A primer probe set, kit and device for quantitative detection of human BRAF gene V600E mutation based on digital PCR
By optimizing primer probe sets and digital PCR technology, combined with vibrating droplet generation, the sensitivity and specificity of the BRAF gene V600E mutation detection is solved, and efficient and rapid detection of low-abundance mutations is achieved, which is suitable for the accurate diagnosis of a variety of tumor diseases.
Patent Information
- Application Number
- CN202510437503.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-09
- Publication Date
- 2025-09-02
- Estimated Expiration
- 2045-04-09
AI Technical Summary
The prior art has problems such as low sensitivity, poor specificity, long detection cycle and limited flux when detecting BRAF gene V600E mutations. Especially in low-abundance mutation samples, it is easy to miss the test, which is difficult to meet the clinical rapid diagnosis needs.
The primer probe set optimization design is adopted, combined with digital PCR technology, and the fluorescence and quenching groups are labeled at specific positions of the primer and probe, and the reaction system is segmented using vibrating droplet generation technology to achieve high sensitivity and specificity detection of BRAF gene V600E mutation.
It significantly improves the detection sensitivity and specificity of the V600E mutation of the BRAF gene, can detect low-abundance mutations as low as 0.01%, shorten the detection cycle, and is suitable for the stability detection of complex samples, especially in early detection and early warning of tumor diseases such as melanoma, papillary thyroid carcinoma, colorectal cancer and non-small cell lung cancer.
Smart Images

Figure CN120138137B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biological detection materials and relates to a primer probe set, a kit and a device for quantitative detection of human BRAF gene V600E mutation based on digital PCR. Background Art
[0002] The BRAF gene is located on the long arm of human chromosome 7 (7q34) and encodes a serine / threonine protein kinase. As a core molecule in the MAPK (Ras / Raf / MEK / ERK) signaling pathway, it regulates key biological processes such as cell proliferation, differentiation, and apoptosis. In tumors, BRAF mutations drive carcinogenesis by activating the MAPK pathway, with mutations at the V600 locus (such as V600E / K / R) accounting for the highest proportion. The BRAF V600E mutation (c.1799T>A) accounts for over 90% of all V600 mutations and is commonly found in melanoma, papillary thyroid carcinoma, colorectal cancer, and non-small cell lung cancer. Furthermore, the BRAF V600R mutation (valine to arginine), although only occurring in 1–5% of malignant melanomas, can be detected in up to 5% of malignant melanomas. Its kinase activity is similar to that of V600E / K, similarly leading to aberrant activation of the MAPK pathway.
[0003] Currently, clinical detection of BRAF mutations mainly relies on the following methods:
[0004] 1. Sanger sequencing: As the "gold standard", its sensitivity is only above 15% and its throughput is limited (a maximum of 96 sites can be detected in a single run);
[0005] 2. Next-generation sequencing (NGS): This method can detect multiple gene variants at high throughput, but it is expensive and time-consuming, and is only suitable for cancers that require multi-gene testing.
[0006] 3. Allele-Specific Amplification (ARMS): A PCR-based mutation detection technology that analyzes known base substitutions or small deletions and insertions. During PCR primer design, a mismatched base is designed at the 3' end or in the middle of the primer based on the properties of the known mutation site, so that it can complement and amplify only the mutant or wild-type gene. Nonspecific amplification caused by G:T mismatches must be avoided, so its applicability is limited.
[0007] 4. Fluorescence quantitative PCR: Relies on Ct value quantification, requires a standard curve and has the risk of false positives;
[0008] 5. Immunohistochemistry (IHC): The initial screening cost is low but the false positive rate is high, and it is only suitable for single testing.
[0009] Studies have shown that the sensitivity and consistency of NGS and multiplex RT-PCR in 138 non-small cell lung cancer samples are better than Sanger sequencing, indicating that molecular detection technology is developing towards high sensitivity and high throughput.
[0010] There are multiple mutations near the V600 position (1797_1799nt) of the BRAF gene, such as the three common V600R mutations: c.1798_1799delinsAG, c.1798_1799delinsCG, c.1797_1799delinsGAG, V600K mutation c.1798_1799delinsAA, and V600D mutation c.1799_1800delinsAC, c.1799_1800delinsAT. V600E (c.1799T>A) differs only by a single base from V600D (c.1799_1800delinsAC), V600D (c.1799_1800delinsAT), and V600K (c.1798_1799delinsAA). V600E (c.1799T>A) differs only by a single base from the wild-type sequence. Therefore, designing probes for V600E detection targets is difficult to ensure specificity. Current primer designs are prone to nonspecific amplification when detecting BRAF V600E mutations. For example, conventional fluorescent PCR methods, due to probe labeling (e.g., a single quencher), can lead to cross-reactions, reducing detection specificity. Furthermore, existing methods have a high miss rate for low-abundance mutations (e.g., 1 copy / μL), and the detection cycle is insufficient to meet the rapid clinical diagnostic needs.
[0011] This application aims to form a primer pair with high specificity for BRAF V600E through probe modification optimization, digital PCR quantitative technology and specific selection of artificial sequences, thereby improving detection efficiency.
[0012] In addition, on the one hand, there are differences in understanding among those skilled in the art; on the other hand, the inventor studied a large number of documents and patents when making the present invention, but due to space limitations, not all details and contents are listed in detail. However, this does not mean that the present invention does not have the characteristics of these prior arts. On the contrary, the present invention already has all the characteristics of the prior art, and the applicant reserves the right to add relevant prior art to the background art. Summary of the Invention
[0013] Based on the above technical problems, the present invention relates to a method, primers and kit for quantitative detection of human BRAF gene V600E mutation based on digital PCR. For samples with low abundance mutations or low copies, the technical solution involved in the present invention can improve detection accuracy (reduce the probability of missed detection) while improving detection efficiency (shortening the detection cycle and increasing detection throughput). The present invention optimizes the primer probe to improve its specificity. Specifically, the 5' end of the internal reference gene is modified with HEX and the 3' end is modified with BHQ1. The 16 bases on the right side of the 5' end of the primer are modified with ROX, and the 3' end is modified with BHQ2. The 16 bases on the right side of the 5' end of the probe are modified with ROX, and the 3' end is modified with BHQ2.
[0014] To achieve the above-mentioned purpose, the technical solution adopted by the present invention to solve the technical problem is:
[0015] A primer-probe set for quantitative detection of the human BRAF gene V600E mutation based on digital PCR, comprising an upstream primer, a downstream primer, and a probe targeting the human BRAF gene V600E mutation sequence, wherein the upstream primer is provided with a sequence as shown in SEQ ID NO.20 from its 5' end; and the probe is provided with a sequence as shown in SEQ ID NO.21 from its 5' end.
[0016] According to a preferred embodiment, the primers comprise the nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.
[0017] Preferably, V600E-F: GAGTGAGCGCAGACGAAACAGACAACTGTTCAAA CTGATGG (SEQ ID NO. 1); V600E-R: TGAAGACCTCACAGTAAAAATAGGT (SEQ ID NO. 2); V600E-P: CGTCTGCGCTCACTCTCTAGCTACAGAGAA (SEQ ID NO. 3).
[0018] Preferably, the probes include a wild-type probe of the V600E gene, a mutation site of the V600E gene (c.1799_1800delinsAT), a mutation site of the V600E gene (c.1799_1800delinsAC) and / or a mutation probe of the mutation site of the V600E gene (c.1798_1799delinsAA).
[0019] Preferably, the primers used to amplify the internal reference gene sequence comprise the nucleotide sequences shown as SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6.
[0020] Preferably, ACTB-F: AACTGGAACGGTGAAGGTGACA (SEQ ID NO. 4); ACTB-R: TCCTGTAACAACGCATCTCATA (SEQ ID NO. 5); ACTB-P: AGCATCCCCCAAAGTTCACAATGT (SEQ ID NO. 6).
[0021] According to a preferred embodiment, the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quencher group.
[0022] Preferably, the fluorescent group includes one or more of ALEX-350, FAM, VIC, TET, CAL FluorGold 540, JOE, HEX, CALFluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CALFluor Red 635, Quasar 670, CY3, CY5, CY5.5, and Quasar 705.
[0023] Preferably, the quencher group comprises one or more of DABCYL, BHQ, ECLIPSE, and TAMRA. A kit for quantitatively detecting the human BRAF gene V600E mutation based on digital PCR comprises the aforementioned primers. Preferably, the BHQ is BHQ-1 or BHQ-2.
[0024] According to a preferred embodiment, the kit further comprises 1 part of a template, 6 parts of a forward primer and 1 to 6 parts of a reverse primer in terms of molar concentration.
[0025] Another aspect of the present invention relates to the use of the above primers in detecting the V600E mutation of the human BRAF gene.
[0026] According to a preferred embodiment, the application includes detecting sample DNA using the above primers or a kit containing the above primers.
[0027] According to a preferred embodiment, the genome in the sample to be tested is derived from human blood, urine, cerebrospinal fluid, saliva, aqueous humor and / or feces.
[0028] Another aspect of the present invention relates to a method for quantitatively detecting the human BRAF gene V600E mutation based on digital PCR. Figure 1 As shown, the method comprises the following steps:
[0029] The sample to be tested, reaction solution and primers are mixed.
[0030] PCR reaction and detection of fluorescence signal.
[0031] According to a preferred embodiment, the PCR reaction program is: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 20 s, and annealing at 56°C for 60 s, for a total of 45 cycles.
[0032] According to a preferred embodiment, the reaction solution includes 1 part template, 6 parts forward primer and 1 to 6 parts reverse primer in terms of molar concentration. Preferably, the reaction solution includes 600 nM forward primer, 100 nM reverse primer and 100 nM template.
[0033] According to a preferred embodiment, the reaction solution comprises 2×PCR reaction buffer, DNA polymerase, probe, forward primer, reverse primer, nucleic acid template and ultrapure water. Preferably, the reaction solution comprises 12.5uL of 2×PCR reaction buffer, 3U of DNA polymerase, 250nM of probe, 600nM of forward primer, 100nM of reverse primer, 6 to 10uL of nucleic acid template and ultrapure water to make up to 25μL of surplus. More preferably, the reaction solution comprises 12.5uL of 2×PCR reaction buffer, 3U of DNA polymerase, 250nM of probe, 600nM of forward primer, 100nM of reverse primer, 6uL of nucleic acid template and ultrapure water to make up to 25μL of surplus.
[0034] Another aspect of the present invention relates to a device for quantitative detection of human BRAF gene V600E mutation based on digital PCR, the device comprising a data acquisition unit and a data processing unit;
[0035] The data acquisition unit is used to perform the following steps: using the genome of the sample to be tested as a template, performing digital PCR using the primer probe set for quantitative detection of the human BRAF gene V600E mutation based on digital PCR, and then performing fluorescence signal detection;
[0036] The data processing unit is used to perform the following operations: interpreting the results after digital PCR processing.
[0037] According to a preferred embodiment, the digital PCR reaction system comprises 1 part of template, 6 parts of forward primers and 1 to 6 parts of reverse primers in terms of substance concentration.
[0038] According to a preferred embodiment, the reaction procedure of digital PCR comprises:
[0039] Pre-denaturation at 95°C for 5 min;
[0040] Denaturation at 94°C for 20 s and annealing at 56°C for 60 s were performed for a total of 45 cycles.
[0041] According to a preferred embodiment, the genome in the sample to be tested is derived from human blood, urine, cerebrospinal fluid, saliva, aqueous humor and / or feces.
[0042] The present invention combines vibrating droplet-generated digital PCR (dPCR) technology with innovative methodological optimization (artificial sequence), demonstrating significant technical advantages and clinical application value in the detection of human BRAF gene V600E mutation.
[0043] 1. This invention utilizes vibrating droplet generation technology to partition the reaction system into thousands of independent reaction units, achieving absolute quantification of target molecules based on the Poisson distribution principle. Compared to traditional qPCR, this technology improves the detection sensitivity of low-abundance mutations (such as ctDNA in liquid biopsies) to 0.01%, making it particularly suitable for the precise detection of low-frequency mutations such as BRAF V600E. Furthermore, the independent containment of the droplets effectively isolates interference from PCR inhibitors (such as ethanol and EDTA), enhancing detection stability in complex samples such as blood and sputum.
[0044] 2. The primer set involved in the present invention targets the conserved region of the BRAF gene, avoids cross-reaction with homologous sequences, and solves the compatibility problem in multiplex detection through artificial sequence optimization. In addition, through annealing temperature gradient experiments (55-65°C) and cycle number optimization (35-45 cycles), amplification efficiency and background signal control are balanced to ensure effective amplification of low-concentration templates and avoid accumulation of nonspecific products.
[0045] The primer set and detection method involved in the present invention have targeted detection accuracy for tumor diseases caused by BRAF gene V600E mutation, such as melanoma, papillary thyroid carcinoma, colorectal cancer and non-small cell lung cancer.
[0046] Specifically, the BRAF V600E mutation rate in melanoma is as high as 50-60%, especially in patients with cutaneous melanoma, where the mutation rate can reach 88%. In particular, brain metastases have extremely low circulating tumor DNA (ctDNA) abundance due to blood-brain barrier restrictions, making them easily missed by traditional ARMS-PCR (sensitivity of approximately 1%). However, the present invention improves sensitivity to 0.01% by optimizing primer sets and detection methods, and can detect mutations as low as 0.13% in the blood, thereby enabling early detection and early warning of tumor metastases in specific locations. Furthermore, artificial sequence design shortens probe binding length, reduces cross-reaction with wild-type sequences, and improves detection specificity in mixed or poorly differentiated samples. This is of significant significance for the classification of melanoma pathological subtypes with significantly different BRAF mutation rates, avoiding false negatives due to tissue heterogeneity.
[0047] For papillary thyroid carcinoma sampled by fine needle aspiration, a single fine needle aspiration often leads to Sanger sequencing failure due to insufficient sample size (e.g., cell number). The digital PCR involved in the present invention not only reduces the sample size requirement, but also improves sensitivity and reduces the secondary puncture rate.
[0048] In the field of colorectal cancer detection, 40% of BRAF-mutated colorectal cancer patients are accompanied by microsatellite instability-high (MSI-H). This association is due to the persistent activation of the MAPK pathway caused by the BRAF mutation (for example, indirectly triggering mismatch repair deficiency through epigenetic changes). The technical solution of the present invention simultaneously analyzes BRAF mutations and MSI status in a single reaction system (HEX\ROX\CY5 multi-channel highly specific quantitative PCR), avoiding the sample loss of traditional step-by-step testing (for example, IHC detection of MMR protein followed by PCR verification of MSI). It is particularly suitable for advanced patients with limited formalin-fixed paraffin-embedded tissue (multi-gene combined testing, such as BRAF+KRAS+NRAS). BRIEF DESCRIPTION OF THE DRAWINGS
[0049] Figure 1 This is a specific implementation flow chart of the present invention;
[0050] Figure 2 This is a graph showing the quantitative results of the ROX channel of primer set 1 involved in the present invention;
[0051] Figure 3 This is a graph showing the quantitative results of the ROX channel of primer set 2 involved in the present invention;
[0052] Figure 4 This is a graph showing the quantitative results of the ROX channel of primer set 3 involved in the present invention;
[0053] Figure 5 This is a graph showing the quantitative results of the ROX channel of primer set 4 involved in the present invention;
[0054] Figure 6 This is a graph showing the quantitative results of the ROX channel of primer set 5 involved in the present invention;
[0055] Figure 7 CY5 channel quantitative results of blank control, negative control, positive control and samples of primer set 1 involved in the present invention;
[0056] Figure 8 This is a graph showing the quantitative results of the blank control, negative control, positive control, and sample of primer set 1 of the present invention;
[0057] Figure 9 This is the quantitative result of the CY5 channel using primer set 1 after sample dilution;
[0058] Figure 10 This is the quantitative result of the HEX channel using primer set 1 after sample dilution. DETAILED DESCRIPTION
[0059] In the description of the present invention, terms are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly indicate the number of technical features indicated. In the description of the present invention, "plurality" means two or more, unless otherwise specifically defined.
[0060] The data acquisition unit includes a fluorescence signal detection component and a PCR injection component. It uses vibration droplet generation technology to divide the genomic DNA template to be tested into 20,000 to 100,000 independent microreaction units (such as oil-in-water droplets or microfluidic chip wells). After the amplification process is completed, the endpoint fluorescence signal of each droplet is collected based on the fluorescence signal detection component (fully automatic optical scanning system).
[0061] The data processing unit can preferably be a server, personal terminal or other device integrated with data processing. The data processing unit is equipped with an algorithm for converting and analyzing fluorescence signals for result interpretation.
[0062] The present invention employs a methodological approach in which an artificial sequence is designed on the probe and an artificial sequence is also incorporated into the upstream primer. The two artificial sequences are naturally complementary. When a single primer binds to the template, the two artificial sequences are more easily bound due to their distance, making it easier for the probe to bind, making mutations more easily detected. Furthermore, due to the design of the artificial sequence, the probe bound to the template is also shorter, resulting in no stem-loops. Consequently, the sensitivity and specificity of detecting the human BRAF gene V600E mutation using this primer-probe combination have been significantly improved (100%).
[0063]
[0064] The designs of the mutation sites in the following examples are all based on SEQ ID NO.19.
[0065] The experimental purpose of the following examples is to design specific primers and fluorescent probes for the human BRAF gene V600E mutation, and to use the vibrating droplet generation digital PCR technology to quantitatively detect the human BRAF gene V600R mutation in patient pathological tissues or specimens.
[0066] The artificial sequence set in the present invention is essentially a pair of complementary sequences: GAGTGAGCGCAGACG (SEQ ID NO. 20); CGTCTGCGCTCACTCT (SEQ ID NO. 21). This pair of artificial sequences is specifically suitable for genetic detection of the human BRAF gene.
[0067] Example 1
[0068] This example relates to the verification of the amplification efficiency of primer sets 1 to 5.
[0069] 1. Experimental Methods
[0070] In this example, vibrating droplet-generated digital PCR technology was used to divide the sample to be tested into many independent, parallel PCR reaction units, some of which contained the target molecule (positive), while others did not (negative). After the amplification phase, when no target sequence was present, there was no signal accumulation. The accumulation of the final fluorescent signal was used to detect the human BRAF gene V600E mutation.
[0071] There are 5 primer sets consisting of probes, forward primers, and reverse primers, as shown in Table 1.
[0072] Table 1. Primer sets
[0073]
[0074] The sample (nucleic acid template) corresponding to each primer set corresponds to the sample number in Table 2 below, and the mutation site of each sample number is shown in the position in Table 2.
[0075] Table 2. Reaction systems of each group
[0076]
[0077]
[0078] Note: MT indicates mutant; WT indicates wild type.
[0079] Prepare a reaction system containing the primer probe set of the present invention, the specific system is shown in Table 2:
[0080] Table 3. Reaction system
[0081] Reagent components concentration 2× PCR reaction buffer 1× DNA polymerase 3U probe 250nM Forward primer 600nM Reverse primer 100nM Nucleic acid template / Ultrapure water Fill to 25 μL
[0082] After preparing the micro-reaction unit on the digital PCR, PCR amplification was performed. The specific amplification program is shown in Table 3:
[0083] Table 4. PCR amplification program
[0084]
[0085] 2. Experimental Results and Analysis
[0086] (1) Using primer sets 1 to 5, digital PCR was performed on different test samples (without reverse transcription process), and each test was repeated twice.
[0087] The V600E (c.1799T>A) mutant plasmid was used as a positive control, and water was used as a blank control. Photography was performed at 40°C.
[0088] As shown in Table 5 and the amplification results of primer set 1 Figure 2 As shown, in primer set 1, using V600E-MT as a template, the copy numbers detected by ROX channel were 16.8 and 11.8, respectively, while using water and V600E-WT as templates, the copy numbers detected by ROX channel were both 0.
[0089] As shown in Table 5 and the amplification results of primer set 1 Figure 3 As shown, in primer set 2, using V600E-MT as a template, the copy numbers detected by the ROX channel were 9.46 and 7.67, respectively, while using water as a template, the copy numbers detected by the ROX channel were 0.13 and 0.12; using V600E-WT as a template, the copy numbers detected by the ROX channel were 1.34 and 2.19.
[0090] As shown in Table 5 and the amplification results of primer set 1 Figure 4 As shown, in primer set 3, using V600E-MT as a template, the copy numbers detected by ROX channel were 27.56 and 28.57, respectively, while using water as a template, the copy numbers detected by ROX channel were 0.13; using V600E-WT as a template, the copy numbers detected by ROX channel were 1.96 and 1.84.
[0091] As shown in Table 5 and the amplification results of primer set 1 Figure 5As shown, in primer set 4, using V600E-MT as a template, the copy numbers detected by ROX channel were 19.37 and 17.37, respectively, while using water as a template, the copy numbers detected by ROX channel were all 0; using V600E-WT as a template, the copy numbers detected by ROX channel were 0.4 and 1.29.
[0092] As shown in Table 5 and the amplification results of primer set 1 Figure 6 As shown, in primer set 5, using V600E-MT as a template, the copy numbers detected by ROX channel were 33.87 and 27.93, respectively, while using water as a template, the copy numbers detected by ROX channel were all 0; using V600E-WT as a template, the copy numbers detected by ROX channel were 0.99 and 1.08.
[0093] The above experimental results show that the V600E mutation detection primers designed according to this technical solution all showed a certain detection effect. In particular, primer group 1 showed high specificity and was able to accurately identify and detect the mutation of the V600E site.
[0094] Table 5. Amplification results of each group
[0095]
[0096] Note: MT indicates mutant; WT indicates wild type.
[0097] Example 2
[0098] This example involves verification of the amplification efficiency of primer set 1 at different sites.
[0099] 1. Experimental Methods
[0100] In this example, vibrating droplet-generated digital PCR technology was used to divide the sample to be tested into many independent, parallel PCR reaction units, some of which contained the target molecule (positive), while others did not (negative). After the amplification phase, when no target sequence was present, there was no signal accumulation. The accumulation of the final fluorescent signal was used to detect the human BRAF gene V600E mutation.
[0101] This example uses the reaction system and amplification procedure described in Example 1 above, employing primers from primer set 1. Samples 1 to 4 were introduced separately, and digital PCR was performed on the different test samples (without reverse transcription). Samples 1 to 4 were each tested twice, a blank control was tested twice, and the positive and negative controls were tested once each. Based on the experiments in this example, the efficiency of primer set 1 designed in this technical solution for detecting the V600E mutation (particularly c.1799T>A) was verified.
[0102] 2. Experimental Results and Analysis
[0103] (1) Sample 1 is BRAF V600 WT; Sample 2 is 50% mutated BRAF V600K (c.1798_1799delinsAA); Sample 3 is 50% mutated BRAF V600D (c.1799_1800delinsAC); Sample 4 is 50% mutated BRAF V600D (c.1799_1800delinsAT).
[0104] The V600E (c.1799T>A) mutant plasmid was used as a positive control, water was used as a blank control, and nucleic acid extracted from 293T cell lines was used as a negative control. The images were taken at 40°C. Figure 7 and 8 As shown, samples 1 to 4 all tested negative in the CY5 channel and positive in the HEX channel; the positive control V600E (c.1799T>A) tested positive in the CY5 channel, but normal and undetectable in the HEX channel; the negative control tested negative in the CY5 channel, but positive in both HEX channels; and the blank control tested normal and undetectable in both channels. This result demonstrates that the replacement of the fluorescent group does not affect the detection effect of the technical solution of the present invention. This result also shows that the replacement of the fluorescent group in the primer probe set has no effect on its amplification effect.
[0105] The result for the V600E mutation in the positive control was 18.3 (sample number 22); the results for the V600E mutation in all other samples were 0, indicating that it was not detected. The experimental results (Table 6) demonstrate that the V600E (c.1799T>A) mutation detection primers designed according to this technical solution can specifically detect the V600E (c.1799T>A) mutation without cross-talking to other similar sequences.
[0106] Table 6. V600E (c.1799T>A) mutation detection results
[0107]
[0108] Example 3
[0109] This embodiment relates to a micro-detection verification experiment after sample dilution.
[0110] The BRAF V600 WT sample was used to dilute the V600E (c.1799T>A) mutant plasmid to 1 copy / ul. The diluted sample was subjected to digital PCR detection using the reaction system shown in Table 1 of Example 1 [primer set 1, F: GAGTGAGCGCAGACGaaaCAGACAACTGTTCAAACTGATGG; R: TGAAGACCTCACAGTAAAAATAGGT; P: CGTCTGCGCTCACTCT(ROX)CTAGCTACAGAGAA(BHQ2)] and the amplification program shown in Table 2. The detection was repeated 21 times.
[0111] Water was used as a blank control and BRAF V600 WT was used as a negative control. Figure 9 and 10 As shown, 21 1 copies / ul V600E (c.1799T>A) mutant plasmids were all positive in the CY5 channel and the HEX channel; the blank control had normal results in both channels and no detection; the negative control BRAF V600 WT was negative in the CY5 channel and positive in the HEX channel.
[0112] Table 7 shows that the V600E (c.1799T>A) mutation detection primers designed according to the present technical solution have good detection sensitivity.
[0113] Table 7. V600E (c.1799T>A) mutation detection results
[0114]
[0115]
[0116] It should be noted that the above-described specific embodiments are illustrative only. Those skilled in the art may devise various solutions based on the disclosure of the present invention, and such solutions fall within the scope of the present invention and are intended to be protected by the present invention. Those skilled in the art should understand that the present description and its accompanying drawings are intended to be illustrative only and are not intended to limit the scope of the claims. The scope of protection of the present invention is defined by the claims and their equivalents.
Claims
1. A primer-probe combination for quantitative detection of human BRAF gene V600E mutation based on digital PCR, characterized in that: The primer-probe combination comprises an upstream primer, a downstream primer and a probe targeting the V600E mutation sequence of the human BRAF gene, wherein: The nucleotide sequence of the upstream primer is as shown in SEQ ID NO. 1; The nucleotide sequence of the downstream primer is as shown in SEQ ID NO.2 The nucleotide sequence of the probe is shown in SEQ ID NO.
3.
2. The primer-probe combination for quantitative detection of human BRAF gene V600E mutation based on digital PCR according to claim 1, characterized in that: The 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quencher group; The fluorescent group includes one of ALEX-350, FAM, VIC, TET, CAL FluorGold 540, JOE, HEX, CAL FluorOrange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL FluorRed 635, Quasar 670, CY3, CY5, CY5.5, and Quasar 705; The quenching group includes one of DABCYL, BHQ, ECLIPSE, and TAMRA, The 16th base at the 5' end of the probe is modified with a fluorescent group.
3. A kit for quantitative detection of human BRAF gene V600E mutation based on digital PCR, characterized in that: The kit comprises the primer probe set for quantitative detection of human BRAF gene V600E mutation based on digital PCR according to claim 1 or 2.
4. A device for quantitative detection of human BRAF gene V600E mutation based on digital PCR, characterized in that: The device includes a data acquisition unit and a data processing unit; The data acquisition unit is configured to perform the following operations: Using the genome in the sample to be tested as a template, digital PCR is performed using the primer probe set for quantitative detection of the human BRAF gene V600E mutation based on digital PCR according to claim 1 or 2, followed by fluorescence signal detection; The data processing unit is configured to perform the following operations: Interpret the results after digital PCR processing.
5. The device for quantitative detection of human BRAF gene V600E mutation based on digital PCR according to claim 4, characterized in that: The digital PCR reaction procedure includes: Pre-denaturation at 95°C for 5 min; Denaturation at 94°C for 20 s and annealing at 56°C for 60 s were repeated for a total of 45 cycles.
6. The device for quantitative detection of human BRAF gene V600E mutation based on digital PCR according to claim 4 or 5, characterized in that: The genome in the sample to be tested is derived from human blood, urine, cerebrospinal fluid, saliva, aqueous humor and / or feces.
Citation Information
Patent Citations
Kit for detecting mutation of V600E locus of BRAF (v-taf mourine sarcoma viral oncogene homolog B1) gene
CN111304329A
Epitaxial probe type qPCR detection method for SNV
CN113846147A