Molecular marker of wheat ta hox9-1a regulating storage protein content and yield and application
By detecting the SNP polymorphism of TaHOX9-1A in the wheat genome and using KASP marker technology for genotyping, the problem of identifying wheat storage protein content and yield was solved, achieving efficient and accurate wheat breeding and cultivating high-yield and high-quality varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
- Filing Date
- 2025-03-05
- Publication Date
- 2026-06-16
AI Technical Summary
Existing technologies are insufficient to effectively identify or assist in the identification of wheat storage protein content and yield, thus affecting the effectiveness of wheat breeding.
By detecting polymorphisms or genotypes at specific SNP sites in the wheat genome, especially haplotypes TaHOX9-1A-Hap1 and TaHOX9-1A-Hap2, genotyping is performed using KASP molecular marker technology, combined with a fluorescence detection system, to achieve efficient identification of storage protein content and yield.
It enables high-throughput, low-cost, and automated identification of stored protein content and yield, improving the accuracy and efficiency of wheat breeding and enabling the cultivation of high-yielding, stable-yielding, weak-gluten, and high-quality wheat varieties.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology, specifically relating to wheat. TaHOX9-1A Molecular markers for regulating the content and yield of storage proteins and their applications. Background Technology
[0002] Wheat is one of the world's most important staple crops, with approximately 35% of the world's population relying on it as their primary food source. my country ranks first in the world in terms of wheat planting area, total production, and consumption. The content and composition of storage protein in wheat grains are crucial indicators determining the processing and nutritional quality of wheat, primarily including glutenin and prolamins. Glutenin is divided into low molecular weight glutenin subunits (LMW-GS) and high molecular weight glutenin subunits (HMW-GS). HMW-GS consists of... Glu-1 Genetic coding determines the strength and elasticity of dough.
[0003] Previously, a transcription factor, TaHOX9, was identified that binds to the promoter of the high molecular weight glutenin subunit. This invention, through... TaHOX9 Haplotype and genetic effect analyses were performed to identify TaHOX9 Superior haplotypes and the development of molecular markers usable for breeding provide molecular tools for breeding high-yielding and high-quality wheat varieties. Summary of the Invention
[0004] The main problem to be solved by this invention is to identify or assist in the identification of wheat storage protein content and / or yield.
[0005] To address the aforementioned problems, this invention provides the application of a substance for detecting polymorphisms, genotypes, or haplotypes at SNP sites in the wheat genome in any of the following:
[0006] (1) To identify or assist in the identification of wheat storage protein content and yield;
[0007] (2) Wheat breeding;
[0008] (3) Prepare products for identification or auxiliary identification of wheat storage protein content and yield;
[0009] (4) Prepare products for wheat breeding;
[0010] The SNP site is a SNP site on wheat chromosome 1A, and its nucleotide type is A or G, which is the 71st nucleotide of sequence 4 in the sequence listing.
[0011] The haplotype is the haplotype described above. TaHOX9-1A - Hap1 and haplotype TaHOX9-1A - Hap2 .
[0012] The haplotypeTaHOX9-1A - Hap1 The allelic variations at positions 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993, and 279744233 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are G, A, C, A, A, T, G, A, C, T, C, C, C, and G, respectively.
[0013] The haplotype TaHOX9-1A - Hap2 The allelic variations at positions 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993, and 279744233 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are C, G, T, G, G, G, C, G, T, C, T, T, T, and A, respectively.
[0014] This invention also provides a method for identifying or assisting in the identification of wheat storage protein content and yield, including method A or B:
[0015] A) Detect the genotype of the SNP site in the wheat genome to be tested, and identify or assist in the identification of wheat storage protein content and yield based on the genotype. The SNP site is a SNP site on wheat chromosome 1A, and its nucleotide type is G or A, which is the 71st nucleotide of sequence 4 in the sequence listing.
[0016] B) Detect haplotypes in the wheat genome to be tested, and identify or assist in identifying wheat storage protein content and yield based on the haplotypes. The haplotypes are defined as haplotypes. TaHOX9-1A - Hap1 and haplotype TaHOX9-1A - Hap2 The haplotype is TaHOX9-1A - Hap1 The storage protein content of wheat varieties is lower than that of the haplotype. TaHOX9-1A - Hap2 wheat varieties; the haplotype is TaHOX9-1A - Hap1 Wheat varieties with higher yields than haplotypesTaHOX9-1A - Hap2 Wheat varieties;
[0017] The present invention also provides a method for wheat breeding, including method M1 or M2).
[0018] M1) Detect the genotype or haplotype of the SNP locus mentioned above in the wheat genome, and select wheat with the genotype GG at the SNP locus as the parent for breeding, wherein GG is the homozygous type of the SNP locus with G.
[0019] M2) Detect the haplotypes described above in the wheat genome and select the haplotypes. TaHOX9-1A-Hap1 Wheat was used as a parent in breeding, and the haplotype TaHOX9-1A-Hap1 The allelic variations at positions 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993, and 279744233 in the Chinese spring wheat reference genome sequence RefSeqv1.0 are G, A, C, A, A, T, G, A, C, T, C, C, C, and G, respectively.
[0020] This invention also provides the application of the methods described above in wheat breeding.
[0021] In this article, the breeding objectives may include developing high-yielding, stable-yielding, weak-gluten, high-quality wheat. The wheat may be a pure-line variety or an inbred line.
[0022] As an implementation method, wheat breeding methods may include the following steps:
[0023] (1) Using the genomic DNA of the wheat to be tested as a template, KASP molecular marker detection was performed using a primer combination;
[0024] (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP site in the wheat to be tested;
[0025] (3) Select GG genotype wheat for breeding high-yield, stable-yield, weak-gluten, and high-quality wheat.
[0026] In the above method, the KASP reaction system can be: 2.0 μL KASP 2×Master Mix (LGC, catalog number: 13448166), 0.048 μL KASP primers (3 primers mixed, with a total concentration of 50 μM, of which the molar ratio of two forward primers and one reverse primer is 2:2:5), and 2.0 μL template DNA (50 ng / μL).
[0027] The reaction program for KASP labeling can be as follows: pre-denaturation at 94℃ for 15 min; denaturation at 94℃ for 20 s, 61℃-55℃ (using the touch-down program, decreasing by 0.6℃ per cycle) for 1 min, amplification for 10 cycles; denaturation at 94℃ for 20 s, 55℃ for 1 min, and continued amplification for 31 cycles.
[0028] The method described above for determining the genotype of the SNP in the wheat sample is as follows: After the PCR reaction, a fluorescence signal reader (Omega) and a fluorescence detection system (Araya) are used to convert the fluorescence signal into analyzable values to read the fluorescence data of the reaction products. Genotyping is performed by reading the fluorescence values at the terminal ends. G-type samples exhibit FAM fluorescence, distributed near the x-axis; A-type samples exhibit HEX fluorescence, distributed near the y-axis; samples with no detected signal are distributed near the origin.
[0029] In the above methods or applications, the genotype of the SNP locus is GG or AA, where GG is the homozygous type of the SNP locus being G, and AA is the homozygous type of the SNP locus being A; the storage protein content of the wheat sample with the genotype GG at the SNP locus is lower than that of the wheat sample with the genotype AA at the SNP locus; and the yield of the wheat sample with the genotype GG at the SNP locus is higher than that of the wheat sample with the genotype AA at the SNP locus.
[0030] The present invention also provides products containing any of the substances described in the foregoing applications:
[0031] C1) Products that detect single nucleotide polymorphisms or genotypes related to wheat storage protein content and yield;
[0032] C2) Products used to identify or assist in identifying the content and yield of stored wheat protein;
[0033] C3) Products used in wheat breeding.
[0034] In the above applications, methods, and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.
[0035] In the above applications or products, the substance may be D1), D2), or D3).
[0036] D1) The substance is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites;
[0037] D2) The substance is a PCR reagent containing the primer composition described in D1);
[0038] D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).
[0039] In the above applications, methods, and products, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading).
[0040] In the above applications or products, the primer composition consists of primer F1, primer F2 and primer R;
[0041] The primer F1 is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence listing or a single-stranded DNA molecule whose nucleotide sequence is positions 22-39 of sequence 1 in the sequence listing;
[0042] The primer F2 is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or a single-stranded DNA molecule whose nucleotide sequence is positions 22-39 of sequence 2 in the sequence listing;
[0043] The primer R nucleotide sequence is a single-stranded DNA molecule of sequence 3 in the sequence listing.
[0044] The present invention also provides a DNA molecule whose nucleotide sequence is sequence 4 in the sequence listing.
[0045] The present invention also provides the use of the above-described DNA molecule in any of the following:
[0046] (1) To identify or assist in the identification of wheat storage protein content and yield;
[0047] (2) Wheat breeding;
[0048] (3) Prepare products for identification or auxiliary identification of wheat storage protein content and yield;
[0049] (4) Prepare wheat breeding products.
[0050] Compared with existing technologies (such as SSR (simple repeat sequence) markers and TaqMan probe technology), the KASP marker developed in this invention has the following advantages: 1) High throughput: suitable for large-scale sample detection; 2) High specificity: allele-specific primers ensure high accuracy; 3) Automation: automated fluorescence detection and analysis reduce human error; 4) Fast and efficient: simple and efficient process from DNA extraction to result analysis; 5) Low cost: KASP does not require special probes and its cost is lower than TaqMan. Attached Figure Description
[0051] Figure 1 For wheat TaHOX9-1A Gene mutation sites and haplotype typing results.
[0052] Figure 2 To utilize KASP tags K-1A-SNP14 Wheat varieties in the Huang-Huai wheat region TaHOX9-1A The results of genotyping.
[0053] Figure 3 To utilize KASP tags K-1A-SNP1 and K-1A-SNP8 Wheat varieties in the Huang-Huai wheat region TaHOX9-1A The results of genotyping. Detailed Implementation
[0054] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0055] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0056] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.
[0057] The 142 natural populations from the Huang-Huai wheat region in the following examples have been documented in: Li J, Xie L, Tian X, Liu S, Xu D, Jin H, Song J, Dong Y, Zhao D, Li G, Li Y, Zhang Y, Zhang Y, Xia X, He Z, Cao S. (2021) TaNAC100 acts as an integrator of seed protein and starch synthesis exerting pleiotropic effects on agronomic traits in wheat. Plant Journal 108(3):829-840. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.
[0058] The following examples use Excel statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The t-test is performed using the T-TEST model. P < 0.05 (*) indicates that there is a significant difference.
[0059] Example 1, Wheat TaHOX9-1A Identification of gene polymorphism sites and haplotypes
[0060] transcription factor-encoding genes TaHOX9-1A wheat genome ID ( TraesCS1A02G157500Input the wheat genome variation database (Wheat-SnpHub-Portal, http: / / wheat.cau.edu.cn / Wheat_SnpHub_Portal / ), select 188 varieties (MP group and NC-CC group) from the database, retrieve the variation information of the gene upstream and downstream 2 Kb and the gene open reading frame, and find a total of 14 variation sites, which are denoted as SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11, SNP12, SNP13 and SNP14. Figure 1 The 14 variant sites in the Chinese spring wheat reference genome sequence RefSeq v1.0 are 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993, and 279744233. These gene-linked variants form two haplotypes. TaHOX9-1A-Hap1 and TaHOX9-1A-Hap2 ( Figure 1 ).
[0061] TaHOX9-1A-Hap1 The allelic variations at positions 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993, and 279744233 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are G, A, C, A, A, T, G, A, C, T, C, C, C, and G, respectively.
[0062] TaHOX9-1A-Hap2The allelic variations at positions 279730261, 279730400, 279730467, 279731039, 279731225, 279731334, 279740904, 279741477, 279743274, 279743377, 279743630, 279743842, 279743993, and 279744233 in the Chinese spring wheat reference genome sequence RefSeq v1.0 are C, G, T, G, G, G, C, G, T, C, T, T, T, and A, respectively.
[0063] Example 2, Identification TaHOX9-1A Development of molecular markers for haplotypes and their specific primer sets
[0064] This invention utilizes Polymarker (https: / / www.polymarker.info / ) to design a set of markers suitable for KASP identification of wheat at SNP14 on wheat chromosome 1A (position 279744233 in the Chinese spring wheat reference genome sequence RefSeq v1.0). TaHOX9-1A haplotype primer set K-1A-SNP14 The primer sequence specificity was evaluated using WheatOmics (http: / / 202.194.139.32 / ).
[0065] The KASP primer set consists of forward primers F1 and F2 and reverse primer R.
[0066] Forward primer F1:
[0067] 5'- GAAGGTGACCAAGTTCATGCT AGAGATGGGCTGCTCCGC-3' (SEQ ID No: 1);
[0068] (The underlined part is the FAM fluorescent probe-specific recognition sequence)
[0069] Forward primer F2:
[0070] 5'- GAAGGTCGGAGTCAACGGATT AGAGATGGGCTGCTCCGT-3' (SEQ ID No: 2);
[0071] (The underlined part is the HEX fluorescent probe-specific recognition sequence);
[0072] Reverse primer R:
[0073] 5'-CTCCGACCGAGCTCACTTAC-3' (SEQ ID No: 3).
[0074] K-1A-SNP14 The nucleotide at position 71 from the 5' end of SEQ ID No:4 in the wheat genome (corresponding to the complementary base of the last base at the 3' end of the two forward primers) is either G or A. In SEQ ID No:4, r represents G or A.
[0075] SEQ ID No:4:
[0076] 5'-TCGTTCGGGCTTGCCTTTCTCATCTTCATCCAATCTGCTCCGACCGAGCTCACTTACCCGGTCGTGGATTrCGGAGCAGCCCATCTCTCAGTTTCTCATTGAAGGCTCGAACTGTTGTCAAACTTTCTCTGCCCAGGAAAA-3'.
[0077] The above-mentioned SEQ ID No:1, SEQ ID No:2 and SEQ ID No:3 nucleic acid sequences are antisense DNA sequences, and the SEQ ID No:4 nucleic acid sequence is a sense DNA sequence.
[0078] Primer F1 is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end. When combined with primer R, it amplifies the fragment with "G" nucleotides at the SNP14 site. The fluorescent signal of the FAM group can be read using an ELISA reader or a real-time PCR instrument.
[0079] Primer F2 is a primer with a HEX fluorescent tag sequence (underlined bases) at the 5' end. When combined with primer R, it amplifies the fragment with nucleotide "A" at the SNP14 site. The fluorescent signal of the HEX group can be read using an ELISA reader or a real-time PCR instrument.
[0080] Example 3, Molecular Markers K-1A-SNP14 Its specific primer set in the identification of natural wheat populations TaHOX9-1A Applications in haplotypes
[0081] 1. Field phenotypic identification and data analysis of 142 natural wheat populations in the Huang-Huai region
[0082] 142 natural wheat varieties from the Huang-Huai wheat region were planted in Anyang, Henan and Suixi, Anhui in 2012-2013 and 2013-2014, respectively, and in Anyang, Henan and Gaoyi, Hebei in 2014-2015. A completely randomized block design with three replicates was used, with single-row plots, row length 1.5 m, row width 0.2 m, and 50 grains / row. Field management practices followed local wheat field management standards.
[0083] Phenotypic data for yield-related traits were obtained from the reference: Li J, Xie L, Tian X, Liu S, Xu D, Jin H, Song J, Dong Y, Zhao D, Li G, Li Y, Zhang Y, Zhang Y, Xia X, He Z, Cao S. (2021) TaNAC100 acts as an integrator of seed protein and starch synthesis exerting pleiotropic effects on agronomic traits in wheat. Plant Journal 108(3):829-840. Protein content was analyzed using a near-infrared reflectance spectrometer (Perten DA 7200, Springfield, IL, USA). Phenotypic data and BLUP values for multi-environment storage proteins and yield constituent traits are shown in Table 1.
[0084] 2. Molecular markers K-1A-SNP14 Genotyping of SNP14 loci in wheat varieties from the Huang-Huai region
[0085] (1) Genomic DNA was extracted from young leaves of 142 wheat varieties using the CTAB method.
[0086] The quality and concentration of genomic DNA must meet the requirements for PCR, with the following standards: agarose gel electrophoresis showing a single DNA band without obvious diffusion; a Nanodrop 2100 (Thermo) UV spectrophotometer showing an A260 / A280 ratio between 1.8 and 2.0 (indicating no protein contamination in the DNA sample), an A260 / A230 ratio between 1.8 and 2.0 (indicating low salt ion concentration in the DNA sample), and no obvious light absorption at 270 nm (indicating no phenol contamination in the DNA sample); the concentration of the wheat genomic DNA to be tested should be 50-200 ng / μL.
[0087] (2) Competitive allele-specific PCR (KASP)
[0088] Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the KASP primer set synthesized in Example 2 to obtain the amplification product.
[0089] Reaction system: 2.0 μL KASP 2×Master Mix (LGC, catalog number: 13448166), 0.048 μL KASP primers (3 primers mixed, total concentration of 50 μM, of which the molar ratio of two forward primers and one reverse primer is 2:2:5), 2.0 μL template DNA (50 ng / μL).
[0090] The reaction program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 61℃-55℃ (using the touch-down program, decreasing by 0.6℃ per cycle) for 1 min, amplification for 10 cycles; 94℃ denaturation for 20 s, 55℃ for 1 min, and continued amplification for 31 cycles.
[0091] (3) Acquisition of fluorescence signals and genotyping
[0092] Fluorescence signals were detected using the PHERAstar Plus autofocus fluorescence multifunction microplate reader (BMG Labtech GmbH, Ortenberg, Germany), and genotyping was performed using KlusterCaller software (LGC, Hoddesdon, UK). Fluorescence values were read by scanning the FAM and HEX beams of the microplate reader after the PCR amplification products cooled to below 40°C (FAM fluorescent tags were read at excitation wavelengths of 485 nm and emission wavelengths of 520 nm, while HEX fluorescent tags were read at excitation wavelengths of 528 nm and emission wavelengths of 560 nm). The wheat genotype was determined based on the color of the fluorescence signal. SNP14 Genotype at the locus.
[0093] The specific judgment principles are as follows:
[0094] 1) If the wheat to be tested is based on K-1A-SNP14 If the marker displays a blue fluorescent signal, then the wheat being tested... SNP14 The genotype at the locus is GG homozygous, meaning that the SNP14 locus in the wheat genome is homozygous for nucleotide G.
[0095] 2) If the wheat to be tested is based on K-1A-SNP14 If the marker displays a red fluorescent signal, then the wheat being tested... SNP14 The genotype at the locus is AA homozygous, meaning that the SNP14 locus in the wheat genome is homozygous for nucleotide A.
[0096] The genotyping of SNP14 loci in 142 wheat lines is shown in Table 1. Detailed genotyping results can be found in [link to table]. Figure 2 .
[0097] Table 1. Molecular markers K-1A-SNP14Genotypic classification and phenotypic data of 142 representative wheat lines in the Huang-Huai wheat region
[0098]
[0099] 3. Wheat TaHOX9-1A Association analysis of gene haplotypes with storage protein content and major agronomic traits
[0100] Based on the typing results and phenotypic data, a t-test was performed using the TTEST model in Excel statistical software to determine... TaHOX9-1A The genetic effects of different haplotypes on storage protein content and yield-related traits. The results of the genetic analysis of storage protein content and yield-related traits are shown in Table 2. Experimental results are expressed as mean ± standard deviation. Based on the SNP14 loci genotypes identified by the aforementioned KASP markers, the following can be used to classify the genotypes: TaHOX9-1A Genes are divided into two haplotypes: TaHOX9-1A-Hap1 (The genotype of SNP14 is GG). TaHOX9-1A-Hap2 (The genotype of SNP14 is AA).
[0101] Table 2 TaHOX9-1A Phenotypic relationship analysis between genotype and wheat storage protein content and yield-related traits
[0102]
[0103] Note: Table 2 shows two haplotypes. TaHOX9-1A-Hap1 and TaHOX9-1A-Hap2 Statistical comparisons of stored protein content, yield, number of spikes per unit area, number of grains per spike, thousand-grain weight, and plant height were made. * indicates a significant difference (P<0.05).
[0104] In summary, the haplotype analysis results show that:
[0105] (1) Compared to type TaHOX9-1A-Hap1 , TaHOX9-1A-Hap2 The content of stored protein increased significantly by 3.36%;
[0106] (2) Compared to type TaHOX9-1A-Hap1 , TaHOX9-1A-Hap2 Production decreased significantly by 4.76%;
[0107] (3) Compared to type TaHOX9-1A-Hap1 , TaHOX9-1A-Hap2 The number of ears per mu increased significantly by 7.52%;
[0108] (4) Compared to type TaHOX9-1A-Hap1 , TaHOX9-1A-Hap2 The number of grains per ear decreased significantly by 6.71%;
[0109] (5) Compared to type TaHOX9-1A - Hap1 , TaHOX9-1A - Hap2 Plant height increased significantly by 5.6%.
[0110] During the research and development process, this invention addresses the aforementioned issues. TaHOX9-1A Fourteen SNP sites were identified, and attempts were made to develop them into KASP markers using Polymarker (https: / / www.polymarker.info / ). Primer design results showed that only three SNP sites could initially generate KASP primers: SNP1, SNP8, and SNP14. Three sets of KASP primers were used: K-SNP1-1A ; K-SNP8-1A and K-SNP14-1A Wheat varieties in the Huang-Huai wheat region TaHOX9-1A Genotyping was performed, and the results showed ( Figure 2 and Figure 3 ), K-SNP14-1A The genotyping effect was significantly better than that of K-SNP1-1A and K-SNP8-1A.
[0111] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. Application of substances for detecting SNP polymorphisms or genotypes in the wheat genome in any of the following: (1) To identify or assist in the identification of wheat storage protein content and wheat yield; (2) Breeding for wheat storage protein content and wheat yield; (3) Prepare products for identification or auxiliary identification of wheat storage protein content and wheat yield; (4) To prepare products for breeding wheat storage protein content and wheat yield; The SNP site is a SNP site on wheat chromosome 1A, and its nucleotide type is G or A, which is the 71st nucleotide of sequence 4 in the sequence listing. The genotype of the SNP locus is GG or AA, where GG is the homozygous type of the SNP locus being G, and AA is the homozygous type of the SNP locus being A; the storage protein content of the wheat sample with the genotype GG at the SNP locus is lower than that of the wheat sample with the genotype AA at the SNP locus; the yield of the wheat sample with the genotype GG at the SNP locus is higher than that of the wheat sample with the genotype AA at the SNP locus.
2. The application according to claim 1, characterized in that, The substance is either D1), D2), or D3). D1) The substance is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).
3. The application according to claim 2, characterized in that, The primer composition consists of primer F1, primer F2 and primer R; The primer F1 is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence listing or a single-stranded DNA molecule whose nucleotide sequence is positions 22-39 of sequence 1 in the sequence listing; The primer F2 is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or a single-stranded DNA molecule whose nucleotide sequence is positions 22-39 of sequence 2 in the sequence listing; The primer R nucleotide sequence is a single-stranded DNA molecule of sequence 3 in the sequence listing.
4. A method for identifying or assisting in the identification of wheat storage protein content and wheat yield, characterized in that... This includes detecting the genotype of SNP sites in the wheat genome to be tested, and identifying or assisting in the identification of wheat storage protein content and wheat yield based on the genotype. The SNP site is a SNP site on wheat chromosome 1A, and its nucleotide type is G or A, which is the 71st nucleotide of sequence 4 in the sequence listing. The genotype of the SNP locus is GG or AA, where GG is the homozygous type of the SNP locus being G, and AA is the homozygous type of the SNP locus being A; the storage protein content of the wheat sample with the genotype GG at the SNP locus is lower than that of the wheat sample with the genotype AA at the SNP locus; the yield of the wheat sample with the genotype GG at the SNP locus is higher than that of the wheat sample with the genotype AA at the SNP locus.
5. A method for breeding wheat based on storage protein content and wheat yield, characterized in that... The method includes detecting the genotype of the SNP site described in claim 1 in the wheat genome, and selecting wheat with the genotype GG at the SNP site as a parent for breeding; The genotype of the SNP locus is GG or AA, where GG is the homozygous type of the SNP locus being G, and AA is the homozygous type of the SNP locus being A; the storage protein content of the wheat sample with the genotype GG at the SNP locus is lower than that of the wheat sample with the genotype AA at the SNP locus; the yield of the wheat sample with the genotype GG at the SNP locus is higher than that of the wheat sample with the genotype AA at the SNP locus.
6. The application of the method according to claim 4 or 5 in wheat breeding.