Polypeptide pka15 having immunomodulatory efficacy and use thereof
By developing the 15-amino acid peptide pka15, the problem of significant side effects of existing drugs in the treatment of inflammatory bowel disease and allergic diseases has been solved, achieving significant improvement in symptoms and protection of the gastrointestinal mucosa, and providing a low-cost and efficient treatment option.
Patent Information
- Application Number
- CN202510448381.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-10
- Publication Date
- 2026-02-17
- Estimated Expiration
- 2045-04-10
AI Technical Summary
In the existing technology, polypeptide drugs have problems such as large side effects and insignificant efficacy when treating inflammatory bowel disease and allergic diseases.
A polypeptide pka15 composed of 15 amino acids was developed, which has immunomodulatory effects, can significantly reduce the number of macrophages and neutrophils at the site of inflammation, inhibit macrophage proliferation, and can be used to prepare drugs to alleviate and/or treat inflammatory bowel disease and allergic diseases. The preparation is simple and non-cytotoxic.
The peptide pka15 significantly improves the symptoms of inflammatory bowel disease, protects the gastrointestinal mucosa, reduces the number of cells at the site of inflammation, reduces side effects, is low in cost, has good efficacy, and is suitable for the preparation of a variety of immunomodulatory drugs.
Smart Images

Figure CN120157743B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of polypeptides, in particular to a polypeptide pka15 with immunomodulatory efficacy and application thereof. BACKGROUND
[0002] The immune system plays a crucial role in maintaining life activities, which is mainly responsible for recognizing and eliminating foreign invaders (such as viruses, bacteria and parasites) and diseased cells (such as cancer cells) in the body. Through a series of complex cellular and molecular mechanisms, the immune system can distinguish between "self" and "non-self" substances, thereby initiating appropriate immune responses to protect the body from infection and disease. However, when the immune function is too strong or is out of balance, it can lead to a variety of diseases, such as autoimmune diseases and allergic reactions. In these cases, the immune system mistakenly attacks normal cells and tissues, causing inflammation and tissue damage. For example, in rheumatoid arthritis, the immune system attacks the joints, causing pain and dysfunction. Allergic reactions, such as asthma and allergic rhinitis, are overreactions to substances in the environment that should be harmless, such as pollen.
[0003] Inflammatory Bowel Disease (IBD) is a common immune inflammatory disease characterized by chronic or recurrent intestinal inflammation, mainly including two types: Crohn's Disease (CD) and Ulcerative Colitis (UC). Crohn's disease can affect any part of the digestive tract, from the mouth to the anus; while ulcerative colitis mainly affects the colon and rectum. Since IBD does not usually kill patients, but there is still no cure for drugs and methods, IBD is also known as "the immortal cancer". IBD not only has a serious impact on the quality of life of patients, but also brings significant economic burden. It is estimated that about 6.5 million people worldwide suffer from IBD, and the incidence is rising. In industrialized countries, the cost of treatment and management of IBD can be as high as billions of dollars per year.
[0004] In order to regulate excessive immune response, common treatment methods include glucocorticoids and non-steroidal anti-inflammatory drugs. These methods, although having certain curative effect on relieving the symptoms of autoimmune and inflammatory diseases, are often accompanied by obvious side effects and low drug safety. Glucocorticoids have strong anti-inflammatory and immunosuppressive effects, but long-term use can cause serious side effects, such as metabolic disorders, osteoporosis, immunosuppression and endocrine disorders. Non-steroidal anti-inflammatory drugs can effectively relieve inflammation and pain, but may cause gastrointestinal discomfort, impaired kidney function and other problems.
[0005] Polypeptides are molecules composed of short chains of amino acids and have a variety of biological functions, including acting as hormones, neurotransmitters, and immunomodulators. In the medical field, specific polypeptides can be designed to modulate the immune system, with the advantages of potentially high selectivity and low toxicity. Compared with traditional drugs, polypeptide drugs are usually more selective because they can precisely target specific cell receptors or molecules, thereby reducing the risk of side effects. The rapid biodegradability of polypeptides also reduces the risk of long-term toxicity. In the field of immunomodulation, this selectivity and low toxicity make polypeptide drugs strong candidates for the development of new immunomodulatory treatment strategies. However, there are currently few effective polypeptide drugs for immune diseases, and there is still a significant gap in the development of polypeptide drugs for the treatment of immune diseases, with a relatively limited product line of clinically valuable products, thus showing a broad industrialization prospect and application value.
[0006] Therefore, it is of great significance to develop new polypeptide immunomodulatory drugs with high specificity and low side effect risk for the treatment and / or diagnosis of immune diseases. SUMMARY
[0007] In view of the deficiencies of the prior art and actual needs, the purpose of the present application is to provide a polypeptide pka15 and its application, the polypeptide pka15 is composed of 15 amino acids, has immunomodulatory efficacy, can significantly reduce the number of macrophages and neutrophils at the inflammation site and inhibit the proliferation of macrophages, and can significantly improve the symptoms of IBD, has the efficacy of protecting the digestive tract mucosa or improving the damage of the digestive tract mucosa, and can be used for preparing drugs for relieving and / or treating autoimmune diseases and allergic diseases caused by inflammation, such as drugs for relieving and / or treating inflammatory bowel disease and drugs for protecting and / or repairing the damage of the digestive tract mucosa; and it is simple to prepare, has no cytotoxicity, and is a polypeptide preparation, which is convenient for subsequent clinical application and promotion, has low drug cost and good efficacy.
[0008] In order to achieve the above-mentioned purpose, the present application provides the following technical scheme:
[0009] In a first aspect, the present application provides a polypeptide pka15, which has:
[0010] (I) the amino acid sequence shown as SEQ ID NO: 1; or
[0011] (II) an amino acid sequence having at least 90% sequence identity to the amino acid sequence shown as SEQ ID NO: 1, obtained by substituting, deleting, adding and / or replacing 1 or 2 amino acids based on the amino acid sequence shown as (I); the polypeptide having the amino acid sequence of (II) has the same biological function as the polypeptide pka15 having the amino acid sequence shown as SEQ ID NO: 1.
[0012] In a second aspect, the present invention provides a nucleic acid molecule encoding the polypeptide pka15.
[0013] In some embodiments of the present invention, the nucleic acid molecule has:
[0014] (I) A nucleotide sequence as shown in SEQ ID NO: 2; or
[0015] (II) The complementary nucleotide sequence of the nucleotide sequence shown in SEQ ID NO: 2; or
[0016] (III) A nucleotide sequence that encodes the same protein as the nucleotide sequence described in (I) or (II), but differs from the nucleotide sequence of (I) or (II) due to the degeneracy of the genetic code; or
[0017] (IV) A nucleotide sequence that has at least 90% sequence identity with the nucleotide sequences described in (I), (II) or (III).
[0018] In a third aspect, the present invention provides a recombinant vector comprising a nucleic acid molecule encoding the polypeptide pka15.
[0019] In a fourth aspect, the present invention provides a host cell comprising a nucleic acid molecule encoding the polypeptide pka15 or the recombinant vector.
[0020] In some embodiments of the present invention, the host cell is a prokaryotic system host cell.
[0021] In some embodiments of the present invention, the host cell of the prokaryotic system is Escherichia coli.
[0022] In a fifth aspect, the present invention provides a fusion protein having a protein tag attached to the N-terminus and / or C-terminus of the peptide pka15, and having the same biological function as the peptide pka15.
[0023] In a sixth aspect, the present invention provides the use of the aforementioned polypeptide pka15, nucleic acid molecules, recombinant vectors, or host cells in the preparation of immunomodulatory agents, which are drugs for relieving and / or treating autoimmune diseases and allergic diseases caused by inflammation.
[0024] In some embodiments of the present invention, the autoimmune diseases and / or allergic diseases include IBD, psoriasis, dermatitis, etc.
[0025] In some embodiments of the present invention, the agents for relieving and / or treating autoimmune diseases and allergic diseases caused by inflammation include drugs that reduce the number of macrophages and neutrophils at the site of inflammation and inhibit the proliferation of macrophages.
[0026] In a seventh aspect, the present invention provides the use of the aforementioned polypeptide pka15, nucleic acid molecule, recombinant vector, host cell, and fusion protein in the preparation of medicaments for alleviating and / or treating inflammatory bowel disease and for protecting and / or repairing the gastrointestinal mucosa, which increases the number of goblet cells in the mucosal injury area, reduces the intestinal lumen area, and improves the histopathological features of the intestinal tissue.
[0027] In an eighth aspect, the present invention provides a pharmaceutical composition comprising the aforementioned polypeptide pka15, a nucleic acid molecule, a recombinant vector or host cell, and a pharmaceutically acceptable carrier and / or excipient.
[0028] In a ninth aspect, the present invention provides a medical device comprising the said polypeptide pka15 and an acceptable carrier.
[0029] Compared with the prior art, the present invention has the following beneficial effects:
[0030] This invention involves in-depth research and screening to obtain a novel polypeptide pka15. Experiments have shown that it can significantly reduce the number of macrophages and neutrophils at the site of inflammation and inhibit macrophage proliferation. At the same time, it can also significantly improve IBD symptoms and has the effect of protecting the gastrointestinal mucosa or improving gastrointestinal mucosal damage. It can be used to prepare drugs for relieving and / or treating autoimmune diseases and / or allergic diseases caused by inflammation, such as drugs for relieving and / or treating inflammatory bowel disease and drugs for protecting and / or repairing gastrointestinal mucosa damage.
[0031] The polypeptide pka15 of this invention can be synthesized using genetic engineering technology or chemical methods such as solid-phase synthesis. It is easy to prepare in large quantities, its synthesis is simple and it can be prepared into polypeptide preparations, which facilitates subsequent clinical application and promotion. It has no toxic side effects, significant effects and good stability. As a polypeptide preparation, it has better safety than glucocorticoids and non-steroidal immunomodulatory drugs, and the drug cost is lower and the efficacy is better.
[0032] Furthermore, the peptide pka15 provided by this invention can also be used as a reagent in immunological research, providing a model for a better understanding of the mechanisms of immune regulation and offering new ideas for discovering immunomodulatory drugs with high specificity and low risk of side effects for the treatment and / or diagnosis of immune diseases. Attached Figure Description
[0033] The accompanying drawings, which are provided to further illustrate this application and form part of this application, illustrate exemplary embodiments of this application and are used to explain this application, but do not constitute a limitation thereof.
[0034] In the attached diagram:
[0035] Figure 1 Mass spectra of peptide pka15 (peptide 15aa) and its amidated form (peptide 15aa-amidated).
[0036] Figure 2 The HPLC purity analysis chromatograms are for peptide pka15 (peptide 15aa) and the amidated peptide pka15 (peptide 15aa-amidation).
[0037] Figure 3 Fluorescence micrographs of zebrafish yolk sac neutrophils after processing with peptide pka15 (peptide 15aa) and amidated peptide pka15 (peptide 15aa-amidation).
[0038] Figure 4 A bar chart showing the effect of peptide pka15 (peptide 15aa) and amidated peptide pka15 (peptide 15aa-amidation) on the number of neutrophils in the yolk sac of zebrafish.
[0039] Figure 5 Fluorescence micrographs of zebrafish yolk sac macrophages after processing with peptide pka15 (peptide 15aa) and amidated peptide pka15 (peptide 15aa-amidation).
[0040] Figure 6 This is a bar chart showing the effect of peptide pka15 (peptide 15aa) and amidated peptide pka15 (peptide 15aa-amidation) on the number of macrophages in zebrafish yolk sacs.
[0041] Figure 7 The graph shows the effect of peptide pka15 (peptide 15aa) and amidated peptide pka15 (peptide 15aa-amidation) on inhibiting the proliferation of RAW264.7 cells.
[0042] Figure 8 This is a bar chart showing the intestinal lumen area of zebrafish after sample processing;
[0043] Figure 9 A bar chart showing the number of goblet cells in the zebrafish intestine after sample treatment;
[0044] Figure 10 A bar chart showing the number of neutrophils in the zebrafish gut after sample processing;
[0045] Figure 11 This is a typical image of a zebrafish intestinal tissue pathological section after sample processing.
[0046] It should be noted that these accompanying drawings and textual descriptions are not intended to limit the scope of the invention in any way, but rather to illustrate the concept of the invention to those skilled in the art through specific embodiments. Detailed Implementation
[0047] To more clearly illustrate the overall concept of this application, a detailed description is provided below with reference to the accompanying drawings and embodiments. Numerous specific details are set forth in the following description to provide a more thorough understanding of the invention. However, it will be apparent to those skilled in the art that the invention can be practiced without one or more of these details. In other instances, certain technical features well-known in the art have not been described to avoid confusion with the invention.
[0048] In this invention, unless otherwise stated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art.
[0049] Unless otherwise specified, the practice of this invention will employ conventional techniques of cell biology, molecular biology (including recombinant technologies), microbiology, biochemistry, and immunology, which are within the capabilities of those skilled in the art. This technique is well explained in the literature, such as *Molecular Cloning: A Laboratory Manual*, 2nd edition (Sambrook et al., 1989); *Oligonucleotide Synthesis* (edited by M.J. Gait, 1984); *Animal Cell Culture* (edited by R.R. Freshney, 1987); *Methods in Enzymology* (Academic Press, Inc.); *Handbook of Experimental Immunology* (edited by D.M. Weir and C.C. Blackwell); *Gene Transfer Vectors for Mammalian Cells* (edited by J.M. Miller and M.P. Calos, 1987); *Current Protocols in Molecular Biology* (edited by F.M. Mausubel et al., 1987); and *PCR: The Polymerase Chain Reaction*. The references cited in the references are: "Reaction" (Mullis et al., ed., 1994); and "Current Protocols in Immunology" (JEColigan et al., ed., 1991), each of which is explicitly incorporated herein by reference.
[0050] Where no specific techniques or conditions are specified in the embodiments, they shall be performed in accordance with the conventional techniques or conditions described in the literature within this art or in accordance with the product manual.
[0051] Unless otherwise specified, in the following embodiments, reagents or instruments whose manufacturers are not indicated are all conventional products that can be purchased through legitimate channels.
[0052] In a first aspect, a novel polypeptide pka15 with immunomodulatory effects is provided. This polypeptide consists of 15 amino acids, hence the name pka15. Its amino acid sequence is shown in SEQ ID NO: 1: N-terminus - LYILEEEEENTKRKD - C-terminus. In this invention, the C-terminus and / or N-terminus of the polypeptide pka15 preferably also have an amide group modification, specifically LYILEEEEENTKRKD-NH2; the amide group modification is used to ensure the stability of the polypeptide without affecting its activity.
[0053] This invention also includes fragments, derivatives, and analogs of the peptide pka15. As used herein, the terms "fragment," "derivative," and "analyte" refer to peptides that substantially retain the same biological function or activity as the peptide pka15 of this invention. Fragments, derivatives, or analogs of the peptide pka15 may be:
[0054] (1) A polypeptide in which one or two conserved or non-conserved amino acid residues (preferably conserved amino acid residues) are substituted, wherein such substituted amino acid residues may or may not be encoded by the genetic code, or
[0055] (2) A polypeptide having a substituent group in one or more amino acid residues, or
[0056] (3) A polypeptide formed by fusing a mature polypeptide with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol), or
[0057] (4) A polypeptide formed by fusing an additional amino acid sequence to this polypeptide sequence (such as a leader sequence, secretory sequence, or sequence used to purify this polypeptide, or a proteogen sequence, or a fusion protein). According to the definition of this invention, these fragments, derivatives, and analogs are within the scope known to those skilled in the art.
[0058] In this invention, peptide pka15 can refer to a peptide having the sequence shown in SEQ ID NO: 1. The term also includes peptide pka15 with one or more amino acids added to its C-terminus and / or N-terminus. For example, in the art, substitution with amino acids of similar or comparable properties generally does not alter the function of the protein. Similarly, adding one or more amino acids to the C-terminus and / or N-terminus generally does not alter the function of the protein. The term also includes active fragments and active derivatives of peptide pka15.
[0059] This invention also includes modified peptides (typically without altering the primary structure) formed by modifying one or more amino acids to increase peptide stability, half-life, or enhance efficacy. These modifications include chemically derived forms of peptides, such as amidation or carboxylation, whether in vivo or in vitro. Glycosylation is also included. Modified forms also include sequences containing phosphorylated amino acid residues (such as phosphotyrosine, phosphotyserine, and phosphotythreonine). Furthermore, it includes peptides modified to improve hydrolysis resistance or optimize solubility.
[0060] The polypeptide of the present invention can also form complexes with other functional molecules, the complexes comprising: the polypeptide of the present invention, and functional molecules linked to the polypeptide.
[0061] In some embodiments, the functional molecule is a marker with tracer function, including but not limited to fluorescent dyes, MRI contrast agents, radioactive contrast agents, magnetic particles, or chemical reagents with coloring function. For example, the marker or functional small molecule with tracer function may be fluorescein isothiocyanate (FITC).
[0062] In some embodiments, the functional molecule is a functional small molecule, including inorganic small molecules and organic small molecules, with a molecular weight of less than 1000 Daltons.
[0063] In some embodiments, the functional molecule is a functional macromolecule, such as a functional polypeptide (e.g., an antibody) or a functional nucleic acid; preferably, the functional nucleic acid includes, but is not limited to, plasmids, siRNA, DNA, oligonucleotides, miRNA, antisense nucleic acids, etc.
[0064] In a second aspect of the invention, a nucleic acid molecule encoding the polypeptide pka15 is provided, the nucleotide sequence of which is shown in SEQ ID NO: 2, and is as follows:
[0065] CTGTACATCCTGGAAGAAGAAGAAGAAAACACCAAACGTAAAGAC.
[0066] In a third aspect, the present invention provides a recombinant vector comprising the aforementioned nucleic acid molecules. The vector of the present invention can be a cloning vector or an expression vector. In some embodiments, the vector of the present invention is, for example, a plasmid, a granule, a bacteriophage, a Cosmid, etc.
[0067] In a fourth aspect of the invention, a host cell is provided that comprises the aforementioned nucleic acid molecules or recombinant vectors. Such host cells include, but are not limited to, prokaryotic cells such as Escherichia coli cells, and eukaryotic cells such as yeast cells, insect cells (e.g., Sf9 cells), plant cells, and animal cells (e.g., mammalian cells, such as mouse cells, human cells, etc.).
[0068] In a fifth aspect of the invention, a method for preparing the polypeptide pka15 is provided, comprising chemical synthesis and synthesis by genetic engineering methods. The method involves culturing host cells of the invention under conditions allowing expression of the polypeptide pka15, and recovering the polypeptide or a variant thereof from the cultured host cell culture.
[0069] In a sixth aspect of the invention, the use of the aforementioned polypeptide pka15, nucleic acid molecule, recombinant vector, or host cell in the preparation of an immunomodulatory drug for relieving and / or treating autoimmune diseases and allergic diseases caused by inflammation is provided.
[0070] The main contribution of this invention lies not only in obtaining the peptide pka15, but also in verifying the function of the peptide.
[0071] In some specific embodiments of the present invention, it has been determined that the polypeptide pka15 can significantly reduce the number of macrophages and neutrophils at the site of inflammation and can significantly inhibit the proliferation of macrophages, thus exhibiting anti-inflammatory effects.
[0072] In other specific embodiments of the present invention, the exogenously synthesized peptide pka15 can reduce the intestinal lumen area, decrease the number of intestinal neutrophils, and increase the number of intestinal goblet cells. Furthermore, histopathological sections of intestinal tissue from a zebrafish gastrointestinal mucosal injury model show that peptide pka15 treatment can improve intestinal distension and increase the number of intestinal folds and villi. In summary, the peptide pka15 of the present invention can significantly improve the intestinal histopathological characteristics of an IBD model, effectively alleviate and / or treat IBD, and has the effect of protecting the digestive tract mucosa or repairing digestive tract mucosal damage.
[0073] The above research results indicate that the peptide pka15 can be used to prepare drugs for autoimmune diseases and / or allergic diseases, or to prepare drugs that reduce the number of macrophages and neutrophils at sites of inflammation and inhibit macrophage proliferation. In some specific embodiments, the autoimmune disease is inflammatory bowel disease.
[0074] In a seventh aspect of the invention, a pharmaceutical composition for immunomodulation is provided, comprising the polypeptide pka15 (or a variant thereof) of the invention, a nucleic acid molecule, a recombinant vector or host cell, and a pharmaceutically acceptable carrier and / or excipient.
[0075] Furthermore, the present invention also provides a medical device comprising the aforementioned polypeptide pka15 and an acceptable carrier.
[0076] The polypeptides (or variants thereof) or pharmaceutical compositions of the present invention can be formulated into any dosage form known in the medical field, such as tablets, pills, suspensions, emulsions, solutions, gels, capsules, powders, granules, elixirs, lozenges, suppositories, injections (including injectable solutions and lyophilized powders), etc. In some embodiments, the polypeptides (or variants thereof) or pharmaceutical compositions of the present invention can be formulated into injectable solutions or lyophilized powders.
[0077] Furthermore, the polypeptides or variants thereof of the present invention may be present in the pharmaceutical composition in unit dose form for ease of administration.
[0078] The polypeptides or variants thereof or pharmaceutical compositions of the present invention may be administered by any suitable method known in the art, including but not limited to oral, oral, sublingual, ocular, topical, parenteral, rectal, intrathecal, intracytoplasmic reticulum groove, groin, intrabladder, topical (e.g., powder, ointment, or drops), or nasal routes. However, for many therapeutic uses, the preferred route / method of administration is parenteral administration (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular). Those skilled in the art will understand that the route and / or method of administration will vary depending on the intended purpose. In a preferred embodiment, the polypeptides (or variants thereof) or pharmaceutical compositions of the present invention are administered by intravenous infusion or injection.
[0079] The polypeptides (or variants thereof) or pharmaceutical compositions provided by this invention can be used alone or in combination, or in combination with other pharmaceutically active agents (e.g., immunomodulators). Such other pharmaceutically active agents can be applied before, simultaneously with, or after the administration of the polypeptides (or variants thereof) or pharmaceutical compositions of this invention.
[0080] The term "pharmaceutical-grade carriers and / or excipients" as used herein refers to carriers and / or excipients that are pharmacologically and / or physiologically compatible with the subject and the active ingredient, and are well-known in the art (see, for example, Remington's Pharmaceutical Sciences, Edited by Gennaro AR, 19th ed. Pennsylvania: Mack Publishing Company, 1995), and includes, but is not limited to: pH adjusters, surfactants, ionic strength enhancers, osmotic pressure maintaining agents, delayed absorption agents, diluents, adjuvants, preservatives, stabilizers, etc. For example, pH adjusters include, but are not limited to, phosphate buffers. Surfactants include, but are not limited to, cationic, anionic, or nonionic surfactants, such as Tween-80. Ionic strength enhancers include, but are not limited to, sodium chloride. Osmotic pressure maintaining agents include, but are not limited to, sugars, NaCl, and their analogues. Delayed absorption agents include, but are not limited to, monostearates and gelatin. Diluents include, but are not limited to, water, aqueous buffers (such as buffered saline), alcohols, and polyols (such as glycerol), etc. Adjuvants include, but are not limited to, aluminum adjuvants (e.g., aluminum hydroxide), Freund's adjuvants (e.g., complete Freund's adjuvant), etc. Preservatives include, but are not limited to, various antibacterial and antifungal agents, such as thimerosal, 2-phenoxyethanol, p-paraben, chlorobutanol, phenol, sorbic acid, etc. Stabilizers have the meaning commonly understood by those skilled in the art, which stabilize the desired activity of the active ingredient in the drug (e.g., inhibitory activity against PSD-95 ubiquitination), including but not limited to monosodium glutamate, gelatin, SPGA, sugars (e.g., sorbitol, mannitol, starch, sucrose, lactose, dextran, or glucose), amino acids (e.g., glutamic acid, glycine), proteins (e.g., dried whey, albumin, or casein) or their degradation products (e.g., lactalbumin hydrolysate), etc.
[0081] In use, a safe and effective amount of the polypeptide or polynucleotide encoding it, or an expression vector containing the polynucleotide or recombinant cells expressing the polypeptide, is administered to an animal (such as a human, mouse, zebrafish, etc.), wherein the safe and effective amount is typically at least about 1 gram per kilogram of body weight. Of course, the specific dosage should also consider factors such as the route of administration and the patient's health condition, which are all within the scope of a skilled physician's expertise.
[0082] The precise effective dose for a given subject depends on the subject's body size and health condition, the nature and severity of the illness, and the chosen therapeutic agent and / or combination of therapeutic agents. For a given condition, the effective dose can be determined using routine laboratory tests, and the clinician is capable of making the judgment.
[0083] The inventors have discovered for the first time that the polypeptide pka15 can be prepared using any well-known techniques in this field, such as solid / liquid phase synthesis or by expressing and purifying the protein through gene recombination using genetic engineering techniques.
[0084] The present invention will be further illustrated below with reference to specific embodiments, but the embodiments do not limit the present invention in any way.
[0085] Example 1: Biosynthesis of peptide pka15
[0086] Recombinant vector construction
[0087] The DNA sequence shown in SEQ ID NO: 2 was synthesized, and the NcoI restriction site sequence CCATGG and the enterokinase restriction site sequence DDDDK were introduced at the 5' end upstream of the synthesized sequence, and the stop codon TAA and the BamHI restriction site sequence GGATCC were introduced at the 3' end downstream of the sequence.
[0088] The synthesized DNA sequence was digested using two restriction endonucleases, BamHI and NcoI, following the instructions for use of the restriction endonucleases. After digestion, agarose gel electrophoresis was performed, and the target size bands were recovered by gel excision.
[0089] The pET-28a(+) vector was digested using two restriction endonucleases, BamHI and NcoI, following the instructions for use of the restriction endonucleases. After digestion, agarose gel electrophoresis was performed, and the target size bands were recovered by gel excision.
[0090] The vector recovered after enzyme digestion was ligated to the DNA fragment using T4 DNA ligase. The ligation method was performed according to the T4 DNA ligase instruction manual.
[0091] The ligation product was transformed into competent E. coli DH5α cells to obtain a single clone strain. Colony PCR was performed to verify the single clone strain using primers pka15F:GTAGAGGATCGAGATCTCGAT and pka15R:AAGGGGTTATGCTAGTTATTGC.
[0092] After culturing colony-positive PCR-verified strains in LB broth containing kanamycin, plasmids were extracted. The plasmid extraction method was performed according to the plasmid extraction kit instructions.
[0093] The extracted plasmid was sequenced and verified using primer pka15F. If the verification was successful, the pET-28a-pka15 recombinant plasmid was obtained. The plasmid concentration was determined using an ultra-micro UV spectrophotometer, and then stored at -80°C.
[0094] Host cell construction
[0095] The recombinant plasmid pET-28a-pka15 was transformed into the host cell strain Escherichia coli Rosetta(DE3) using the CaCl2 chemical transformation method. The transformation method was performed in accordance with "Molecular Cloning: A Laboratory Manual", and a single clone strain was obtained.
[0096] The single-clone strain was validated by colony PCR using primers pka15F:GTAGAGGATCGAGATCTCGAT and pka15R:AAGGGGTTATGCTAGTTATTGC. Correct validation yielded a host strain containing the pET-28a-pka15 recombinant plasmid.
[0097] After culturing the host strain containing the pET-28a-pka15 recombinant plasmid in LB liquid medium containing kanamycin, sterile glycerol (final concentration 15%) was added, mixed well, aliquoted into cryovials, labeled, and stored in a freezer at -80°C.
[0098] The pka15 gene fragment with restriction enzyme sites at both ends was amplified by PCR using upstream and downstream primers containing restriction enzyme site sequences. The pka15 gene fragment and the pET-28a vector were digested with restriction endonucleases, and the digested fragments were then recovered. The vector and gene fragment were ligated using T4 DNA ligase, and the resulting mixture was transformed into *E. coli* for positive clone selection. After plasmid sequencing verification of positive clones, the pka15 gene was constructed into the pET-28a plasmid to obtain the first recombinant vector. The first recombinant vector was the pET-28a plasmid containing the pka15 gene, hereinafter referred to as pET-28a-pka15; the host cell used in all embodiments and comparative examples in this application was *E. coli*.
[0099] a. Transform pET-28a-pka15 into Escherichia coli (e.g., competent E.coli DH5α cells); pick a single clone of pET-28a-pka15 or a strain preserved at -80℃ and inoculate it into a small test tube containing 5 mL of LB liquid medium (Kan+, 100 μg / mL), and incubate overnight at 37℃ and 220 rpm to obtain the seed culture.
[0100] b. Transfer the seed culture to 50 mL of LB liquid medium (Kan+, 100 μg / mL) and incubate at 37 °C and 220 rpm on a shaker for reactivation.
[0101] c. Transfer the reactivated bacterial culture to 800 mL of 2YT liquid medium (Kan+, 100 μg / mL) at an inoculation rate of 1%, and incubate at 37 °C and 220 rpm on a shaker until the OD 600 is approximately 0.6-0.8.
[0102] d. Lower the temperature of the shaker to 16℃-18℃. After the temperature of the cultured bacterial solution has decreased, add isopropylthio-β-D-galactoside (IPTG) to a final concentration of 0.5mM and induce expression for 14-16h.
[0103] e. After expression is complete, collect the above culture solution into a bottle, pre-cool the centrifuge to 4°C, and centrifuge at 5500 rpm for 10 min.
[0104] f. Remove the supernatant, add 30 mL of protein purification buffer, and resuspend the bacterial cells using a vortex mixer.
[0105] g. Centrifuge the resuspended bacterial cells again at 5500 rpm for 10 min. Discard the supernatant, add 30 mL of protein purification buffer, and vortex to resuspend the bacterial cells (there should be no solid particles). Transfer the resuspended cells to a 50 mL centrifuge tube and store at -80°C.
[0106] Purification of peptide pka15
[0107] a. Preparation of crude enzyme solution: 1.0 g of collected wet bacterial cells were added to 20 mL of equilibration buffer for resuspending. The resuspended cells were then disrupted using a cell disruptor set to 300 W to prevent excessive temperature from affecting enzyme activity. The disruption program was set to run for 1 second and pause for 3 seconds. The disruption solution was continuously cooled with an ice-water mixture until the suspension became clear and transparent. The disruption solution was then centrifuged at 12000 rpm for 10 min at 4 °C. The supernatant was collected and filtered through a 0.22 μm filter to obtain the crude enzyme solution. All proteins used in this study were unlabeled, and the predicted isoelectric point (PI) was 6.35; therefore, weakly basic anionic groups were selected for purification.
[0108] b. Regeneration and equilibration of ion exchange chromatography column: Protein purification was performed using a DEAE Sepharose Fast Flow anion exchange column. The column was washed with a high-salt buffer (containing 1-2 M NaCl) at a flow rate of 1 mL / min for 3-5 column volumes, then washed with 0.1 M NaOH for 3-5 column volumes, then washed with elution buffer for 3-5 column volumes, and finally washed with equilibration buffer until the detector parameters such as OD280, conductivity, and pH value stabilized.
[0109] c. Loading and elution of crude enzyme solution: Load the prepared crude enzyme solution at a loading rate of 0.5 mL / min, with a loading volume of 20 mL. After loading, wash with equilibration buffer for 3–5 column volumes, then elute using an increasing salt concentration gradient with elution buffer. Collect each fraction and confirm by protein electrophoresis. If the purification effect is unsatisfactory, this step can be repeated, or purification can be performed again using agarose gel G75 FF.
[0110] d. Protein concentration: The collected target protein was concentrated using ultrafiltration membrane concentration method. A 1 kDa protein concentration tube was used for concentration, and the protein was centrifuged at 5000 rpm for 30 min at 4 °C.
[0111] e. Protein desalting: Dilute the concentrated protein with an appropriate amount of PBS buffer (20mM, pH 7.0) and place it in a dialysis bag (molecular weight cutoff 8-14kDa). Use 20mM, pH 7.0 PBS dialysate and let it stand overnight at 4°C. The dialysate needs to be changed once during the process.
[0112] f. Preservation of ion exchange chromatography columns: After use, rinse the ion exchange chromatography column with 1M NaOH for 3-5 column volumes, then rinse with 20% ethanol, and store in a refrigerator at 4°C.
[0113] Electrophoretic analysis of peptide pka15
[0114] a. Protein sample preparation: Add the purified protein solution and 5× loading buffer at a ratio of 1:4 (v / v), heat in boiling water for 10 min, and set aside for later use.
[0115] b. Sample loading and electrophoresis: Place the precast protein gel (Genscript, SurePAGE, 4%–20%) in the electrophoresis tank, and add the protein sample and marker to the sample wells of the protein gel using a pipette.
[0116] c. Staining and destaining: Remove the outer shell of the pre-cast gel after electrophoresis, and automatically destain and stain using a protein staining and destaining instrument for 15 minutes.
[0117] d. Gel image analysis: The stained and destained protein gels were photographed and saved using a gel imaging system.
[0118] Example 2: Chemical Synthesis of Peptide pka15
[0119] This embodiment uses solid-phase peptide synthesis (SPPS) to produce peptide pka15. SPPS involves sequentially coupling amino acids onto a resin to form a peptide chain. After sequence synthesis, the N-terminal Fmoc protecting group is first deprotected (or after N-terminal modification), followed by deprotection of the side chain protecting groups, cleaving the peptide from the resin.
[0120] 1) Coupling the first amino acid: Take an appropriate amount of modified resin, add the prepared amino acid solution and coupling reagent to the resin, and react for a period of time;
[0121] 2) Removal of Fmoc: After adding Pip / DMF solution for a period of time, remove the solvent by vacuum filtration;
[0122] 3) Washing: Add DMF to the resin (washing step), and remove the solvent by vacuum filtration;
[0123] 4) Resin test: Place test reagents A and B and a small amount of resin into a test tube. Then place the test tube in a metal bath for a few seconds and check if the resin color changes. If the resin color changes, the Fmoc group has been successfully removed;
[0124] 5) Amino acid condensation: Add the prepared amino acid solution to the resin. Then add the coupling reagent, shake well for a period of time, and remove the solvent by vacuum filtration;
[0125] 6) Repeat steps 2-5 until the synthesis of the last amino acid is complete.
[0126] This embodiment employs a conventional solid-phase peptide synthesis method, synthesizing peptides according to the amino acid sequence of SEQ ID NO:2. The accuracy and purity of the obtained peptides are analyzed by mass spectrometry and HPLC. The results are as follows: Figure 1 and 2 As shown, mass spectrometry analysis confirmed the correct amino acid composition, and the molecular weight of the obtained polypeptide pka15 was 1909.0 ( ). Figure 1 a) The molecular weight of the amidated polypeptide pka15 obtained was 1907.8 (a). Figure 1 b); The purity of the peptide pka15 obtained by HPLC was 95.04% ( Figure 2 a) The purity of the obtained amidation-modified polypeptide pka15 was 98.05%.
[0127] Example 3: Effects of peptide pka15 and amidated peptide pka15 on bacterial inflammation
[0128] 1. Testing materials
[0129] 1.1. Sample Preparation Information
[0130] Polypeptide pka15 was prepared as a stock solution of 2.00 mg / mL with PBS buffer and stored at 4°C.
[0131] The amidated modified polypeptide pka15 was prepared as a stock solution of 2.00 mg / mL with PBS buffer and stored at 4°C.
[0132] Positive control: Dexamethasone acetate, batch number B1828095, Shanghai Aladdin Biochemical Technology Co., Ltd., stored in a cool and dry place. It was prepared as a stock solution of 20.0 mg / mL with DMSO and stored at -20°C.
[0133] 1.2. Experimental animals
[0134] Zebrafish (Water quality: 200 mg of instant sea salt was added to every 1 L of reverse osmosis water, conductivity was 450 - 550 μS / cm; pH was 6.5 - 8.5; hardness was 50 - 100 mg / L CaCO3), provided by the breeding center of Huante Biotechnology. The license number for the use of experimental animals was: SYXK(Zhe)2022 - 0004. The feeding management met the requirements of international AAALAC accreditation (accreditation number: 001458). The IACUC ethical review number was: IACUC - 2024 - 7634 - 01.
[0135] Transgenic neutrophil green fluorescent zebrafish (MPX), purchased from the breeding center of Huante Biotechnology. The neutrophils of this strain showed green fluorescence under a fluorescence microscope, and were used for the observation and quantification of cell behavior. They were bred by natural paired mating. Zebrafish at 3 days post-fertilization (3dpf) were used for the evaluation of the anti-bacterial inflammation (neutrophil) efficacy of the samples.
[0136] Transgenic macrophage green fluorescent zebrafish, purchased from the breeding center of Huante Biotechnology. The macrophages of this strain showed green fluorescence under a fluorescence microscope, and were used for the observation and quantification of cell behavior. They were bred by natural paired mating. Zebrafish at 3dpf were used for the evaluation of the anti-bacterial inflammation (macrophage) efficacy of the samples.
[0137] 1.3. Instruments, consumables and reagents
[0138] Dissecting microscope (SZX7, OLYMPUS, Japan); Microinjector (IM300, Narishige, Japan); Pulling needle instrument (PC - 10, Narishige, Japan); Precision electronic balance (CP214, OHAUS, USA); CCD camera (VertA1, Shanghai Tusen Vision Technology Co., Ltd., China); Motorized focusing continuously variable fluorescence microscope (AZ100, Nikon, Japan); 6-well plate (Zhejiang Berambo Biotechnology Co., Ltd., China).
[0139] Dimethyl sulfoxide (DMSO, lot number BCCD8942, Sigma, Switzerland); LPS (lot number 127M4030V, Sigma, Israel); PBS phosphate buffer (catalog number BL601A, biosharp, China); methylcellulose (lot number C2004046, Shanghai Aladdin Biochemical Technology Co., Ltd., China).
[0140] 2. Detection Method
[0141] 2.1. Evaluation of antibacterial inflammatory (neutrophil) efficacy
[0142] 3dpf transgenic green fluorescent zebrafish (MPX) with neutrophils were randomly selected and placed in 6-well plates, with 30 fish treated in each well (experimental group). Samples were administered intravenously (dosages shown in Table 1). Positive controls were given dexamethasone acetate at doses of 10.0, 20.0, and 40.0 ng / fish. Normal and model control groups were also included. Each well contained 3 mL. After 1 h of sample pretreatment, except for the normal control group, all other experimental groups received LPS injection into the yolk sac to establish a zebrafish bacterial inflammation model. After 2 h of treatment at 28℃, 10 zebrafish from each experimental group were randomly selected and photographed under a fluorescence microscope. Data were analyzed and collected using NIS-Elements D 3.20 advanced image processing software. The number of neutrophils in the zebrafish yolk sac was analyzed, and the statistical analysis results of this index were used to evaluate the antibacterial anti-inflammatory efficacy of the samples. Statistical results are expressed as mean ± SE. Statistical analysis was performed using SPSS 26.0 software; p < 0.05 indicated statistical significance.
[0143] 2.2. Evaluation of antibacterial inflammatory (macrophage) efficacy
[0144] 30 zebrafish with 3dpf transgenic macrophages and green fluorescent fluorescence were randomly selected and placed in 6-well plates, with 30 zebrafish treated in each well (experimental group). Samples were administered intravenously (dosages shown in Table 2). Positive controls were given dexamethasone acetate at doses of 10.0, 20.0, and 40.0 ng / zebrafish. Normal and model control groups were also included. Each well contained 3 mL. After 1 h of sample pretreatment, except for the normal control group, all other experimental groups received LPS injection into the yolk sac to establish a zebrafish bacterial inflammation model. After 2 h of treatment at 28℃, 10 zebrafish from each experimental group were randomly selected and photographed under a fluorescence microscope. Data were analyzed and collected using NIS-Elements D 3.20 advanced image processing software. The fluorescence intensity of zebrafish yolk sac macrophages was analyzed, and the statistical analysis results of this index were used to evaluate the antibacterial anti-inflammatory efficacy of the samples. Statistical results are expressed as mean ± SE. Statistical analysis was performed using SPSS 26.0 software; p < 0.05 indicated statistical significance.
[0145] 3. Test Results
[0146] 3.1. Evaluation of antibacterial inflammatory (neutrophil) efficacy
[0147] Figure 3 and 4 The images show fluorescence micrographs of zebrafish yolk sac neutrophils after treatment with peptide pka15 (peptide 15aa) and amidated peptide pka15 (peptide 15aa-amidation), respectively, and a bar chart illustrating the effect of this treatment on the number of zebrafish yolk sac neutrophils. Figure 3 In the diagram, the yellow dashed box indicates the analysis site, and the green fluorescent dots represent neutrophils. Under the experimental conditions, the number of neutrophils in the yolk sac was significantly reduced, specifically manifested as a significant decrease in the fluorescence intensity of yolk sac macrophages. This indicates that both peptide pka15 and its amidated form reduced the number of neutrophils at the site of inflammation, demonstrating antibacterial inflammatory efficacy. The antibacterial inflammatory efficacy of the amidated peptide pka15 at doses of 10.0, 20.0, and 40.0 ng / tail was not statistically different from that of peptide pka15 alone at doses of 10.0, 20.0, and 40.0 ng / tail showed no statistically significant difference compared to peptide pka15. See Table 1 for details. Figure 4 .
[0148] Table 1. Results of the experiment evaluating the antibacterial inflammatory (neutrophil) efficacy of the samples (n=10)
[0149]
[0150]
[0151] Compared with the model control group, *p<0.05, **p<0.01, ***p<0.001
[0152] Figure 4 The figure shows the number of neutrophils in the yolk sac of zebrafish after sample treatment, where polypeptide 15aa represents pka15; compared with the model control group, *p<0.05, **p<0.01, ***p<0.001.
[0153] 3.2. Evaluation of antibacterial inflammatory (macrophage) efficacy
[0154] Figure 5 and 6 The image shows fluorescence micrographs of zebrafish yolk sac macrophages after treatment with peptide pka15 (peptide 15aa) and amidated peptide pka15 (peptide 15aa-amidation), respectively, and a bar chart illustrating the effect of this treatment on the number of zebrafish yolk sac macrophages. Figure 5In the diagram, the yellow dashed box indicates the analysis site, and the green fluorescent dots represent neutrophils. Under the experimental conditions, the number of yolk sac macrophages was significantly reduced, specifically manifested by a significant decrease in the fluorescence intensity of yolk sac macrophages. This indicates that both peptide pka15 and its amidated form reduced the number of macrophages at the site of inflammation, demonstrating antibacterial inflammatory efficacy. The amidated peptide pka15 showed no statistically significant difference in antibacterial inflammatory efficacy compared to peptide pka15 at doses of 10.0 and 20.0 ng / tail, but exhibited superior antibacterial inflammatory efficacy at a dose of 40.0 ng / tail. See Table 2 for details. Figure 6 .
[0155] Table 2. Results of the experiment evaluating the antibacterial and anti-inflammatory (macrophage) efficacy of the samples (n=10)
[0156]
[0157]
[0158] Compared with the model control group, **p<0.01, ***p<0.001
[0159] Compared to peptide pka15 at 40.0 ng / tail, # p<0.05
[0160] Figure 6 The figure shows the number of zebrafish yolk sac macrophages after sample treatment, where peptide 15aa represents pka15; compared with the model control group, **p<0.01, ***p<0.001; compared with peptide pka15 40.0 ng / tail, #p<0.05.
[0161] Example 4: Effects of peptide pka15 and amidated peptide pka15 on macrophage proliferation
[0162] 1.1 Materials: Raw264.7 mouse macrophages, 1640 medium, high glucose DMEM, FBS, penicillin and streptomycin, PBS, and two peptides (peptide 15aa and peptide 15aa-amidation).
[0163] 1.2 Methods: Four concentrations of peptide solution (0.125 mg / ml, 0.25 mg / ml, 0.5 mg / ml, 1 mg / ml) and a control without peptide were added to 96-well plates and Raw264.7 cells to observe cell proliferation.
[0164] Step 1.3:
[0165] a: Preparation of polypeptide samples and preparation of stock solutions at various concentrations
[0166] The original peptide vials contain 5 mg / vial. Add 1 ml of PBS directly to the vial, then vortex to dissolve and mix thoroughly. The solution labeled A has a concentration of 5 mg / ml.
[0167] Take 150 μl of stock solution A and add it to 150 μl of PBS in a new EP tube and mix well. The solution concentration is 2.5 mg / ml. Label it as stock solution B.
[0168] Add 150 μl of B stock solution to 150 μl of PBS and mix well in a new EP tube. The solution concentration is 1.25 mg / ml, and this solution is labeled as C stock solution.
[0169] Add 150 μl of C stock solution to 150 μl of PBS and mix well in a new EP tube. The solution concentration is 0.625 mg / ml, and this solution is labeled as D stock solution.
[0170] b: Cell seeding in 96-well plates
[0171] Raw264.7 cells were seeded into 96-well plates at a density of 2 x 10⁶ cells per well. 3 Cells. 100 μl / well. Five replicates per group of cells, for a total of 25 wells. Incubate in a CO2 incubator, and add two different peptide reagents the following morning.
[0172] c: Before adding peptides to a 96-well plate, replace the medium with 80 μl of fresh cell culture medium per well.
[0173] The experiment was set up as follows: control group (20 μl PBS + 80 μl culture medium), experimental group (peptide concentration 0.125 mg / ml: peptide concentration), experimental group (peptide concentration 0.25 mg / ml: 20 μl C stock solution + 80 μl culture medium), experimental group (peptide concentration 0.5 mg / ml: 20 μl B stock solution + 80 μl culture medium), and experimental group (peptide concentration 1 mg / ml: 20 μl A stock solution + 80 μl culture medium).
[0174] d: MTT proliferation assay
[0175] 48 hours after adding the peptide, 10 μl of MTT reagent solution was added to each well of a 96-well plate and incubated at 37 degrees Celsius for 3 hours. The supernatant was then discarded, and 150 μl of formazan solubilizing solution was added to each well and the plate was placed on a shaker at room temperature for 10 minutes to dissolve. The OD value at 570 nm was then measured using a microplate reader.
[0176] e: Calculation of proliferation rate
[0177] Proliferation rate = (OD measurement well - OD zeroing well) / OD control * 100%
[0178] f: Statistical difference analysis
[0179] Using 5 replicates, one-way ANOVA analysis was performed on the results of 5 concentrations, and the Student-Newman-Keμls test was used for significant difference analysis. Different letters were used to represent the significant differences in cell proliferation caused by different concentrations.
[0180] 1.4 Results:
[0181] Figure 7 The evaluation of the inhibitory effect of polypeptide pka15 and amidated polypeptide pka15 on the proliferation of RAW264.7 cells is shown. The evaluation results show that both polypeptides have a significant inhibitory effect on the proliferation of mouse macrophages RAW264.7 ( Figure 7 ).
[0182] Example 5 Role of polypeptide pka15 and amidated polypeptide pka15 in assisting IBD treatment and relieving gastrointestinal mucosal injury
[0183] 1. Detection materials
[0184] 1.1. Sample preparation information
[0185] For polypeptide pka15, the solvent is standard dilution water.
[0186] Positive control: Prednisolone, white powder, batch number A2411035, Shanghai Aladdin Biochemical Technology Co., Ltd., the solvent is DMSO.
[0187] 1.2. Experimental animals
[0188] Zebrafish were all raised in fish culture water at 28°C (water quality: 200 mg of instant sea salt was added to every 1 L of reverse osmosis water, the conductivity was 450 - 550 μS / cm; the pH was 6.5 - 8.5; the hardness was 50 - 100 mg / L CaCO3), provided by the fish breeding center of Huante Biology, and the experimental animal use license number was: SYXK(Zhe)2022 - 0004. The feeding management met the requirements of international AAALAC certification (certification number: 001458), and the IACUC ethical review number was: IACUC - 2024 - 7587 - 01.
[0189] 1.3. Instruments, consumables and reagents
[0190] Dissecting microscope (SZX7, OLYMPUS, Japan); CCD camera (VertA1, Shanghai Tusen Vision Technology Co., Ltd., China); motorized focusing continuous zoom fluorescence microscope (AZ100, Nikon, Japan); precision electronic balance (CP214, OHAUS, America); 6-well plate (Zhejiang Beilanbo Biotechnology Co., Ltd., China); digital display horizontal decolorizing shaker (ZD-9556A, Taicang Hualida Experimental Equipment Co., Ltd., China); electronic constant temperature water bath (HHS-2S, Shanghai Kanglu Instrument Equipment Co., Ltd., China); microtome (KD2258, Jinhua Kedi Medical Instrument Co., Ltd., China); intelligent electric heating plate (400X280, Tianjin Laiyue Nag Laboratory Instrument Sales Co., Ltd., China); biological microscope (CX31, OLYMPUS, Japan).
[0191] Methylcellulose (batch number C2004046, Shanghai Aladdin Biochemical Technology Co., Ltd., China); Dimethyl sulfoxide (DMSO, batch number I2229063, Shanghai Aladdin Biochemical Technology Co., Ltd., China); TNBS (batch number 0000296416, Sigma, USA); Alcian blue (batch number BCBV8028, Sigma, Switzerland); 4% tissue cell fixative (batch number 240005013, Beijing Solarbio Science & Technology Co., Ltd., China); Glacial acetic acid (batch number A2425033, Shanghai Aladdin Biochemical Technology Co., Ltd., China); Anhydrous ethanol (batch number 20240312, Sinopharm Chemical Reagent Co., Ltd., China); dimethyl sulfoxide (DMSO, batch number I2229063, Shanghai Aladdin Biochemical Technology ... Benzene (batch number 20220105, Sinopharm Chemical Reagent Co., Ltd., China); Hematoxylin staining solution (batch number 20220120, Shanghai Yihe Biotechnology Co., Ltd., China); Eosin staining solution (batch number 20220120, Shanghai Yihe Biotechnology Co., Ltd., China); Dilute hydrochloric acid (batch number 20210104, Shenzhen Bolinda Technology Co., Ltd., China); Neutral resin (batch number 330A021, Beijing Solarbio Technology Co., Ltd., China); High-efficiency slicing paraffin (melting point 54-56℃, batch number 20201020, Shanghai Huayong Paraffin Co., Ltd., China); High-efficiency slicing paraffin (melting point 62-64℃, batch number 20210828, Shanghai Huayong Paraffin Co., Ltd., China).
[0192] 2. Detection Method
[0193] 2.1. Effect on intestinal lumen area
[0194] Wild-type AB strain zebrafish, 3 days post-fertilization (3 dpf), were randomly selected and encapsulated in 6-well plates, with 30 zebrafish treated in each well (experimental group). Except for the normal control group, all experimental groups were treated with TNBS (toluene-based saline) to establish a zebrafish gastrointestinal mucosal injury model. After treatment at 28℃ for 2 days, the TNBS was removed, and samples were administered in water at three peptide concentration gradients: 6 μg / mL, 30 μg / mL, and 150 μg / mL. The positive control was prednisolone at a concentration of 25.0 μg / mL. A normal control group and a model control group were also included, with a volume of 3 mL per well. After another 2 days of treatment at 28℃, 10 zebrafish from each experimental group were randomly selected and photographed under a dissecting microscope. Images were saved, and data were collected using NIS-Elements D 3.20 advanced image processing software. The intestinal lumen area of the zebrafish was analyzed, and the statistical analysis results of this index were used to evaluate the efficacy of the samples in alleviating and / or treating gastrointestinal mucosal injury. Statistical results are expressed as mean ± SE. Statistical analysis was performed using SPSS 26.0 software, and p < 0.05 indicated that the difference was statistically significant.
[0195] 2.2. Effects on the number of intestinal neutrophils
[0196] 3dpf transgenic green fluorescent zebrafish with neutrophils (MPX strain) were randomly selected and placed in 6-well plates, with 30 zebrafish treated in each well (experimental group). Except for the normal control group, all experimental groups were treated with TNBS in water to establish a zebrafish gastrointestinal mucosal injury model. After treatment at 28℃ for 2 days, the TNBS was removed, and samples were administered in water (three peptide concentration gradients: 6 μg / mL, 30 μg / mL, and 150 μg / mL). The positive control was prednisolone at a concentration of 25.0 μg / mL. A normal control group and a model control group were also included, with a volume of 3 mL per well. After another 2 days of treatment at 28℃, 10 zebrafish from each experimental group were randomly selected and photographed under a fluorescence microscope. Images were saved, and data were collected using NIS-Elements D 3.20 advanced image processing software. The number of neutrophils in the zebrafish intestine was analyzed, and the statistical analysis results of this index were used to evaluate the efficacy of the samples in alleviating and / or treating gastrointestinal mucosal injury. Statistical results are expressed as mean ± SE. Statistical analysis was performed using SPSS 26.0 software, and p < 0.05 indicated that the difference was statistically significant.
[0197] 2.3. Effects on the number of goblet cells in the intestine
[0198] Wild-type AB strain zebrafish (3dpf) were randomly selected and placed in 6-well plates, with 30 zebrafish treated in each well (experimental group). Except for the normal control group, all experimental groups were treated with TNBS (toluene-toluene saline) to establish a zebrafish gastrointestinal mucosal injury model. After treatment at 28℃ for 2 days, the TNBS was removed, and samples were treated with water at three peptide concentration gradients: 6 μg / mL, 30 μg / mL, and 150 μg / mL. The positive control was prednisolone at a concentration of 25.0 μg / mL. A normal control group and a model control group were also included, with a volume of 3 mL per well. After another 2 days of treatment at 28℃, the zebrafish in each group were fixed with 4% tissue cell fixative and then stained with Alcian blue. After staining, 10 zebrafish from each experimental group were randomly selected and photographed under a dissecting microscope. Images were saved, and data were collected using NIS-Elements D 3.20 advanced image processing software. The number of goblet cells in the zebrafish intestine was analyzed, and the statistical analysis results of this index were used to evaluate the efficacy of the samples in alleviating and / or treating gastrointestinal mucosal injury. Statistical results are expressed as mean ± SE. Statistical analysis was performed using SPSS 26.0 software, and p < 0.05 was considered statistically significant.
[0199] 2.4. Effects on intestinal histopathology
[0200] Wild-type AB strain zebrafish with a 3dpf growth rate were randomly selected and placed in 6-well plates, with 30 zebrafish treated in each well (experimental group). Except for the normal control group, all experimental groups were treated with TNBS dissolved in water to establish a zebrafish gastrointestinal mucosal injury model. After treatment at 28℃ for 2 days, the TNBS was removed, and the samples were treated with water-soluble TNBS (concentrations see [concentration details]). Figure 8 The positive control was prednisolone at a concentration of 25.0 μg / mL. A normal control group and a model control group were also set up, with a volume of 3 mL per well. After treatment at 28℃ for 2 days, zebrafish from each group underwent fixation, dehydration, embedding, sectioning, and H&E staining for intestinal histopathological examination to evaluate the efficacy of the samples in alleviating and / or treating gastrointestinal mucosal damage.
[0201] 3. Test Results
[0202] 3.1. Effect on intestinal lumen area
[0203] Under the experimental conditions described herein, the peptide pka15 significantly reduced gastrointestinal mucosal damage, specifically by decreasing the intestinal lumen area. See details... Figure 8 .
[0204] 3.2. Effects on the number of intestinal neutrophils
[0205] Under the experimental conditions described herein, the peptide pka15 significantly reduced gastrointestinal mucosal damage, specifically by decreasing the number of intestinal neutrophils. See details... Figure 9 .
[0206] 3.3. Effects on the number of goblet cells in the intestine
[0207] Under the experimental conditions described herein, the peptide pka15 significantly reduced gastrointestinal mucosal damage, specifically by increasing the number of intestinal goblet cells. See details... Figure 10 .
[0208] 3.4. Effects on intestinal histopathology
[0209] Under the experimental conditions, no obvious abnormalities were observed in the intestines of the normal control group. The intestines exhibited prominent folds, abundant villi of normal height, and tight connections between the intestinal epithelial cells, cilia, and mucosa. In the model control group, the intestinal folds were significantly reduced, the number and height of villi were significantly decreased, and the intestinal lumen was significantly dilated, indicating successful model establishment.
[0210] In the positive control group, the 25.0 μg / mL concentration of prednisolone showed significant improvement in intestinal lumen dilation and intestinal mucosal tissue, with a significant increase in the number of intestinal folds and intestinal mucosa, indicating that prednisolone has the effect of reducing gastrointestinal mucosal damage.
[0211] In the pka15 6.00 μg / mL group, the intestinal lumen was significantly dilated, with fewer intestinal folds, fewer intestinal villi, and decreased height, similar to the model control group. In the pka15 30.0 μg / mL group, intestinal lumen dilation was slightly improved, with an increase in the number of intestinal folds and villi. In the pka15 150 μg / mL group, the intestinal lumen was narrowed, the number of intestinal folds was significantly increased, and the number and height of intestinal villi were significantly improved; no obvious abnormalities were observed in the intestinal mucosa. Therefore, pka15 can significantly reduce gastrointestinal mucosal damage. See details. Figure 11 .
[0212] This invention first evaluated the immunomodulatory efficacy of peptide pka15 by injecting fluorescently labeled modified zebrafish embryos into the yolk sac and observing the responses of macrophages and neutrophils in different groups under PBS induction. The results showed that the novel peptide pka15 significantly reduced the number of macrophages and neutrophils at sites of inflammation. Simultaneously, peptide pka15 was added to mouse macrophages to assess its effect on mammalian immune cells. The results showed that peptide pka15 also significantly inhibited the proliferation of mouse macrophages. Therefore, peptide pka15 exhibits immunomodulatory effects on immune cells in both zebrafish and mice, and can be used in the preparation of immunomodulatory drugs.
[0213] Secondly, this invention, through oral administration to a TNBS-induced zebrafish IBD model, observed the effect of peptide pka15-amidation on the recovery of the digestive tract at different dosages. The results showed that peptide pka15 significantly reduced gastrointestinal mucosal damage, improving the zebrafish gastrointestinal mucosa and reducing inflammatory cell infiltration. Specifically, this was manifested in a reduction of intestinal lumen area, a decrease in the number of intestinal neutrophils, an increase in the number of intestinal goblet cells, and an improvement in intestinal histopathological features. These results indicate that peptide pka15 can significantly improve IBD symptoms, possessing the efficacy of protecting the digestive tract mucosa or improving digestive tract mucosal damage. It can be applied to the preparation of drugs for relieving and / or treating IBD, and is easy to mass-produce. Compared with existing drugs, this invention has lower cost, higher safety, and better efficacy.
[0214] Meanwhile, the peptide pka15 of this invention can also serve as a reagent for immunological research, providing a model for a better understanding of the mechanisms of immune regulation. This peptide pka15 exhibits a clear regulatory effect on immune cells; based on this, it can be used to prepare drugs and / or kits for immunotherapy and / or diagnosis, possessing broad application prospects and potential value in the biomedical field.
[0215] It should be noted that the embodiments described above are merely preferred embodiments of the present invention. For those skilled in the art, various modifications, improvements, and equivalent substitutions can be made to the present invention without departing from its principles, and such modifications, improvements, and equivalent substitutions are also considered to fall within the protection scope of the claims of the present invention.
Claims
1. A polypeptide pka15, characterized in that, Its amino acid sequence is shown in SEQ ID NO:
1.
2. A nucleic acid molecule encoding the polypeptide pka15 according to claim 1.
3. The nucleic acid molecule according to claim 2, characterized in that, have: (I) A nucleotide sequence as shown in SEQ ID NO: 2; or (II) The complementary nucleotide sequence of the nucleotide sequence shown in SEQ ID NO: 2; or (III) A nucleotide sequence that encodes the same protein as the nucleotide sequence described in (I) or (II), but is different from the nucleotide sequence of (I) or (II) due to the degeneracy of the genetic code.
4. A recombinant vector, characterized in that, It contains the nucleic acid molecule according to claim 2.
5. A host cell, characterized in that, It contains the nucleic acid molecule according to claim 2 or the recombinant vector according to claim 4.
6. A fusion protein having a protein tag attached to the N-terminus and / or C-terminus of the polypeptide pka15 of claim 1, and having the same biological function as the polypeptide pka15 of claim 1.
7. The use of the polypeptide pka15 as described in claim 1, or the amidated modified polypeptide pka15, in the preparation of antibacterial inflammatory drugs.
8. The use of the polypeptide pka15 as described in claim 1, or the amidated modified polypeptide pka15, in the preparation of adjuvant drugs for IBD treatment and for relieving gastrointestinal mucosal damage.
9. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the polypeptide pka15 according to claim 1, the nucleic acid molecule according to claim 2, the recombinant vector according to claim 4 or the host cell according to claim 5, and a pharmaceutically acceptable carrier and / or excipient.
10. A medical device, characterized in that, It comprises the polypeptide pka15 according to claim 1 and an acceptable vector.
Citation Information
Patent Citations
Polypeptide pka15 with function of inhibiting tumor cell proliferation and application of polypeptide pka15
CN120230181A