siRNA modified with Cn (n = 16) on AR mRNA, and the verification method can refer to Example 1. As can be seen from Figure 4 compared with the control group, under the conditions of 30 mM and 100 mM siRNA, the relative expression levels in the siAR-1-mode1a group were both greater than 0.6, and the relative expression levels of AR mRNA in the siAR-1-mode1b group were both less than 0.6. It can be seen that the Cn (n = 16) modification significantly improved the delivery performance of siRNA into cells. Therefore, carrier-free delivery of siRNA can be achieved by adding alkyl chain Cn modification, and the delivery effect is excellent.

[0142] Example 5: Carrier-free delivery effect of siRNA modified with alkyl chain Cn

[0143] In this example, by introducing alkyl chain Cn (n = 16 - 22) modification into the siRNA sequence, the effect of the number of carbon atoms in the alkyl chain on siRNA delivery was further investigated. The siRNA sequences containing Cn modification are shown in Table 7.

[0144] Table 7: siRNA sequences containing Cn modification

[0145]

[0146] Effect of siRNA Modified with Alkyl Chains Cn Containing Different Numbers of Carbon Atoms on the Expression Level of Cellular AR mRNA

[0147] The knockdown effect of siRNA on AR mRNA was verified using HaCat cells. The verification method can refer to Example 1. Figure 5 It can be seen that, compared with the control group, the relative expression levels of AR mRNA corresponding to the 4 siRNAs with Cn modification were all less than 0.6 under the concentration conditions of 30 mM and 100 nM. It can be seen that the siRNA after adding Cn modification can still effectively knockdown AR mRNA without carriers such as lipid nanoparticles. Therefore, the Cn conjugate of siRNA has good cell delivery effect.

[0148] Example 6: Delivery effect of siRNA with alkyl chain Cn modification at different regional sites

[0149] The antisense strand of siRNA can generally be divided into four regions: the seed region, the middle region, the supplementary region, and the 3'-tail region. Corresponding to the siAR-1 and its modified sequences provided by the present invention, the nucleotide sites corresponding to the four regions are the seed region (positions 4 - 10), the middle region (positions 11 - 14), the supplementary region (positions 15 - 19), and the 3'-tail region (positions 20 to the 3'-end); the above sites are all calculated in the 5'-3' direction.

[0150] In this example, one site in each of the above regions of the antisense strand was selected to insert Cn modification, or Cn modification was added at the corresponding complementary pairing sites of the sense strand, and the effect of the modification regional sites of the siRNA alkyl chain on siRNA delivery was further investigated. In particular, the combination of the siAR-1-mode1 sequence and Cn (n = 16) modification was used as an example for illustration; among them, the base complementary pairing sites of siAR-1-mode1 are located at positions 3 - 21 of the sense strand (positions 1 - 2 are hanging nucleotides), and positions 3 - 21 of the antisense strand (positions 1 - 2 are hanging nucleotides); the above sites are independently calculated in the 5'-3' direction of the sense strand or the antisense strand respectively. The siRNA sequences containing Cn (n = 16) modification at different sites are shown in Table 8.

[0151] Table 8: siRNA sequences containing Cn (n = 16) modification at different sites

[0152]

[0153] Effect of siRNA Modified with Alkyl Chains Cn at Different Sites on the Expression Level of AR mRNA in HaCat Cells

[0154] The knockdown effect of siRNA on AR mRNA was evaluated using HaCat cells, and the verification method can refer to Example 1. From Figure 6 It can be seen that all 8 modified siARs have good silencing effects on AR. Among them, except for siAR-1-mode16, the relative expression levels of AR mRNA corresponding to the other 7 siARs are less than 0.6, and the effect is prominent. After inserting Cn (n = 16) into different regions of the siAR sequence, carrier-free delivery of siRNA can be achieved, and good gene silencing effects can be realized.

[0155] Example 7: Effect of Modified siRNA on Hair Growth in Male Mice

[0156] A male mouse model was used to verify the effect of the modified siRNA (preferably siAR-1-mode1, hereinafter simply referred to as siAR) on mouse hair growth and the knockdown effect on AR mRNA. The delivery vector used was the LNP prepared in Example 2 (preferably LNP-001).

[0157] Construction of a male androgenetic alopecia mouse model (modeling): C57BL / 6 male mice aged 6 - 8 weeks with a body weight of 20 ± 2 g were selected. The back hair of each mouse was removed with depilatory cream, and 100 μL of dihydrotestosterone with a concentration of 10 mg / mL was subcutaneously injected at the depilated site. It was injected 5 days a week for three consecutive weeks, and the experiment lasted for 21 days. The experimental grouping is shown in Table 9 below.

[0158] For androgenetic alopecia mice, siAR was administered through the carriers of LNP or lip3000, denoted as LNP-siAR and lip3000-siAR. The injection method of LNP-siAR or lip3000-siAR was intradermal (i.d.) injection on days 0, 3, and 7, and the injection dose was 60 μg siRNA per mouse. The administration method of Minoxidil was topical application for 5 consecutive days per week. Among them, LNP-siAR was prepared according to the method of Example 2, and lip3000-siAR was prepared as follows: Add 10 μL of lip3000 and 50 μL of normal saline to tube A, add 50 μL of normal saline and 60 μg of siAR to tube B, and transfer all the liquid in tube B to tube A and mix well for standby.

[0159] The mice were sacrificed on the 21st day after hair removal. The skin of the mice was taken to detect the change in the expression level of AR mRNA, and serum samples were collected for later use. Another skin tissue sample (2×3 cm) was fixed with 4% paraformaldehyde solution for 24 h. After fixation, the skin tissue sample was dehydrated with ethanol of low concentration to high concentration (75% → 85% → 95% → absolute ethanol I → absolute ethanol II, 30 min each), and the tissue sample was treated with xylene twice, 10 min each time. The skin tissue treated with ethanol and xylene was embedded in paraffin blocks, and longitudinal and horizontal skin sections with a thickness of 5.0 μm were prepared.

[0160] The tissue sections were successively placed in xylene I for 30 min, xylene II for 30 min, absolute ethanol I for 5 min, absolute ethanol II for 5 min, 95% ethanol for 5 min, 85% ethanol for 5 min, and 75% ethanol for 5 min for dewaxing and hematoxylin & eosin (H&E) staining. The longitudinal sections were stained with Masson's trichrome staining to evaluate hair length, diameter, follicle density, ratio of growing / resting follicles, and the area of the hair bulb covered by melanin.

[0161] Table 9: Experimental grouping of male mice

[0162]

[0163] (1) Hair growth indicators

[0164] The changes in the phenotypes of the mice over time are as Figure 7 shown. On the 7th day after modeling, no obvious melanin patches or new villi appeared in all groups. The skin of the negative control group began to show a light gray color, indicating a trend of hair growth. On the 14th day after modeling, the negative control group grew hair normally, and new hair appeared in the lip3000-siAR group, indicating that knocking down the AR gene can effectively promote hair growth, and lip3000 can be effectively used for siRNA delivery to skin tissue. On the 21st day after modeling, the negative control group had vigorous hair growth, the Minoxidil group had obvious new hair, and the LNP-siAR group had vigorous and significantly better new hair than the Minoxidil group. It can be seen that knocking down the AR gene can effectively promote new hair growth, and LNP can also be effectively used for siRNA delivery to skin tissue.

[0165] The analysis results of the phenotypic data of the skin sections of the mice on the 21st day after modeling are as Figure 8 shown:

[0166] For hair length (hair length, Figure 8 , a), hair shaft diameter of the mice (hair shaft, Figure 8, b), length of hair follicle, Figure 8 , c), hair follicle density per view, Figure 8 , d), diameter of hair bulb, Figure 8 , e), anagen / telogen ratio, Figure 8 , f), melanin area in hair bulb, Figure 8 , g) For each of these indicators, the values in the DHT group were significantly lower than those in the negative control group, indicating that each indicator in the DHT group decreased significantly. While in the Minoxidil group and the three treatment groups, each indicator was significantly higher than that in the DHT group, indicating that the treatments with Minoxidil, LNP-siAR, lip3000-siAR, or lip3000-siAR and Minoxidil could significantly alleviate or reverse the effects on hair and hair follicles caused by DHT modeling. Among them Figure 8 , f indicates that the treatments with Minoxidil, LNP-siAR, lip3000-siAR, or lip3000-siAR and Minoxidil can effectively shorten the telogen phase of hair follicles and make them enter the anagen phase faster.

[0167] In the analysis of the above-mentioned multiple indicators, the Minoxidil group showed a similar efficacy to siAR, being close to or only slightly lower than the siAR treatment group in each indicator. Compared with the treatment with siAR alone, no obvious additive effect was observed in the lip3000-siAR + Minoxidil group. The results of this example suggest that the siRNA sequence siAR-1-mode1 has a significant promoting effect on hair growth.

[0168] (2) Expression level of androgen receptor mRNA in skin tissue

[0169] Mouse skin tissue RNA was extracted by the Trizol method, and the expression level of the target gene was detected by qPCR according to the kit instructions. The relative expression levels of each group relative to the negative control group are as Figure 9 shown. It can be seen that the expression level of AR mRNA in the DHT group was significantly higher than that in all treatment groups, and the AR mRNA expression levels in the Minoxidil group and all treatment groups decreased relative to the negative control group.

[0170] Example 8: Safety assessment of LNP-siAR

[0171] The expression levels of various factors TNF-α, TNF-γ, IL-1β, IL-6, CCL2, TGF-β and VEGF in the serum samples of the negative control group, DHT group and LNP-siAR group collected in Example 7 were detected by ELISA kits.

[0172] The expression levels of TNF-α, TNF-γ, IL-1β, IL-6, CCL2 and VEGF in the serum were relatively low, only at the pg level; the expression level of TGF-β was at the ng level. To better reflect the differences between the treatment group and the model group, the relative expression changes of various factors in the LNP-siAR group and DHT group relative to the negative control group were investigated in this example, and the results are as Figure 10 shown.

[0173] As Figure 10 can be seen, in the sera of the DHT group and the LNP-siAR group, the differences in the expression levels of TNF-α, TNF-γ, IL-1β, IL-6 and CCL2 were relatively small, while the differences in the expression levels of TGF-β and VEGF were relatively large. It may be due to the active role of TGF-β and VEGF in promoting hair growth in the LNP-siAR group, and their expression levels were significantly higher than those in the DHT group. Among them, TGF-β is involved in regulating cell division in hair follicles, activating hair follicle stem cells and proliferating, and stimulating hair growth; VEGF regulates angiogenesis, and the blood vessels around hair follicles provide the necessary nutrients for hair growth.

[0174] Example 9: Effects of Modified siRNA on Hair Growth in Female Mice

[0175] A female mouse model was used to verify the effects of modified siRNA (preferably siAR-1-mode1, the same as siAR in this example) on mouse hair growth and the knockdown effect on AR mRNA. The delivery vector used was the LNP prepared in Example 2 (preferably LNP-001).

[0176] Construction of a female androgenetic alopecia mouse model (modeling): C57BL / 6 female mice aged 6 - 8 weeks with a body weight of 20 ± 2 g were selected. The back hair of each mouse was removed with depilatory cream, and 100 μL of dihydrotestosterone with a concentration of 10 mg / mL was subcutaneously injected at the depilated site. It was injected 5 days a week for three consecutive weeks, and the experiment lasted for 21 days. The experimental grouping is shown in Table 10.

[0177] For androgenetic alopecia mice, the injection method of the drug, the administration method, the collection method and the treatment method of mouse skin were the same as those in Example 7.

[0178] Table 10: Experimental Grouping of Female Mice

[0179]

[0180] (1)Hair growth indicators

[0181] The changes in mouse phenotypes over time are as Figure 11 shown. On the 7th day after modeling, no obvious melanin patches or new villi appeared in all groups. On the 14th day after modeling, hair growth was obvious in the negative control group, and the skin of the Minoxidil group and the lip3000-siAR group began to show a light gray color, indicating a trend of hair growth. On the 21st day after modeling, obvious hair growth occurred in the Minoxidil, lip3000-siAR groups and the DHT group. The hair growth effect of the lip3000-siAR group was significantly better than that of the DHT group, indicating that for female mice, knocking down the AR gene can also effectively promote hair growth.

[0182] The analysis results of the phenotypic data of mouse skin sections on the 21st day after modeling are as Figure 12 shown:

[0183] For the hair length (hair length, Figure 12 , a), the hair shaft diameter of mice (hair shaft, Figure 12 , b), the hair follicle length (length of hair follicle, Figure 12 , c), the hair follicle density (hair follicle density per view, Figure 12 , d), the hair follicle diameter (diameter of hair bulb, Figure 12 , e), the ratio of the number of anagen / telogen hair follicles (anagen / telogen ratio, Figure 12 , f), and the area of the hair bulb covered by melanin (melanin area in hairbulb, Figure 12 , g) for each index, the values of the DHT group were significantly lower than those of the negative control group, indicating that each index in the DHT group decreased significantly, while each index in the Minoxidil group and the lip3000-siAR group was significantly higher than that of the DHT group, indicating that the treatment with Minoxidil or lip3000-siAR can significantly alleviate or reverse the effects on the hair and hair follicles of female mice caused by DHT modeling.

[0184] (2)Expression level of androgen receptor mRNA in skin tissue

[0185] The mRNA extraction method and detection method are the same as those in Example 7. The relative expression levels of each group relative to the negative control group are as Figure 13As shown, the AR mRNA expression level in the DHT group was significantly higher than that in the treatment group, and the AR mRNA expression levels in the Minoxidil group and the lip3000-siAR group decreased compared with the negative control group.

[0186] In summary, the present invention provides siRNA sequences targeting AR, as well as corresponding siRNA sequences containing modifications, which can effectively reduce the expression level of AR mRNA, thereby being used for treating diseases caused by abnormal androgen expression or treating diseases related to androgen receptors, and its indications include but are not limited to androgenetic alopecia, alopecia areata, telogen effluvium, cicatricial alopecia, diffuse alopecia, and acne. The present invention provides a variety of siRNA modification methods, and the stability of the modified sequences is enhanced and ARmRNA is effectively knocked down. The siRNA provided by the present invention can be efficiently delivered to the target through a delivery vector, or can be effectively delivered into cells without other delivery vectors by adding steroid or alkyl chain modifications to the sequence, and has been verified in cell experiments. Compared with existing small molecule drugs, the siRNA of the present invention has a longer drug efficacy duration, reduces the frequency of medication, and patients do not need to take medicine daily, effectively improving patient compliance.

Claims

1. A small nucleic acid targeting the androgen receptor, characterized in that, The small nucleic acid targeting androgen receptor comprises a sense strand and an antisense strand. The sense strand comprises the nucleotide sequence shown in SEQ ID NO: 1, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 2; the small nucleic acid targeting androgen receptor comprises one or more modifications; the sequence of the sense strand is t*t*AmUmUm(C16-c)CfAmGfUf GfGmAmUmGmGmGmCmUm*Gm*Am (SEQ ID NO: 13), and the sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um (SEQ ID NO: 14), wherein, u or U represents uridine nucleotide, G represents guanine nucleotide, c or C represents cytosine nucleotide, A represents adenine nucleotide, t represents thymidine nucleotide, m represents 2'-O-methyl modification, f represents 2'-fluoro modification, VP represents 5'-phosphorylation modification of ribose, * represents thiophosphorylation modification of a non-bridging oxygen atom of the α-position phosphate group of the nucleotide, and C16- represents 2'-O-hexadecyl modification.

2. A method for preparing the small nucleic acid targeting androgen receptor as claimed in claim 1, and the method is the phosphoramidite method.

3. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises a therapeutically effective amount of the small nucleic acid targeting androgen receptor as claimed in claim 1, and a pharmaceutically acceptable carrier.

4. The pharmaceutical composition according to claim 3, wherein The carrier is a lipid nanoparticle or an exosome.

5. The pharmaceutical composition according to claim 4, wherein The lipid nanoparticle is composed of an aqueous phase and an organic phase, and the volume ratio of the aqueous phase to the organic phase is 10:1 to 1:

10.

6. The pharmaceutical composition according to claim 5, wherein The organic phase consists of cationic lipid, co-lipid, steroid, and PEG-lipid. Among them, the molar ratio of cationic lipid, co-lipid, steroid, and PEG-lipid is 40-60:3-20:25-55:0.1-10. The cationic lipid is selected from one or more of dimethyldilinoleylammonium butyrate (Dlin-M-C3-DMA), 9A1P9, trimethyl-2,3-dioleyloxypropylammonium chloride (DOTAP), trimethyl-2,3-dioleoyloxypropylammonium bromide (DTOPA), dimethyl-2,3-dioleyloxypropyl-2-(2-sperminecarboxamido)ethylammonium trifluoroacetate (DOSPA), dioleoylpropyltrimethylammonium chloride (DOTMA), C12-200, ATX-100, 98N 12 -5, FTT5, heptadec-9-yl 8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), ((4-hydroxybutyl)azaalkanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), bis((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (Lipid-319), bis(2-butyl octyl) 10-(1-(3-(dimethylamino)propyl)-3-octylureido)nonadecanoate (OT13), Dlin-KC2-DMA, Lipid 29, heptadec-9-yl 8-((2-hydroxyethyl)(8-(nonoxy)octan-8-yl)amino)octanoate) (Lipid5), Lipid A6, YSK12-C4, and CL4H6; the co-lipid is selected from one or more of 1,2-distearoyl-sn-glycero-3-phosphocholine (1,2-DSPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), and dioleoylphosphatidylethanolamine (DOPE); the steroid lipid is selected from phytosterol or cholesterol; the PEG-lipid is selected from one or more of 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG2000), DPG-PEG 2000, polyethylene glycol-distearoylphosphatidylethanolamine (PEG2000-DSPE), distearoyl-rac-glycero-polyethylene glycol 2000 (DSG-PEG 2000), and methoxypolyethylene glycol ditetradecylacetamide (ALC-0159).

7. A method for preparing a pharmaceutical composition according to any one of claims 3-6, characterized in that, The method comprises adding the small nucleic acid targeting androgen receptor as claimed in claim 1, and a pharmaceutically acceptable excipient into a solvent.

8. Use of the small nucleic acid targeting androgen receptor as claimed in claim 1 or the pharmaceutical composition as claimed in any one of claims 3-6 in the preparation of a medicament for treating a disease related to abnormal androgen expression, and the disease is androgenetic alopecia.

Images