Use of l1 protein and / or a gene encoding l1 protein in modulating soybean oil content and / or soybean phenotype
By increasing the expression of the L1 gene or increasing the content of L1 protein in soybeans, and utilizing the influence of L1 protein on pod color, the problem of regulating soybean oil content in existing technologies has been solved, achieving increased soybean oil content and phenotypic changes, thus confirming the application potential of the L1 gene in soybean breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CHINA AGRI UNIV
- Filing Date
- 2024-11-20
- Publication Date
- 2026-07-07
AI Technical Summary
There are no existing reports on how to increase soybean oil content by regulating the corresponding traits of soybean pods.
By increasing the expression of the L1 gene or increasing the content of L1 protein in soybeans, and utilizing the influence of L1 protein on pod color, the oil content of soybeans can be regulated. L1 overexpression vectors and engineered bacteria were used for gene transformation, and high-oil soybeans were cultivated by combining real-time quantitative PCR and cotyledon node transformation method.
The study successfully increased soybean oil content and altered the color of soybean pods and seeds, confirming the potential of the L1 gene in regulating soybean oil content and phenotype.
Smart Images
Figure CN120099071B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of L1 protein and / or genes encoding L1 protein in regulating soybean oil content and / or soybean phenotype. Background Technology
[0002] As the world's largest oilseed crop, increasing the seed oil content of soybean (Glycine max (Linn.) Merr.) is an important breeding goal.
[0003] The pod is the final transit point for assimilates to be transported to the seed. It also provides nutrients to the seed through photosynthesis. During seed development, it acts as both a source and a flow of nutrients, closely influencing seed development and oil formation.
[0004] However, there are currently no reports on how to increase soybean oil content by regulating the corresponding traits of pods. Summary of the Invention
[0005] To address the shortcomings of existing technologies, the present invention aims to provide the application of L1 protein and / or the L1 gene encoding L1 protein in regulating soybean oil content and / or regulating soybean phenotype. The L1 protein can affect pod color and also has a regulatory effect on soybean oil content.
[0006] The objective of this invention is achieved through the following technical solution:
[0007] This invention provides the application of L1 protein and / or the gene encoding L1 protein in regulating soybean oil content and / or soybean phenotype, wherein the amino acid sequence of the L1 protein is shown in SEQ ID NO.11.
[0008] Preferably, increasing the expression of the L1 gene encoding soybean or increasing the content of L1 protein in soybean increases soybean oil content and / or alters the color of soybean pods and / or seeds.
[0009] Preferably, the CDS sequence of the L1 gene is shown in SEQ ID NO.9.
[0010] The present invention provides a biological material comprising an L1 overexpression vector and / or engineered bacteria containing the L1 overexpression vector; the L1 overexpression vector contains an L1 gene CDS sequence; the L1 gene CDS sequence is shown in SEQ ID NO. 9.
[0011] This invention provides a method for cultivating high-oil-content soybeans, comprising:
[0012] High-oil soybeans can be obtained by increasing the expression of the L1 gene or increasing the content of L1 protein in soybeans.
[0013] Preferred methods for increasing the expression of the L1 gene in soybean include:
[0014] The biomaterials described in the above technical solution are transferred into soybeans.
[0015] Preferably, the soybeans include black-skin soybeans and / or black-hilum soybeans.
[0016] This invention provides a primer set for identifying the successful cultivation of high-oil-content soybeans, including upstream primer F as shown in SEQ ID NO.5 and downstream primer R as shown in SEQ ID NO.6.
[0017] This invention provides a method for identifying the successful construction of L1 transgenic plants, comprising: observing the color of the pods of mature transgenic soybeans; if the pods show uneven color deposition or turn black, it is determined that the L1 gene has been introduced and is functioning.
[0018] Beneficial effects of the present invention
[0019] This invention provides the application of the L1 protein and / or the gene encoding the L1 protein in regulating soybean oil content and / or soybean phenotype. The amino acid sequence of the L1 protein is shown in SEQ ID NO. 11. This invention discovered that the L1 gene determines whether soybean pods are black. Using black-podded soybeans and yellow-podded soybeans as parents, and through fine mapping, the L1 gene was identified as Glyma.19G120400. Based on annotations from the Phytozome website (https: / / phytozome-next.jgi.doe.gov / ) and protein homology comparison, this gene was found to encode a synthase containing an HMGL-like domain. Its synthetic product affects soybean pod color through accumulation and oxidation. Natural population analysis revealed that pod color, in a genetic background of black seed coat or black hilum, can affect soybean seed oil content; in this genetic background, oil content is positively correlated with pod color. Therefore, utilizing the L1 gene to increase soybean oil content is feasible. The results of this invention through examples show that the L1 gene not only affects the color of soybean pods and seeds, but can also be used to regulate the formation of soybean oil. Specifically, increasing the expression of the L1 gene can turn soybean pods black, make soybean seeds exhibit uneven color deposition, and increase soybean oil content. This confirms the application of the L1 gene in black-navel soybean Williams82. In other soybean genetic backgrounds, there is still great potential to use the L1 gene to cultivate high-oil soybeans. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0021] Figure 1 This is a graph showing the expression level of L1 transgenic plants in Example 2;
[0022] Figure 2 Phenotypic diagram of pods and seeds of L1 transgenic plant in Example 3;
[0023] Figure 3 Oil content diagrams of L1 transgenic plants and the control group in Example 3;
[0024] Figure 4 This is a partial map of the final vector of the L1 overexpression vector. Detailed Implementation
[0025] This invention provides the application of L1 protein and / or the gene encoding L1 protein in regulating soybean oil content and / or soybean phenotype, wherein the amino acid sequence of the L1 protein is shown in SEQ ID NO.11.
[0026] SEQ ID NO.11:
[0027] .
[0028] This invention can increase soybean oil content by increasing the expression of the L1 gene encoding L1 protein or by increasing the content of L1 protein in soybeans; it can also regulate soybean phenotype by increasing the expression of the L1 gene encoding L1 protein or by increasing the content of L1 protein in soybeans. In this invention, the CDS sequence of the L1 gene is shown in SEQ ID NO. 9. In this invention, regulating soybean phenotype includes changing the color of soybean pods and / or seeds at maturity. In this invention, increasing the expression of the L1 gene encoding L1 protein or increasing the content of L1 protein in soybeans can turn the color of mature soybean pods black, while causing uneven color deposition in the seeds.
[0029] SEQ ID NO.9:
[0030]
[0031] This invention provides a biomaterial comprising an L1 overexpression vector and / or engineered bacteria containing the L1 overexpression vector; the L1 overexpression vector contains an L1 gene CDS sequence; the L1 gene CDS sequence is shown in SEQ ID NO. 9. In this invention, the biomaterial can enhance the expression of the soybean L1 gene.
[0032] This invention does not specifically limit the method for constructing the L1 overexpression vector; any conventional construction method in the art can be used. This invention also does not specifically limit the method for constructing the engineered bacteria containing the L1 overexpression vector; any conventional construction method in the art can be used. In this invention, the L1 overexpression vector ultimately highly expresses L1 mRNA in the target soybean, and through translation, increases the L1 protein expression level. This invention does not specifically limit the backbone vector of the L1 overexpression vector; any conventional backbone vector in the art can be used. As an optional embodiment of this invention, the backbone vector may include the pTF101 vector; the pTF101 vector is a conventional commercially available vector. This invention does not specifically limit the engineered bacteria; any conventional engineered bacteria in the art can be used. As an optional embodiment of this invention, the engineered bacteria may include competent Agrobacterium cells GV3101.
[0033] This invention provides a method for cultivating high-oil-content soybeans, comprising:
[0034] High-oil soybeans can be obtained by increasing the expression of the L1 gene or increasing the content of L1 protein in soybeans.
[0035] In this invention, the soybean includes black-seed-coat soybeans and / or black-hilum soybeans; the black-hilum soybeans include Williams82 soybeans. The method of this invention for increasing the expression of the L1 gene in soybeans or increasing the content of L1 protein in soybeans includes: transferring the biological material described in the above technical solution into the target soybean. This invention does not specifically limit the transfer method; any conventional transfer method in the art can be used. As an optional embodiment of this invention, the transfer method includes cotyledonary node transformation.
[0036] This invention provides a primer set for identifying successful cultivation of high-oil-content soybeans, comprising upstream primer F as shown in SEQ ID NO.5 and downstream primer R as shown in SEQ ID NO.6. Using this primer set, real-time quantitative PCR of soybean pod cDNA can determine the expression level of the L1 gene in soybean plants.
[0037] This invention also provides a method for identifying the successful construction of L1 transgenic plants, comprising: observing the color of the pods of mature transgenic soybeans to determine whether the L1 gene has been introduced and is functioning. In this invention, if the pods of mature transgenic soybeans show uneven color deposition or turn black, it indicates that the L1 gene has been successfully introduced and is functioning.
[0038] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0039] Example 1
[0040] Construction of L1 overexpression vector
[0041] 1. Using black-pod soybean material containing the L1 allele as parental material, RNA was extracted from the pods and reverse transcribed into cDNA. The CDS sequence of the L1 gene without a stop codon was amplified, as shown in SEQ ID NO.8. The primer sequences were F: gacttaagcctaggacgcgtATGGCAGCCAAAACATCTAC (Primer 1, SEQ ID NO.1), R: gcgcgcctcccgggactagtTTCCTTTAAATCGAGCATTT (Primer 2, SEQ ID NO.2). The italicized lowercase letters in the above primer sequences represent the recombinant homologous arms. The PCR reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2.
[0042] Table 1 PCR reaction system
[0043] Component Name Amount added (μL) 2×ApexHFFLPCRMasterMix 25 template 1 upstream primer F 2.5 Downstream primer R 2.5 Deionized water 19 Total volume 50
[0044] Table 2 PCR reaction procedures
[0045]
[0046] The amplified products were obtained by electrophoresis and sequencing. Both ends of the amplified products had homologous recombination arms, which could form a recombinant vector with the backbone vector pTF101-p35S-MCS-3xFlag-NOS through homologous recombination.
[0047] 2. The backbone vector pTF101-p35S-MCS-3xFlag-NOS originated from Professor Kong Fanjiang's team at Guangzhou University. The literature source for the backbone vector pTF101-p35S-MCS-3xFlag-NOS is (Lu, Sijia, et al. Natural variation at the soybean J locus improves adaptation to the tropics and enhances yield. Nature Genetics 49.5(2017):773).
[0048] 3. Linearize the pTF101-p35S-MCS-3xFlag-NOS vector with SpeI and MluI endonucleases, and perform homologous recombination with the amplification product from step 1. The specific method is as follows:
[0049] The pTF101-p35S-MCS-3xFlag-NOS vector was digested with SpeI and MluI. The digestion reaction system is shown in Table 3. After digestion at 37℃ for 1 hour, the digested product was recovered by gel excision to obtain the digested vector.
[0050] Table 3 Enzyme digestion reaction system
[0051] Component Name Amount added (μL) 10×rCutsmartBuffer 5 pTF101-p35S-MCS-3xFlag-NOS 5 SpeI 1 MluI 1 ddH2O 38 Total volume 50
[0052] Then, according to Table 4, the homologous recombination reaction system was mixed and reacted at 50°C for 15 min to carry out the homologous recombination reaction and obtain the ligation product.
[0053] Table 4 Homologous recombination reaction system
[0054] Component Name Amount added (μL) 2×OneStepAssemblyCloningMix 5 Enzyme digested vector 3 PCR products 2 Total volume 10
[0055] The final vector partial map of the L1 overexpression vector of this invention is as follows: Figure 4 As shown. The final vector sequence map is shown in SEQ ID NO. 10. The sequence shown in SEQ ID NO. 10 of this invention is a part of the L1 overexpression vector, which includes a p35S-L1-3xFlag-NOS sequence fragment and a fragment from the pTF101 vector. The remaining part of the L1 overexpression vector sequence is the same as the pTF101 vector.
[0056] SEQ ID NO.10:
[0057]
[0058] The ligation product was introduced into competent E. coli cells by heat shock, and an overexpression vector containing the L1 allele was obtained by amplification culture, PCR identification and plasmid extraction, and named pTF101-L1.
[0059] Example 2
[0060] Genetic transformation and identification of positive single plants
[0061] The constructed pTF101-L1 vector was transformed into competent Agrobacterium tumefaciens GV3101 cells and then into the soybean variety Williams82 via cotyledon node transformation, yielding one T0 generation positive plantlet named L1oe1. Seeds from this single plantlet were planted at the Jize Experimental Station of China Agricultural University to obtain T1 generation plants. DNA was extracted from each T1 generation plantlet and identified by PCR. The detection vector primers were F: ATGGCAGCCAAAACATCTAC (Primer 3, SEQ ID NO.3); R: AATCATCGCAAGACCGGC (Primer 4, SEQ ID NO.4). A total of four T1 generation plants carrying the pTF101-L1 vector were detected. RNA was extracted from the pods of the positive plantlet and reverse transcribed into cDNA. The L1 gene expression level was determined by real-time quantitative PCR. Simultaneously, the L1 gene expression level in the wild-type soybean variety Williams82 was detected as a control. The quantitative PCR primers were F: CTGGGAGGCTCTGAAATAC (Primer 5, SEQ ID NO. 5); R: CTCTATCCGATCTGGCTGCA (Primer 6, SEQ ID NO. 6). GmActin was used as an internal reference gene for relative expression determination. Its primer sequences were GmActin-F (as shown in SEQ ID NO. 7, specifically: CGTGGTTCTATCTTGGCATC) and GmActin-R (as shown in SEQ ID NO. 8, specifically: GTCTTTCGCTTCAATAACCCTA).
[0062] In the results of real-time quantitative PCR, the relative expression levels of the L1 gene between the T1 generation transgenic line and the control line were as follows: Figure 1 As shown in Table 5. Figure 1 In the text, * indicates a p-value < 0.05, ** indicates < 0.01, *** indicates less than 0.001, and **** indicates < 0.0001, and so on. Figure 1 In this context, W82 refers to the detection result of the relative expression level of the L1 gene in the control line, and L1oe1 refers to the detection result of the relative expression level of the L1 gene in the T1 generation transgenic line.
[0063] Table 5. Relative expression levels of L1 gene in T1 generation transgenic lines and control lines.
[0064]
[0065]
[0066] Depend on Figure 1 As shown in Table 5, the relative expression level of the L1 gene in positive transgenic lines was higher than that in wild-type Williams82.
[0067] Example 3
[0068] L1 gene function verification and oil content determination
[0069] The T1 generation transgenic line and wild-type control material (Williams82) grown at the Jize Experimental Station of China Agricultural University were harvested. Their pod and seed phenotypes are as follows: Figure 2 As shown; the phenotypes of its pods and seeds are as follows. Figure 2 As shown, Figure 2 The scale bars in all figures are 1 cm. Oil content was determined in seeds of the T1 generation L1oe1 line and the control material (Williams82) using Soxhlet extraction. Each treatment was performed in four biological replicates, meaning each biological sample was from a different single plant, i.e., seeds from four Williams82 plants and four T1 generation transgenic lines. Oil content was measured using Soxhlet extraction, and the results are shown in [Figure number missing]. Figure 3 See Table 6. Figure 2 and Figure 3 W82 refers to the corresponding result of the wild-type control material, and L1oe1 refers to the corresponding result of the T1 generation transgenic line.
[0070] Table 6. Oil content of transgenic lines and control lines
[0071] Plant number Williams82 L1oe1 1 19.57 20.36 2 18.82 19.89 3 19.66 20.51 4 19.44 20.05
[0072] Depend on Figure 2 It can be seen that, compared with the control material, the pod color of the positive transgenic lines changed from yellow to black or uneven black deposition, and the seeds of the positive transgenic lines showed uneven color deposition. (See Table 6 and...) Figure 3 It can be seen that increasing the expression level of the L1 gene significantly increases the oil content of soybean seeds.
[0073] In summary, the L1 gene not only affects the color of soybean pods and seeds but can also be used to regulate soybean oil formation. This invention confirms the application of the L1 gene in the black-skinned soybean Williams82. Furthermore, there is still great potential for breeding high-oil-content soybeans using the L1 gene in other soybean genetic backgrounds.
[0074] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. The application of L1 protein or L1 gene encoding L1 protein in regulating soybean oil content, wherein the amino acid sequence of L1 protein is shown in SEQ ID NO.11; the regulation of soybean oil content is to increase the content of L1 protein in soybeans or increase the expression of L1 gene in soybeans, thereby increasing soybean oil content; The soybeans mentioned are black-navel soybeans.
2. The application according to claim 1, characterized in that, The CDS sequence of the L1 gene is shown in SEQ ID NO.
9.
3. A method for increasing the oil content in soybeans, characterized in that, include: By increasing the expression of the L1 gene encoding L1 protein in soybeans or increasing the content of L1 protein in soybeans; The soybeans mentioned are black-navel soybeans; The amino acid sequence of the L1 protein is shown in SEQ ID NO.
11.
4. The method according to claim 3, characterized in that, Methods to increase the expression of the L1 gene in soybean include: Transferring biomaterials into soybeans; The biological material is an L1 overexpression vector or an engineered bacterium containing the L1 overexpression vector; the L1 overexpression vector contains an L1 gene CDS sequence; the L1 gene CDS sequence is shown in SEQ ID NO.9.