Use of l2 gene and / or l2 protein in controlling soybean oil content and / or regulating soybean phenotype

By increasing the expression of the L2 gene or increasing the content of L2 protein in soybeans, the color of soybean pods can be regulated to increase oil content, thus solving the problem of insufficient soybean oil content in existing technologies and achieving a significant increase in soybean oil content.

CN120099070BActive Publication Date: 2026-07-07CHINA AGRI UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA AGRI UNIV
Filing Date
2024-11-15
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

There is no existing technology on how to increase soybean oil content by regulating the corresponding traits of soybean pods.

Method used

By increasing the expression of the L2 gene, which encodes the L2 protein in soybeans, or by increasing the content of the L2 protein, the oil content of soybeans can be regulated by utilizing the influence of the L2 gene on pod color. Specific methods include constructing a genomic vector containing the L2 gene promoter, CDS, and terminator, and then transferring it into soybeans using the cotyledon node transformation method.

Benefits of technology

It achieved an increase in soybean oil content and changed the color of soybean pods and seeds, especially showing a significant increase in oil content in soybeans with black seed coats or hilum.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099070B_ABST
    Figure CN120099070B_ABST
Patent Text Reader

Abstract

The application provides application of L2 gene and / or L2 protein in controlling soybean oil content and / or regulating soybean phenotype, and belongs to the technical field of genetic engineering. The application provides application of L2 protein and / or L2 gene coding the L2 protein in regulating soybean oil content and / or regulating soybean phenotype, wherein the amino acid sequence of the L2 protein is shown as SEQ ID NO. 14. The application shows through the results of examples that the L2 gene not only affects the color of soybean pods and seeds, but also can be used for regulating the oil formation of soybean. The expression of the L2 gene is improved, the soybean pods are changed into brown, the seed color presents uneven color deposition, the soybean oil content is also improved, and the application of the L2 gene in black nodule soybean is confirmed.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of the L2 gene and / or L2 protein in regulating soybean oil content and / or regulating soybean phenotype. Background Technology

[0002] As the world's largest oilseed crop, increasing the seed oil content of soybean (Glycine max (Linn.) Merr.) is an important breeding goal.

[0003] The pod is the final transit point for assimilates to be transported to the seed. It also provides nutrients to the seed through photosynthesis. During seed development, it acts as both a source and a flow of nutrients, closely influencing seed development and oil formation.

[0004] However, there are currently no reports on how to increase soybean oil content by regulating the corresponding traits of pods. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the present invention aims to provide the application of L2 protein and / or the L2 gene encoding L2 protein in regulating soybean oil content and / or regulating soybean phenotype. The L2 protein can affect pod color and further regulate soybean oil content.

[0006] The objective of this invention is achieved through the following technical solution:

[0007] This invention provides the application of L2 protein and / or L2 gene encoding L2 protein in regulating soybean oil content and / or regulating soybean phenotype, wherein the amino acid sequence of L2 protein is shown in SEQ ID NO.14.

[0008] Preferably, increasing the expression of the L2 gene encoding L2 protein in soybeans or increasing the content of L2 protein in soybeans can increase the oil content of soybeans and / or change the color of soybean pods and / or seeds.

[0009] Preferably, the CDS sequence of the L2 gene is shown in SEQ ID NO.3.

[0010] The present invention provides a biomaterial comprising a genome vector and / or engineered bacteria containing the genome vector; the genome vector contains an L2 gene promoter sequence, an L2 gene CDS sequence and an L2 gene terminator sequence; the L2 gene CDS sequence is shown in SEQ ID NO.3.

[0011] Preferably, the L2 gene promoter sequence is shown in SEQ ID NO.1; and the L2 gene terminator sequence is shown in SEQ ID NO.2.

[0012] This invention provides a method for cultivating high-oil-content soybeans, comprising:

[0013] High-oil soybeans were obtained by increasing the expression of the L2 gene or increasing the content of L2 protein in soybeans.

[0014] Preferred methods for increasing the expression of the L2 gene in target soybeans include:

[0015] The biomaterials described in the above technical solution are transferred into the target soybean.

[0016] Preferably, the target soybean includes black-skin soybean and / or black-hilum soybean.

[0017] This invention provides a primer set for identifying the successful cultivation of high-oil-content soybeans, including upstream primer F as shown in SEQ ID NO.12 and downstream primer R as shown in SEQ ID NO.13.

[0018] This invention provides a method for identifying the successful construction of L2 transgenic plants, comprising: observing the pod color of mature transgenic soybeans to determine whether the L2 gene has been transferred and is functioning.

[0019] Beneficial effects of the present invention

[0020] This invention provides the application of the L2 protein and / or the L2 gene encoding the L2 protein in regulating soybean oil content and / or soybean phenotype. The amino acid sequence of the L2 protein is shown in SEQ ID NO. 14. This invention has discovered that the L2 gene controls soybean pod color. The L2 gene determines whether the pod color is brown. Using brown-podded soybeans and yellow-podded soybeans as parents, this invention identified the L2 gene as Glyma.03G005700 using fine mapping. Based on annotations from the Phytozome website (https: / / phytozome-next.jgi.doe.gov / ) and protein homology comparison, this gene encodes a synthase containing an HMGL-like domain. Its synthetic product affects soybean pod color through accumulation and oxidation. Natural population analysis revealed that pod color, in a genetic background of black seed coat or black hilum, may affect soybean seed oil content. Therefore, utilizing the L2 gene to increase soybean oil content is feasible. The results of this invention through examples show that the L2 gene not only affects the color of soybean pods and seeds, but can also be used to regulate soybean oil formation. Specifically, increasing the expression of the L2 gene can turn soybean pods brown, cause soybean seeds to exhibit uneven color deposition, and increase soybean oil content. This confirms the application of the L2 gene in black-navel soybean Williams82. In other soybean genetic backgrounds, there is still great potential to use the L2 gene to cultivate high-oil soybeans. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 This is a graph showing the expression level of L2 transgenic plants in Example 2;

[0023] Figure 2 Phenotypic diagram of pods and seeds of L2 transgenic plants in Example 3;

[0024] Figure 3 The image shows the oil content of the L2 transgenic plant and the control group in Example 3. Detailed Implementation

[0025] This invention provides the application of L2 protein and / or the L2 gene encoding L2 protein in regulating soybean oil content and / or regulating soybean phenotype, wherein the amino acid sequence of the L2 protein is shown in SEQ ID NO.14.

[0026] SEQ ID NO.14:

[0027] .

[0028] This invention provides the application of the L2 gene, which encodes the L2 protein, in controlling soybean oil content and / or regulating soybean phenotype.

[0029] This invention can increase soybean oil content and / or regulate soybean phenotype by increasing the expression of the L2 gene encoding the L2 protein or increasing the content of the L2 protein in soybeans. In this invention, the CDS sequence of the L2 gene is shown in SEQ ID NO. 3. In this invention, regulating the soybean phenotype can include altering the color of mature soybean pods and / or seed color. In this invention, increasing the expression of the L2 gene encoding the L2 protein or increasing the content of the L2 protein in soybeans can change the color of mature soybean pods to brown, while simultaneously causing uneven color deposition in the seeds.

[0030] SEQ ID NO.3:

[0031]

[0032] This invention provides a biomaterial comprising a genome vector and / or engineered bacteria containing the genome vector; the genome vector contains an L2 gene promoter sequence, an L2 gene CDS sequence, and an L2 gene terminator sequence; the L2 gene CDS sequence is shown in SEQ ID NO. 3. In this invention, the biomaterial can enhance the expression of the soybean L2 gene.

[0033] This invention does not impose any particular limitation on the method for constructing the genome vector; any conventional construction method in the art may be used. Similarly, this invention does not impose any particular limitation on the method for constructing engineered bacteria containing the genome vector; any conventional construction method in the art may be used.

[0034] In this invention, the L2 gene promoter sequence is shown in SEQ ID NO.1; the L2 gene terminator sequence is shown in SEQ ID NO.2. This invention does not specifically limit the backbone vector of the genome vector; any conventional backbone vector in the art can be used. As an optional embodiment of this invention, the backbone vector may include the pTF101 vector; the pTF101 vector is a conventional commercially available vector. This invention does not specifically limit the engineered bacteria; any conventional engineered bacteria in the art can be used. As an optional embodiment of this invention, the engineered bacteria may include competent Agrobacterium tumefaciens cells GV3101.

[0035] SEQ ID NO.1:

[0036]

[0037] SEQ ID NO.2:

[0038]

[0039] This invention provides a method for cultivating high-oil-content soybeans, comprising:

[0040] High-oil soybeans were obtained by increasing the expression of the L2 gene or increasing the content of L2 protein in soybeans.

[0041] In this invention, the target soybean includes black-seed-coat soybeans and / or black-hidden-seed soybeans; the black-hidden-seed soybeans include Williams82 soybeans. The method for increasing L2 gene expression in the target soybean according to this invention includes: transferring the biological material described in the above technical solution into the target soybean. This invention does not specifically limit the transfer method; any conventional transfer method in the art can be used. As an optional embodiment of this invention, the transfer method includes cotyledonary node transformation.

[0042] This invention provides a primer set for identifying the successful cultivation of high-oil-content soybeans, comprising upstream primer F as shown in SEQ ID NO.12 and downstream primer R as shown in SEQ ID NO.13. Using this primer set, real-time quantitative PCR can be performed on soybean pod cDNA to determine the expression level of the L2 gene in soybean plants.

[0043] This invention also provides a method for identifying the successful construction of L2 transgenic plants, comprising: observing the pod color of mature transgenic soybeans to determine whether the L2 gene has been introduced and is functioning. In this invention, if the pod color of mature transgenic soybeans shows uneven color deposition or turns brown, it indicates that the L2 gene has been successfully introduced and is functioning.

[0044] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0045] Example 1

[0046] Construction of L2 genome vector

[0047] Genomic DNA was extracted from brown-pod soybean material, the parental material containing the L2 allele. The promoter sequence of the L2 gene 3kb before the CDS was amplified by PCR as shown in SEQ ID NO.1, and the terminator sequence 1.75kb after the CDS was amplified by PCR as shown in SEQ ID NO.2. The CDS sequence of the L2 gene was amplified by PCR using cDNA from the pods of the brown-pod soybean material, as shown in SEQ ID NO.3. The promoter primer sequences are F: aagcttgcatgcctgcaggtcgactctagaGCATCTTAATCTTCATCTTC (Primer 1, SEQ ID NO.4), R: gtggatgttttggctgccatGGATTAATGCAAGATTGATA (Primer 2, SEQ ID NO.5); the terminator primer sequences are F: TGCTCGATTCAAAGGAATGA (Primer 3, SEQ ID NO.6), R: aggaaacagctatgacatgattacgaattcAGTTATAGAAGTCCCATCAA (Primer 4, SEQ ID NO.7); and the CDS primer sequences are F: ATGGCAGCCAAAACATCCAC (Primer 5, SEQ ID NO.8), R: tcattcctttgaatcgagcaTTTTGTTTAGTGCAGTAATA (Primer 6, SEQ ID NO.9).

[0048] The PCR reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2.

[0049] Table 1 PCR reaction system

[0050] Component Name Amount added (μL) 2×ApexHFFLPCRMasterMix 25 template 1 upstream primer F 2.5 Downstream primer R 2.5 Deionized water 19 Total volume 50

[0051] Table 2 PCR reaction procedures

[0052]

[0053] The homologous recombination arms in the primer sequences are represented by italicized lowercase letters, and all the fragments amplified above include homologous recombination arms. Specifically, the fragments containing these homologous recombination arms—namely, the L2 gene CDS first 3kb promoter sequence containing homologous recombination arms, the L2 gene CDS sequence containing homologous recombination arms, and the CDS last 1.75kb terminator sequence containing homologous recombination arms—can all be directly synthesized artificially.

[0054] After amplifying the above fragments, each amplified fragment was sequentially ligated via homologous recombination. Specifically, the pTF101 vector was linearized using EcoRI and XbaI endonucleases, and homologous recombination was performed with the three fragments mentioned above.

[0055] The pTF101 vector was digested with XbaI and EcoRI. The digestion reaction system is shown in Table 3. After digestion at 37℃ for 1 hour, the digested product was recovered by gel excision to obtain the digested vector.

[0056] Table 3 Enzyme digestion reaction system

[0057] Component Name Amount added (μL) 10×rCutsmartBuffer 5 pTF101 5 XbaI 1 EcoRI 1 <![CDATA[ddH2O]]> 38 Total volume 50

[0058] According to the homologous recombination reaction system in Table 4, the homologous recombination reaction was carried out at 50℃ for 15 min to obtain the ligation product.

[0059] Table 4 Homologous recombination reaction system

[0060] Component Name Amount added (μL) 2×OneStepAssemblyCloningMix 5 Enzyme digested vector 3.5 PCR product (promoter) 0.5 PCR products (CDS) 0.5 PCR product (terminator) 0.5 Total volume 10

[0061] The ligation product was introduced into competent E. coli cells by heat shock, and a genomic vector containing the L2 allele was obtained by amplification culture, PCR identification and plasmid extraction, and named pTF101-L2.

[0062] Example 2

[0063] Genetic transformation and identification of positive single plants

[0064] The constructed pTF101-L2 vector was transformed into competent Agrobacterium tumefaciens cells GV3101 and then transformed into soybean variety Williams82 using the cotyledonary node transformation method. Three T0 generation positive plants were obtained and named L2co1, L2co2, and L2co3, respectively. Seeds were harvested from each plant and planted into lines (L2co1, L2co2, and L2co3 were planted separately) at the Jize Experimental Station of China Agricultural University to obtain T1 generation plants. DNA was extracted from each T1 generation plant and PCR identification was performed. The primers for detecting the vector were F: CCGTACTTATACCTACCTACTC (Primer 7, SEQ ID NO.10); R: GTGGATGTTTTGGCTGCCAT (Primer 8, SEQ ID NO.11). At least 4 positive plants carrying the vector were detected in each line. RNA was extracted from the pods of positive soybean plants and reverse transcribed into cDNA. The expression level of the L2 gene was determined by real-time quantitative PCR. Simultaneously, the L2 gene expression level of the wild-type soybean variety Williams82 was detected as a control. The primers for quantitative PCR were: F: GCACGGGGTTTAGGGTGTAC (Primer 9, SEQ ID NO.12); R: GCACGAGCAGCCTCTATTGT (Primer 10, SEQ ID NO.13). The relative expression level was determined using GmActin as an internal reference gene. The primer sequences for GmActin-F are shown in SEQ ID NO.15: CGGTGGTTCTATCTTGGCATC; and for GmActin-R are shown in SEQ ID NO.16: GTCTTTCGCTTCAATAACCCTA.

[0065] In the results of real-time quantitative PCR, the relative expression levels of the L2 gene between the transgenic line and the control line are as follows: Figure 1 As shown in Table 5. Figure 1 In the text, * indicates a p-value < 0.05, ** indicates < 0.01, *** indicates less than 0.001, and **** indicates < 0.0001, and so on.

[0066] Table 5. Relative expression levels of L2 gene in transgenic lines and control lines.

[0067]

[0068] Depend on Figure 1 As shown in Table 5, the relative expression level of the L2 gene in positive transgenic lines was higher than that in wild-type Williams82.

[0069] Example 3

[0070] L2 gene function verification and oil content determination

[0071] The T1 generation transgenic line and wild-type control material (Williams82) grown at the Jize Experimental Station of China Agricultural University were harvested. Their pod and seed phenotypes are as follows: Figure 2 As shown, Figure 2 The scale bars in all figures are 1 cm. Oil content was determined in seeds of T1 generation lines L2co1, L2co2, and L2co3, as well as in the control material (Williams82), using Soxhlet extraction. Four positive plants were selected from each transgenic line as biological replicates, and the control material also used four plants as biological replicates. The results of the oil content determination are shown in […]. Figure 3 See Table 6.

[0072] Table 6. Oil content of transgenic lines and control lines

[0073]

[0074] Depend on Figure 2 It can be seen that, compared with the control material, the pod color of the positive transgenic lines changed from yellow to brown or uneven brown deposition, and the seeds of the positive transgenic lines showed uneven color deposition. (See Table 6 and...) Figure 3 It can be seen that increasing the expression level of the L2 gene significantly increases the oil content of soybean seeds.

[0075] In summary, the L2 gene not only affects the color of soybean pods and seeds but can also be used to regulate soybean oil formation. This invention confirms the application of the L2 gene in the black-skinned soybean Williams82. Furthermore, using the L2 gene to breed high-oil-content soybeans in other soybean genetic backgrounds still holds great potential.

[0076] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of L2 protein or L2 gene encoding L2 protein in regulating soybean oil content, wherein the amino acid sequence of L2 protein is shown in SEQ ID NO.14; the regulation of soybean oil content is to increase the content of L2 protein in soybean or increase the expression of L2 gene in soybean, thereby increasing soybean oil content; The soybeans mentioned are black-navel soybeans.

2. The application according to claim 1, characterized in that, The CDS sequence of the L2 gene is shown in SEQ ID NO.

3.

3. A method for increasing the oil content in soybeans, characterized in that, include: To increase the expression of the L2 gene encoding L2 protein in soybeans or to increase the content of L2 protein in soybeans; The soybeans mentioned are black-navel soybeans; The amino acid sequence of the L2 protein is shown in SEQ ID NO.

14.

4. The method according to claim 3, characterized in that, Methods to increase the expression of the L2 gene in target soybeans include: Transferring biological materials into the target soybean; The biological material is a genome vector or an engineered bacterium containing the genome vector; the genome vector contains an L2 gene promoter sequence, an L2 gene CDS sequence and an L2 gene terminator sequence; the L2 gene CDS sequence is shown in SEQ ID NO.

3.

5. The method according to claim 4, characterized in that, The L2 gene promoter sequence is shown in SEQ ID NO.1; the L2 gene terminator sequence is shown in SEQ ID NO.2.