Eukaryotic expression vector for expressing fully human anti-RhD antibody, cell strain and application of eukaryotic expression vector
By constructing the heavy and light chains of anti-RhD antibodies on the same plasmid in the eukaryotic expression vector, the problem of stable expression and large-scale production of anti-RhD antibodies in the prior art is solved, and efficient and stable antibody expression and simplified production process are achieved.
Patent Information
- Application Number
- CN202510226167.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-27
- Publication Date
- 2025-06-06
AI Technical Summary
The existing protocol uses transient plasmids to construct anti-RhD antibodies, making it difficult to achieve stable expression and large-scale production, and the proportion of light and heavy chains is unbalanced during the transfection process, affecting the assembly of the target protein.
A eukaryotic expression vector was designed, and the heavy and light chains of anti-RhD antibodies were constructed on the same plasmid. The stable expression cell lines were obtained by transfecting the host cells and screening them.
The efficient expression and stability of anti-RhD antibodies are achieved, the problem of imbalance in the proportion of light and heavy chains is avoided, the experimental process is simplified and the production cost is reduced.
Smart Images

Figure CN120099097A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to a eukaryotic expression vector for expressing a fully human anti-RhD antibody, a cell line and an application thereof. Background Art
[0002] According to the International Society of Blood Transfusion (ISBT) naming principles for red blood cell surface antigens, 366 red blood cell blood group antigens have been discovered and confirmed, which can be classified into 47 blood group systems, of which the most complex system is the Rh blood group system. The Rh antigen is a multi-protein complex, with the core of the protein composed of RhD and RhCE. The RhD gene is located at 1P36.1 on the short arm of chromosome 1, and is connected in series with the protein gene of RhCE in the opposite direction. The homology between the two is as high as more than 95%. The protein encoded by the RhD gene contains 417 amino acids, which is only a few dozen amino acids different from RhCE. However, gene recombination and mutation produce many different antigens, the most common of which are D, C, c, E, and e antigens. Among them, the D antigen is the most immunogenic antigen, which will cause the production of anti-D, resulting in hemolysis of anti-D and red blood cells.
[0003] The preparation of Rh blood group antigen antibodies can provide more options for clinical red blood cell blood group testing. At present, there are many methods that can be used for antibody preparation, such as EBV hybridoma technology, genetic engineering antibody technology, phage library technology and single B cell technology. The above methods have their own advantages and disadvantages, and genetic engineering antibody technology has the advantages of reducing immunogenicity, improving antibody affinity, easy production and purification, and high flexibility.
[0004] The existing scheme uses single-cell BCR library sequencing technology to screen out fully human antibody sequences that can specifically recognize and bind to the red blood cell blood type RhD antigen, and constructs the light chain and heavy chain into transient plasmids respectively, and verifies the transfected and expressed proteins. Although the antibodies obtained by this scheme can specifically recognize the RhD antigen, the transient plasmids used are difficult to use for large-scale production, and during the transfection process, since the light chain and heavy chain are transferred into the cells separately, the ratio of light and heavy chains in the cells will be unbalanced, which will affect the assembly of the target protein and is not conducive to the expression of the RhD antibody. Summary of the invention
[0005] The present invention provides a recombinant expression system capable of stably expressing anti-erythrocyte RhD antibodies, so as to solve the problem that the expression vector constructed in the existing scheme is a transient plasmid and cannot be used for the stable expression and large-scale production of RhD antibodies.
[0006] In a first aspect, the present invention provides a eukaryotic expression vector, which is a recombinant plasmid capable of expressing anti-RhD antibodies, and the nucleotide sequence of the recombinant plasmid in the 5'-3' direction is shown in SEQ ID NO.1.
[0007] Among them, the genes of the heavy chain (H) and light chain (L) of the anti-RhD antibody described in the present application are both located on the eukaryotic expression vector, that is, the exogenous genes introduced into the recombinant plasmid include the heavy chain and light chain of the anti-RhD antibody, both of which are introduced into the same vector. The nucleotide sequence of the heavy chain gene on the eukaryotic expression vector is shown in SEQ ID NO.2, and the nucleotide sequence of the light chain gene is shown in SEQ ID NO.3.
[0008] The second aspect of the present invention provides a cell line obtained by transfecting the above-mentioned eukaryotic expression vector into a host cell.
[0009] Optionally, the host cell is a mammalian CHO-K1 cell.
[0010] The third aspect of the present invention provides a method for preparing the above cell line, comprising transfecting the eukaryotic expression vector into a host cell, culturing and screening; The transfection method includes: diluting the recombinant plasmid DNA and the transfection reagent PEI respectively, then adding the PEI dilution solution to the recombinant plasmid DNA dilution solution and mixing to form a mixture, and adding the mixture to the host cell for culturing; wherein the mass ratio of the recombinant plasmid DNA and PEI when mixed is 1:1.5.
[0011] Optionally, the screening includes screening using a eukaryotic screening marker contained in the eukaryotic expression vector; the eukaryotic screening marker includes puromycin.
[0012] The fourth aspect of the present invention provides a method for preparing an anti-RhD antibody, comprising: culturing the above-mentioned cell line, and obtaining the anti-RhD antibody from the cell culture.
[0013] The fifth aspect of the present invention provides an anti-RhD antibody obtained by the above-mentioned method for preparing an anti-RhD antibody.
[0014] The sixth aspect of the present invention provides use of the anti-RhD antibody described above in the preparation of a preparation for detecting the RhD antigen on red blood cells.
[0015] In a seventh aspect, the present invention provides a detection reagent or kit for detecting human erythrocyte RhD antigen, which comprises the anti-RhD antibody expressed by the eukaryotic expression vector or the anti-RhD antibody obtained by the preparation method.
[0016] The eukaryotic expression vector of the present invention constructs the light chain and heavy chain of the anti-human erythrocyte RhD antibody on the same plasmid, which can avoid the phenomenon of improper light and heavy chain ratio of the antibody protein during the transfection process, and obtain an antibody protein with high expression efficiency and good functionality. In addition, since the light and heavy chains are on the same plasmid, only one plasmid needs to be transfected, which simplifies the experimental process, and screening stable cells only needs to target a single resistance marker, saving time and cost. Through stable transformation screening, a stable transformed cell strain with strong immunogenicity is obtained, which can be used for large-scale production. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 The following is the electrophoresis diagram of the restriction enzyme digestion of the intermediate plasmid H-pCHO1.0. In the figure, lane M: marker (KB Ladder); lane 1: undigested plasmid; lane 2: plasmid digested with BamHI and EcoRI. Digestion conditions: 200-1000 ng of plasmid DNA, incubated at 37°C for 30-60 minutes, and analyzed by electrophoresis using 1% agarose gel.
[0018] Figure 2 This is the restriction enzyme electrophoresis diagram of the recombinant plasmid RhD IgG_H+L_pCHO1.0. In the figure, lane M: marker (KBLadder); lane 1: undigested plasmid; lane 2: plasmid digested with BamHI and EcoRI. Digestion conditions: 200-1000ng of plasmid DNA, incubated at 37°C for 30-60 minutes, and analyzed by electrophoresis using 1% agarose gel.
[0019] Figure 3 The results of the anti-human globulin (IgG+C3d) card of CHO-K1 cell supernatant 24h, 48h, and 72h after transfection with the recombinant plasmid (RhD IgG_H+L_pCHO1.0). In the figure, A: 24h transfection result; B: 48h transfection result; C: 72h transfection result; D: control group result. Negative control: untransfected CHO-K1 cell supernatant; positive control: 1% O-type red blood cells sensitized with commercial IgG; blank control: normal saline.
[0020] Figure 4 The results of the anti-D IgG antibody titer test tube method using cell supernatant at different (DNA:PEI) transfection ratios. (a) is the data result, and (b) is the color development of the corresponding test tubes for each group.
[0021] Figure 5 This is the SDS-PAGE gel electrophoresis of the culture supernatant of the anti-D IgG stable cell line. DETAILED DESCRIPTION
[0022] The technical solution of the present invention is described in detail below in conjunction with the accompanying drawings and specific implementation methods.
[0023] The eukaryotic expression vector of the present invention is a recombinant plasmid capable of expressing anti-human erythrocyte RhD antibodies. The recombinant plasmid is based on pCHO1.0 plasmid, and various types of elements of the vector are designed, and an exogenous target gene is inserted to construct a recombinant plasmid. Its complete nucleotide sequence from 5' to 3' direction is shown in SEQ ID NO.1.
[0024] For the exogenous target gene of the vector, the heavy chain (H) and light chain (L) of the anti-human erythrocyte RhD antibody are the exogenous target genes. The nucleotide sequence of the heavy chain is shown in SEQ ID NO.2, and the nucleotide sequence of the light chain is shown in SEQ ID NO.3. The heavy chain and light chain of the anti-RhD antibody of the present invention are linked to the same plasmid, and the target protein (anti-RhD IgG) with specific functions is successfully expressed.
[0025] Specifically, when this vector was designed and constructed, the insertion site of the heavy chain (H) was Avr Ⅱ / BstZ17 I, and the insertion site of the light chain (L) was EcoR Ⅴ / Pac Ⅰ. In addition, both the light chain synthetic sequence and the heavy chain synthetic sequence were added with initiators and terminators before and after, namely: ATG+ heavy / light chain (variable region+constant region)+TGA; at the same time, a CHO secretory extracellular signal peptide was added, and the amino acid sequence of the signal peptide was MGWSCIILFLVATATGVHS.
[0026] As for other elements of the vector, promoters include pPGK, pCMV / EF1, pEF2 / CMV, etc., and contain other elements such as SV40polyA, CMV polyA, etc.; screening markers include prokaryotic screening markers and eukaryotic screening markers, prokaryotic screening markers include kanamycin (KanR), and eukaryotic screening markers include puromycin (pac) and DHFR. The promoter pPGK can achieve precise control of gene expression; the polyadenylic acid tail (pA) can improve the stability of mRNA molecules, reduce the rate of degradation by intracellular RNases, and also help mRNA to effectively transfer from the nucleus to the cytoplasm, thereby improving translation efficiency; and the chimeric promoter can provide stable and consistent gene expression in a variety of cells, achieve more complex gene regulation and increase antibody production.
[0027] Example 1 Design and construction of recombinant plasmid 1.1 Heavy chain insertion and construction of intermediate plasmid (H-pCHO1.0) 1) Primer synthesis: synthesize the target gene fragment.
[0028] 2) Perform homologous recombination between the target sequence and the vector pCHO1.0 digested with AvrII-BstZ17I.
[0029] 3) Transform the Top10 strain with kanamycin resistance at a concentration of 45 μg / mL and a culture temperature of 37 degrees.
[0030] 4) Screening of positive clones.
[0031] 5) Pick a single clone for culture and extract the plasmid.
[0032] 6) Sequencing, sequencing primers are as follows: seq1 TACTACTACTACGGTATGGA; seq2 GGAGGAGCAGTACAACAGCA; seqR1 ACTGTCACCACGCTGCTCAG; The sequencing results showed that the sequencing results were consistent with the theoretical synthetic sequence provided.
[0033] 7) QC test, the recombinant plasmid was digested with BamHI-EcoRI, and the actual size was consistent with the theoretical size (9944bp / 4478bp). Figure 1 shown.
[0034] 1.2 Light chain insertion and construction of recombinant plasmid (RhD IgG_H+L_pCHO1.0) 1) Perform homologous recombination between the target sequence and the vector intermediate plasmid H-pCHO1.0 digested with EcoRV-PacІ.
[0035] 2) Transform the Top10 strain with kanamycin resistance at a concentration of 45 μg / mL and a culture temperature of 37°C.
[0036] 3) Screening of positive clones.
[0037] 4) Select single clones for culture and extract plasmids.
[0038] 5) Sequencing, primers are as follows: Seq1r CCTCTCTGGGATAGAAGTTA; SeqR TAGTCAATAATCAATGTCCG; The sequencing results showed that the sequencing results were consistent with the theoretical synthetic sequence provided.
[0039] 6) QC test, the recombinant plasmid was digested with Mlul-EcoRV, and the actual size was consistent with the theoretical size (8594bp / 4786bp / 1746bp). Figure 2 shown.
[0040] Example 2 Plasmid extraction
[0041] 2.1 Cell transformation 1) Take 100 μL of TOP 10 competent cells, place on ice and thaw (about 3 min).
[0042] 2) Immediately add the target DNA (i.e., the recombinant plasmid RhD IgG_H+L_pCHO1.0 successfully constructed in Example 1) to the thawed competent cell suspension, gently shake to mix, and place on ice for 25 min. Ensure that the added DNA volume does not exceed one tenth of the volume of the competent cell suspension.
[0043] 3) Heat shock in a 42℃ water bath for 45 seconds, then quickly transfer the EP tube to ice and let it stand for 2 minutes.
[0044] 4) Add about 700 μL of LB medium without antibiotics to the centrifuge tube, mix well and incubate at 37°C, 200 rpm for 60 min.
[0045] 5) Collect the cells by centrifugation at 5000 rpm for 1 min, transfer the culture medium to LB medium containing 30 μg / ml kanamycin, and culture overnight at 37°C and 120 rpm.
[0046] 2.2 Plasmid extraction 2.2.1 Sample preprocessing 1) Take 150-200 mL of overnight culture solution and transfer it to a 50 mL centrifuge tube. Centrifuge at 10,000 rpm for 1 min, discard the supernatant and collect the bacteria.
[0047] 2) Add 7.5 mL of buffer RS* (using the Endotoxin-Free Plasmid Extraction Kit (Shanghai Yisheng Biotechnology Co., Ltd.), and resuspend the bacterial pellet by pipetting or vortexing.
[0048] 3) Add 7.5 mL of lysis buffer LB and gently invert the tube 6-8 times to fully lyse the cells. Leave at room temperature for 4 min.
[0049] 4) Add 7.5 mL of Binding Buffer BD and immediately mix thoroughly by gently inverting the tube 6-8 times. Centrifuge at 10,000 rpm for 10-15 minutes and carefully collect the supernatant. Avoid aspirating the floating white precipitate.
[0050] 5) Add 1 / 10 of the supernatant volume of endotoxin-free solution ER (about 2.4 mL), invert to mix, and place on ice for 5 min until the solution becomes clear (or slightly turbid). Invert 2-3 times to mix during the ice bath.
[0051] 6) Place at room temperature (25°C) for 5 min. When the solution regains its turbidity, invert and mix.
[0052] 7) Centrifuge at 10,000 rpm for 10 min at room temperature to separate the layers. The upper aqueous phase is DNA, and the lower blue oily phase is endotoxin and other substances. Carefully collect the upper aqueous phase into a new centrifuge tube.
[0053] 8) Add 0.5 volume of isopropanol (about 11 mL) and mix thoroughly by inversion.
[0054] 2.2.2 Large-scale extraction of plasmid DNA 1) Place DNA adsorption column E1 into a 50 mL collection tube and set aside.
[0055] 2) Add the above pretreatment mixture to DNA adsorption column E1, centrifuge at 10,000 rpm for 1 min, and discard the waste liquid.
[0056] 3) Add 10 mL of deproteinized solution PL*, centrifuge at 10,000 rpm for 1 min, and discard the waste liquid.
[0057] 4) Place DNA adsorption column E1 back into the collection tube, add 10 mL of rinse solution W*, centrifuge at 12,000 rpm at room temperature for 1 min, and discard the waste liquid.
[0058] Repeat step 4).
[0059] 5) Place the DNA adsorption column E1 back into the collection tube and centrifuge the empty column at 12,000 rpm for 3 min at room temperature to remove the remaining rinse solution W*. Allow to dry at room temperature for 3 min.
[0060] 6) Place DNA adsorption column E1 into a new 50 mL collection tube, add 1-2 mL of elution buffer to the center of DNA adsorption column E1, and place at room temperature for 2 min. Then centrifuge at 10,000 rpm for 2 min. Collect the filtrate, which is the plasmid DNA solution.
[0061] 7) Load the plasmid DNA filtrate onto the column again, leave it at room temperature for 2 min, and then elute to obtain the plasmid DNA.
[0062] 8) Use a UV spectrophotometer to measure the concentration of plasmid DNA and store the DNA solution at -20℃ for a long time.
[0063] Example 3 Cell transfection and stable cell line screening 3.1 Cell transfection 3.1.1 Preparation of storage solution (1 mg / mL) 1) In a 1L glass beaker, add 1g PEI 40000 powder to 900mL Milli-Q ultrapure water and stir evenly on a magnetic stirrer.
[0064] 2) Wait until PEI 40000 is completely dissolved (usually less than 5 minutes).
[0065] 3) Adjust the pH to 6.80-6.90 with 1 mol / L sodium hydroxide (NaOH) solution.
[0066] 4) Transfer the solution into a measuring cylinder and add water to make up to 1 L.
[0067] 5) Filter and sterilize using a disposable 0.1~0.2um PES vacuum filter to obtain a 1mg / mL stock solution.
[0068] 6) Aliquot as needed and store at 4°C, stable for 3 months.
[0069] 3.1.2 Cell transfection 1) One day before transfection, CHO-K1 cells in logarithmic phase were cultured at 5×10 5 / mL, 2mL per well was plated into a 6-well plate and placed in a 37°C, 5% CO 2 Incubator. Cell fusion density is 70%~80%.
[0070] 2) Exploration of the ratio of transfection reagent to DNA:
[0071] 2 μg of DNA is required per well in a 6-well plate, and PEI is prepared according to the transfection pattern shown in the following table:
[0072] Among them, in group 2, the "H / L" group, heavy chain H and light chain L were respectively used as exogenous target genes and inserted into different plasmids to form heavy chain H plasmid (H) and light chain L plasmid (k), and the two plasmids were co-transfected into cells. When preparing this group of solutions, the ratio of heavy chain H plasmid (H) and light chain L plasmid (k) was 1:1, and the ratio of DNA to PEI was 1:3. That is, 1μg DNA of plasmid H and plasmid L (k) was diluted to 50μL serum-free DMEM, and 6μg PEI was diluted to 50μL serum-free DMEM.
[0073] 3) After the diluted PEI and DNA are left to stand at room temperature for 5 minutes, add the PEI dilution to the DNA dilution, mix gently, and leave to stand at room temperature for 20 minutes.
[0074] 4) During this period, wash the cell plate with saline, then add serum-free DMEM. After incubation, mix the PEI-DNA mixture and add the mixture to different areas of the well while shaking. Place it in a 37°C, 5% CO 2 Culture in an incubator. Replace serum-free DMEM after 4 hours, and collect the supernatant every 24 hours.
[0075] 3.2 Anti-human globulin gel card test confirmation Take 100 μL of the cell supernatant after transfection at different time periods in a microplate, add 50 μL of 1% O-type red blood cell suspension, incubate at 37°C for 30 minutes, mix well, take 50 μL of the mixture and add anti-human globulin gel card, incubate at 37°C for 30 minutes, centrifuge at room temperature, and end the interpretation of the results.
[0076] The cell supernatants were collected 24h, 48h, and 72h after transfection for anti-human globulin gel card test. The results showed (see Figure 3 ), after CHO-K1 cells were transfected with the recombinant plasmid of the present invention, functional target protein anti-D IgG was successfully expressed at 48h. Furthermore, anti-D IgG was detected at 24h in the co-transfected heavy and light chain plasmid group (i.e., H / L group in Table 1). The speed of expressing anti-D IgG protein may be related to the sequence size of the exogenous gene in the plasmid.
[0077] 3.3 Test tube method for IgG titer The cell supernatant 72 hours after transfection was used to measure the titer of the target protein anti-D IgG antibody by the test tube method.
[0078] 1) Dilute the cell supernatant 72 hours after transfection with saline in multiple ratios. Add 50 μL of 2% O-type red blood cell suspension to each tube, and incubate at 37°C for 30 min.
[0079] 2) Add an appropriate amount of physiological saline to each tube, centrifuge at 1500 rpm for 2 min, discard the supernatant, and repeat this operation 3 times.
[0080] 3) After the last wash, discard the supernatant, add 100 μL of anti-human immunoglobulin IgG to each tube, mix well, centrifuge at 800 rpm for 1 min, and gently shake the test tube to read the result.
[0081] The results are as follows Figure 4 As shown, the results show that when the ratio of recombinant plasmid DNA and PEI is 1:1.5, the titer (8) is slightly higher than that of other groups (4), which is the relatively optimal ratio of DNA to transfection reagent. This ratio will continue to be used for cell transfection operations in subsequent production.
[0082] 3.4 Screening of stable cell lines Day 1: 48 hours after cell transfection, the cells were first subcultured and diluted. When the cell confluence reached 60% to 70%, the above-determined puromycin working concentration (6 μg / ml) was added to the culture medium, and a blank cell control group (not transfected with plasmid) was set up at the same time. Day 2-3: Screen for at least 48 hours. When the mortality rate of the empty cell plus antibiotic group is greater than 90%, replace the drug-screening antibiotic medium with fresh complete medium. At this time, the remaining cells in the experimental group can basically be considered positive cells. Day 4~: Continue to screen and amplify the positive cells (add drugs every other generation to maintain the positive cell rate, and maintain the concentration at half of the working concentration), and perform cell preservation and re-inspection. At this point, a mixed clone anti-D-IgG stable cell line was obtained.
[0083] 3.5 SDS-PAGE analysis of protein expression in stably transfected cell lines The supernatant of the anti-D-IgG stable cell line and the supernatant of the empty plasmid transfection were analyzed by SDS-PAGE, and the marker band selected was 10-170KD. Figure 5 As shown, after gel imaging analysis, the heavy chain content of the supernatant of the anti-D-IgG stable cell line was 57KD, and the light chain content was 26KD, further indicating the successful expression of the target protein.
[0084] The present invention has been described in detail above in conjunction with specific implementation methods and exemplary examples, but these descriptions cannot be understood as limiting the present invention. Those skilled in the art will appreciate that, without departing from the spirit and scope of the present invention, various equivalent substitutions, modifications or improvements may be made to the technical solution of the present invention and its implementation methods, all of which fall within the scope of the present invention.
Claims
1. A eukaryotic expression vector, characterized in that: The eukaryotic expression vector is a recombinant plasmid, and the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NO.
1.
2. The eukaryotic expression vector according to claim 1, characterized in that The anti-RhD antibody can be expressed; the genes of the heavy chain and light chain of the anti-RhD antibody are both located on the eukaryotic expression vector; the nucleotide sequence of the heavy chain gene on the eukaryotic expression vector is shown in SEQ ID NO.2, and the nucleotide sequence of the light chain gene is shown in SEQ ID NO.
3.
3. A cell strain obtained by transfecting the eukaryotic expression vector according to claim 1 into a host cell.
4. The cell line according to claim 3, characterized in that The host cell is a mammalian CHO-K1 cell.
5. The method for preparing the cell line according to claim 3, characterized in that: The method comprises transfecting the eukaryotic expression vector into a host cell, culturing and screening; The transfection method comprises: diluting the recombinant plasmid DNA and the transfection reagent PEI respectively, then adding the PEI dilution liquid into the recombinant plasmid DNA dilution liquid and mixing to form a mixture, and adding the mixture into the host cell for culturing; wherein the mass ratio of the recombinant plasmid DNA to the PEI when mixed is 1:1.
5.
6. The method for preparing a cell line according to claim 5, characterized in that: The screening includes screening using a eukaryotic screening marker contained in the eukaryotic expression vector; the eukaryotic screening marker includes puromycin.
7. A method for preparing an anti-RhD antibody, characterized in that: include: Cultivate the cell line according to claim 3 and obtain anti-RhD antibodies from the cell culture.
8. The anti-RhD antibody obtained by the method for preparing the anti-RhD antibody according to claim 7.
9. Use of the anti-RhD antibody according to claim 8 in the preparation of a preparation for detecting erythrocyte RhD antigen.
10. A detection reagent or kit for detecting human erythrocyte RhD antigen, characterized in that: The method comprises the anti-RhD antibody expressed by the eukaryotic expression vector of claim 1 or the anti-RhD antibody of claim 8.