An ultrahigh dose loaded compressed nucleic acid DNA drug delivery platform, preparation method and application thereof
By forming an ultracompressed spherical flower-shaped DNA drug delivery platform (scudDNA), the problems of easy degradation and side effects of nucleic acid drugs have been solved, achieving efficient nucleic acid drug loading and targeted release, enhancing immune response, significantly inhibiting tumor growth and treating inflammation.
Patent Information
- Application Number
- CN202410199744.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2023-11-27
- Filing Date
- 2024-02-23
- Publication Date
- 2026-07-24
- Estimated Expiration
- 2044-02-23
Smart Images

Figure CN120041544B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to a drug delivery platform, specifically a DNA drug delivery platform for ultra-high dose loading compressed nucleic acid, its preparation method, and its application. Background Technology
[0002] Currently, nucleic acids (DNA or RNA) are used as drugs in gene therapy or immunotherapy due to their unique advantages, and are widely used in cancer treatment, genetic diseases, and prevention of infectious diseases. For example, in the field of cancer treatment, DNA drugs composed of non-coding, unmethylated cytosine-phosphate-guanine oligodeoxynucleotides (CpG ODNs) can be recognized by Toll-like receptor 9 (TLR9) in the endosomes of antigen-presenting cells (APCs), inducing cellular and humoral immunity and enhancing the body's immune response. This has become a very promising type of nucleic acid drug.
[0003] To date, more than a dozen CpG ODNs-based DNA drugs have entered human clinical trials as vaccine adjuvants, anti-allergens, and cancer immunotherapy agents. However, all nucleic acid-based therapies (including CpG ODNs) are chemically unstable under physiological conditions, easily digested by nucleases in the body, leading to rapid degradation. This severely limits their potency in vivo and greatly hinders their clinical translation and application.
[0004] Currently, in CpG-mediated immunotherapy, to mitigate degradation issues, the traditional phosphodiester backbone of natural DNA is replaced with thiophosphate bonds. Since the thiophosphate backbone is not a substrate for nucleases, it can resist nuclease degradation. However, thiophosphate-modified DNA can only be obtained through de novo chemical synthesis, its length is limited to around 100 bases, and the synthesis cost is high. More importantly, unlike natural DNA, thiophosphate-modified CpG drugs are not natural substrates for any metabolic pathway, exhibiting significant in vivo toxicity. Repeated injections of high doses of thiophosphate-modified CpG can trigger acute toxicity, causing dose-dependent splenomegaly, kidney damage, and other immune-related toxicities, even death.
[0005] Nucleic acids (DNA / RNA), as the endogenous genetic material that makes up living organisms, are also polymeric materials. They possess excellent biocompatibility, precise molecular manipulation, and sequence programmability. Through on-demand design of their base sequences, they can be precisely functionalized, efficiently achieving drug delivery and intelligent responsive controlled release, making them ideal drug carriers. Over the past few decades, targeted therapies based on nucleic acid materials (DNA hydrogels, DNA tetrahedra, globular nucleic acids, etc.) have been developed for research and exploration of diseases such as cancer, attracting widespread attention. The precise programmability and endogenous nature of nucleic acids give them significant advantages as drug carriers, demonstrating enormous clinical application value. Summary of the Invention
[0006] To address the aforementioned technical problems in the prior art, this invention provides a DNA drug delivery platform for ultra-high dose compressed nucleic acid, its preparation method, and its application. This ultra-high dose compressed nucleic acid DNA drug delivery platform, preparation method, and its application aim to solve the technical problems of low nucleic acid drug loading efficiency, significant side effects, easy degradation, and easy cytotoxicity in the prior art.
[0007] This invention provides a method for preparing a DNA drug delivery platform with ultra-high dose loading and compressed nucleic acid, comprising the following steps:
[0008] 1) Select the CpG type according to the disease type, mix the DNA template with 5' phosphorylated and containing CpG sequence with the first primer solution, add 10×T4 ligase buffer, and Milli-Q ultrapure water to form a circularization system, and perform heating annealing in a PCR instrument.
[0009] 2) Add T4 DNA ligase solution to step 1), react overnight at 4°C, and after the reaction is complete, inactivate the ligase to obtain a circular DNA template.
[0010] 3) Add phi29 DNA polymerase, 10×phi29 buffer, and a mixed solution of dATP, dTTP, dCTP, and dGTP to the circular DNA template. Mix them with Milli-Q to form the reaction solution. Place the reaction solution in a constant temperature mixer and react at 37°C.
[0011] 4) Then, design the second and third primers based on the sequence of the circular DNA template, and apply them to step 3).
[0012] The second and third primers were added to the reaction solution, and the reaction was carried out at 37°C to form a DNA drug delivery platform. After the reaction was completed, the polymerase was inactivated to terminate the reaction.
[0013] In step 1), the temperature program for amplification in the PCR instrument is 95℃ for 2 minutes, followed by a decrease of 1℃ every 1 minute, and 91 cycles to reach 4℃.
[0014] The concentration of the DNA template in step 1) is 500 nM, and the concentration of primer 1 is 500 nM.
[0015] The concentration of T4 DNA ligase in step 2) is 10 U / μL.
[0016] The concentration of phi29 DNA polymerase in step 3) is 0.1 U / μL.
[0017] The concentrations of primers 2 and 3 in step 4) are 50 μM.
[0018] The DNA template sequence is:
[0019] 5'-phosphateTAGTTTTCCATGACGTTCCTGACGTTAAGCAGTATTATGAACTCTCCATGAGCTTCCTGAGCTTGATGTTCCTAACCTACCA.
[0020] The first primer sequence is: 5'-GTCATGGAAAACTATGGTAGGTTAGGAAC.
[0021] The second primer sequence is: 5'-AAGCAGTATTATGAACTC.
[0022] The third primer sequence is: 5'-TGGTAGGTTAGGAACATC.
[0023] The present invention also provides a DNA drug delivery platform obtained by the above method.
[0024] The present invention also provides the application of the above-mentioned DNA drug delivery platform in the preparation of drugs for treating cancer or inflammation.
[0025] Furthermore, the cancer in question is triple-negative breast cancer.
[0026] The present invention also provides the use of the above-described DNA drug delivery platform as a drug carrier.
[0027] This invention discloses a DNA drug delivery platform for ultra-high dose compressed nucleic acid (Super-condensed ultra-high dose DNA, named scudDNA), composed of ultra-long DNA chains. These ultra-long DNA chains are formed through rolling circle amplification (RCA) and multi-primed chain amplification (MCA). The long DNA drug chains formed by RCA and MCA amplification are then physically wrapped and self-condensed and super-compressed under the action of magnesium pyrophosphate generated in situ, forming dense scudDNA with a particle size of 100 nm to 2.5 μm, exhibiting a spherical, flower-like shape. This platform can carry any type of nucleic acid drug, such as CpG, siRNA, and ASO.
[0028] Compared with existing technologies, the technological advancements of this invention are significant. The scudDNA of this invention innovatively ultra-concentrates millions of copies (dosages) of CpG motifs into a single nanodrug, with a compression degree similar to that of DNA super-compressed by histones on three chromosomes. By optimizing reaction conditions, the size of the scudDNA can be precisely controlled, achieving precise control over the number of DNA drugs loaded. scudDNA is an immune cell-targeted self-release system that does not cause any measurable toxicity. It can induce enhanced or weakened macrophage immune responses in vitro and significantly inhibit tumor growth or treat inflammatory diseases in vivo. The scudDNA platform can load ultra-high doses of any combination of different CpG motifs, or any therapeutic nucleic acid drug, providing a universal delivery platform for all nucleic acid-based drug therapies. Attached Figure Description
[0029] Figure 1 This is a polyacrylamide gel electrophoresis characterization of the circular template and the rolling circle amplification product.
[0030] Figure 2 This is a scanning electron microscope (SEM) characterization of scudDNA.
[0031] Figure 3 This is a characterization diagram of RAW264.7 cells uptake of scudDNA observed by confocal fluorescence microscopy;
[0032] Figure 4 These are scanning electron microscope images of scudDNA released in different pH buffers.
[0033] Figure 5 The scanning electron microscopy characterization of scudDNA incubated in pH 7.4 and pH 4.0 buffer solutions.
[0034] Figure 6The concentrations of inflammatory cytokines TNF-α and IL-6 in macrophages were measured by ELISA after scudDNA stimulation.
[0035] Figure 7 It is scudDNA +CpG A graph showing the inhibition of tumor proliferation in mice with triple-negative breast cancer. Detailed Implementation
[0036] The present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are performed according to conventional methods and conditions, or as selected according to the product instructions.
[0037] Example 1: Synthesis and Characterization of Circular DNA Templates
[0038] Synthesis: For triple-negative breast cancer, a DNA template and primer 1 were designed (see Table 1). First, 2.5 μL of 10 μM phosphorylated single-stranded DNA template solution, 2.5 μL of 10 μM primer 1 solution, 5 μL of 10×T4 ligase buffer, and 40 μL of LiMilli-Q ultrapure water were mixed to form a 50 μL circularization system. The circularization system was then placed in a PCR instrument and the temperature program was followed: 95 °C for 2 min, followed by a 1 °C decrease every 1 min, for 91 cycles until reaching 4 °C.
[0039] Then, 1.25 μL of 400 U / μL T4 DNA ligase solution and 1.25 μL of 50 mM ATP solution were added to a 50 μL circularization system, and the reaction was carried out overnight at 4 °C. After the reaction was completed, the ligase was inactivated at 65 °C for 10 min, and circular DNA (cirDNA) was finally obtained and stored at 4 °C for later use.
[0040] Next, 5 μL of cir DNA, 5 μL of 10×Phi29 buffer, 6 μL of 100 mM dNTP mix (1.25 μL each of dATP, dTTP, dCTP, and dGTP), 1 μL of 100 mM DTT, 0.5 μL of 10 U / μL Phi29 DNA polymerase, and 33.5 μL of LiMilli-Q were mixed to form a 50 μL reaction solution. The reaction solution was placed in a thermostat and incubated at 37°C for 4 h for RCA amplification.
[0041] The DNA template and primer 1 are listed in DNAID NO:1 to DNAID NO:2, respectively.
[0042] Characterization: Successful formation of circDNA and RCA products was demonstrated by 8% polyacrylamide gel electrophoresis (PAGE) based on the different positions of bands containing DNA of different molecular weights in the gel. Figure 1 As shown, after circDNA is formed, the band shifts backward, while after RCA product is formed, the band remains in the well.
[0043] Table 1 shows the DNA sequences involved in the examples.
[0044]
[0045]
[0046] Example 2: Synthesis and Characterization of the Final Product scudDNA
[0047] Synthesis: DNA primers 2 and 3 were designed based on the sequence of the circular template. Then, 50 μM of primers 2 and 3 were added to the RCA product, and the mixture was incubated at 37°C for 16 h to form scudDNA. After the reaction was complete, the polymerase was inactivated at 65°C for 10 min to terminate the reaction.
[0048] Characterization: The reaction solution was centrifuged at 10,000 rpm for 5 min, and the lower precipitate was retained. After washing three times with Milli-Q, the precipitate was dispersed in Milli-Q solution and stored at 4°C. The morphology and size of the scudDNA were characterized using scanning electron microscopy (SEM). Figure 2 As shown, scudDNA is spherical and flower-like, with a size of about 1.3 μm.
[0049] Table 2 shows the DNA sequences involved in the examples.
[0050] Primer 2 5'-AAGCAGTATTATGAACTC SEQ ID NO:3 Primer 3 5'-TGGTAGGTTAGGAACATC SEQ ID NO:4
[0051] Example 3: Observation of ScudDNA uptake behavior in macrophages (Raw 264.7 cells)
[0052] Raw264.7 cells were cultured in 400 μL LMEM medium containing 10% fetal bovine serum. Culture conditions were: 37°C, 5% CO2, and saturated humidity. Raw264.7 cells were sputtered at a rate of 1.7 × 10⁻⁶ cells / mL. 5Cells were seeded at a density of cells / well in 4-well slides (ThermoFisher Scientific) and allowed to adhere overnight. Cy3-labeled (red fluorescent) scudDNA (0.75 g) was added to each well, and cells were incubated at 37°C or 4°C for 8 h. Cells were then washed three times with 500 μL PBS and fixed for 15 min with PBS containing 4% paraformaldehyde. After incubation for 4 min in PBS containing 0.1% Triton-X-100, cells were stained with Alexa-488 phalloidin (Life Technologies) to stain filamentous actin on the cell membrane. The slides were then incubated with DAPI to stain the nuclei. After sealing the slides with nail polish, imaging was performed using an LSM710 confocal microscope (Carl Zeiss).
[0053] Results: After 8 hours of incubation, the fluorescence intensity of ScudDNA in cells was significantly increased when incubated at 37°C compared to incubation at 4°C. Cellular confocal fluorescence microscopy imaging is shown below. Figure 3 .
[0054] Example 4 Release of scudDNA in different pH buffers
[0055] scudDNA was incubated at 37°C for 2 hours in 100 mM PBS buffer at pH 7.4, 6.5, and 6.0, or in 100 mM sodium acetate buffer at pH 5.5, 5.0, 4.5, and 4.0. The remaining scudDNA was collected after centrifugation. The released DNA was quantified by measuring the absorbance of the supernatant at 260 nm. Furthermore, scudDNA incubated in pH 7.4 and pH 4.0 buffers was characterized using SEM imaging.
[0056] Results: As the solution acidified, DNA was gradually released from the scudDNA. The low pH dissolved the magnesium pyrophosphate in the scudDNA, exposing the therapeutic CpG motif. Absorbance results under different pH buffers are shown below. Figure 4 SEM characterization results after incubation in pH 7.4 and pH 4.0 buffer solutions are shown in [the table below]. Figure 5 .
[0057] Example 5: Evaluation of the in vitro immunostimulatory effect of scudDNA
[0058] Mouse macrophage Raw264.7 cells were grown at a rate of 1.6 × 10⁻⁶. 5 Cells were seeded at a density of [number] cells / well in 48-well cell culture plates and allowed to adhere overnight. scudDNA (named scudDNA) loaded with different concentrations of CpG was then added. +CpGMacrophages were treated for 8 hours and 24 hours, respectively, as the experimental group. The control group consisted of an uncompressed short-chain CpG sequence, named shortDNA. +CpG The concentrations of TNF-α and IL-6 in the cell supernatant were determined using ELISA.
[0059] Result: As Figure 6 As shown, the concentrations of TNF-α and IL-6 increased with the increase of the number of CpG loaded on scudDNA, indicating that scudDNA can successfully stimulate and regulate the immune response.
[0060] Example 6: Validation of the therapeutic effect of scudDNA on breast cancer mice
[0061] A breast cancer animal model was established using 6-8 week old BALB / c female mice. Hair was removed from the area near the third pair of mammary glands on the right side of the mice using depilatory cream, and the shed hair and remaining cream were wiped away with a moistened cotton ball. The outer skin of the appendages of the third pair of mammary glands was cut open with surgical scissors, and 4T1 cells (5 × 10⁻⁶) were introduced. 5 (Each mouse) was inoculated into the fat pad of the third pair of mammary glands on the right side. The day of tumor inoculation was recorded as day 0. BALB / c tumor-bearing mice were randomly divided into 4 groups of 5 mice each. Tumors were inoculated until they reached 80 mm in size. 3 The following preparations were administered at the time: PBS, control scudDNA. -CpG control shortDNA +CpG and scudDNA +CpG scudDNA +CpG As a positive control group, the mice were administered the drug twice a week for a total of five times, and the size of the tumors was observed.
[0062] Result: As Figure 7 As shown, compared with the control group tumors, scudDNA +CpG The tumors in the treated mice were significantly smaller, indicating that the proliferation of orthotopic tumors in BALB / c mice was inhibited by scudDNA. +CpG Effectively suppress.
[0063] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of the invention. Various variations can be made to the above embodiments of the present invention. That is, all simple and equivalent changes and modifications made in accordance with the claims and description of the present invention fall within the protection scope of the claims of the present invention. All aspects not described in detail in this invention are conventional technical content.
Claims
1. The application of an ultra-high dose DNA drug delivery platform loaded with compressed nucleic acid in the preparation of drugs for treating triple-negative breast cancer, wherein the preparation method of the ultra-high dose DNA drug delivery platform loaded with compressed nucleic acid includes the following steps: 1) Select the CpG type according to the disease type, mix the DNA template with 5' phosphorylated and containing CpG sequence with the first primer solution, add 10×T4 ligase buffer, and mix with Milli-Q ultrapure water to form a circularization system, and heat and anneal in the PCR instrument. The sequence of the DNA template is: 5'-phosphateTAGTTTTCCATGACGTTCCTGACGTTAAGCAGTATTATGAACTCTCCATGAGCTTCCTGAGCTTGATGTTCCTAACCTACCA; The sequence of the first primer is: 5'-GTCATGGAAAACTATGGTAGGTTAGGAAC; 2) Add T4 DNA ligase solution to step 1), react overnight at 4 °C, and after the reaction is complete, inactivate the ligase to obtain a circular DNA template. 3) Add phi29 DNA polymerase, 10×phi29 buffer, and a mixed solution of dATP, dTTP, dCTP, and dGTP to the circular DNA template. Mix them with Milli-Q to form the reaction solution. Place the reaction solution in a constant temperature mixer and react at 37°C. 4) Then, design the second and third primers based on the sequence of the circular DNA template. The sequence of the second primer is: 5'-AAGCAGTATTATGAACTC; The third primer sequence is: 5'-TGGTAGGTTAGGAACATC; 5) Add the second and third primers to the reaction solution in step 3), and react at a constant temperature of 37°C to form a DNA drug delivery platform; after the reaction is completed, inactivate the polymerase to terminate the reaction; 6) Centrifuge the reaction solution at 10,000 rpm, retain the lower precipitate, wash it with Milli-Q, disperse it in Milli-Q solution, and store it at 4°C.
2. The application according to claim 1, characterized in that: In step 1), the temperature program for heating and annealing in the PCR instrument is 95°C for 2 min, followed by a decrease of 1°C every 1 min, for 91 cycles to reach 4°C. The concentration of the DNA template in step 1) is 500 nM, and the concentration of the first primer is 500 nM; The concentration of T4 DNA ligase in step 2) is 10 U / μL; The concentration of phi29 DNA polymerase in step 3) is 0.1 U / μL; In step 4), the concentrations of the second and third primers are 50 μM.