Engineering bacterium for producing HMB through biological fermentation and application of engineering bacterium

Abstract

The invention provides a recombinant strain for synthesizing HMB, application of the recombinant strain, and a method for performing whole-cell catalytic synthesis of HMB by using the strain. The recombinant bacterium is obtained by knocking out genes such as a fatty acid metabolism regulation factor fadR gene, a beta-ketoacyl-ACP synthase II gene FabF, a beta-ketoacyl-ACP synthase III gene FabH and the like and enhancing or inserting genes such as a fatty acyl coenzyme A synthetase gene fadD, a long-chain fatty acid transporter gene fadL, a short-chain fatty acid degradation regulation gene cluster gene atoSC and the like. A strain capable of producing HMB by using fatty acid or a substance containing a fatty acid component as a raw material is obtained. The strain has the prospect of green, efficient and industrial production of HMB by utilizing the capability of synthesizing HMB.

Description

Technical Field

[0001] The present invention relates to the technical fields of gene editing, genetically recombined edited microbial strains, synthetic biology, and microbial whole-cell catalysis. Specifically, it relates to a recombinant strain for generating HMB and a preparation method thereof. Background Art

[0002] β-Hydroxy-β-methylbutyric acid (HMB) is an important metabolite of L-leucine in mammals, which can change the balance of protein metabolism during the growth of new muscle tissues and has an anti-catabolic effect. HMB has been widely used as an animal feed additive, a human sports nutrition supplement, and a dietary food, and is expected to play an important role in cancer treatment. It can also be used for clinical treatment of muscle wasting diseases such as tumors and AIDS. The traditional method for producing HMB is chemical synthesis, but this method has problems such as toxic organic substances and multi-stage reactions, which does not conform to the concept of sustainable development.

[0003] In the prior art, a biological production process using β-methylbutyric acid (MBA) as a substrate and Galactomyces reessii as a cell factory has been developed, but this method has disadvantages such as high raw material and energy consumption, high cost, and complex operation.

[0004] Therefore, there is an urgent need in the prior art to develop a green biosynthesis pathway for HMB with high production efficiency. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a stable genetically recombined strain, which can prepare β-hydroxy-β-methylbutyric acid (HMB) with high conversion rate, low cost, and few side reactions through whole-cell catalysis.

[0006] According to an exemplary embodiment of the present disclosure, the present disclosure provides a recombinant Escherichia coli for synthesizing β-hydroxy-β-methylbutyric acid HMB, which comprises deletion, knockout, or inhibitory expression of the following gene clusters: fatty acid metabolism regulator fadR gene, β-ketoacyl-ACP synthase II gene fabF, β-ketoacyl-ACP synthase III gene fabH;

[0007] And it comprises enhancement or exogenous insertion of the following gene clusters: acyl-CoA synthetase gene fadD, long-chain fatty acid transporter gene fadL, short-chain fatty acid degradation regulatory gene cluster gene atoSC.

[0008] Optionally or alternatively, the recombinant Escherichia coli further comprises the following modifications:

[0009] Deletion, knockout or inhibitory expression of the following gene clusters: fumarate reductase flavoprotein A subunit gene frdA, NAD(P) transhydrogenase gene sthA; and

[0010] And enhancement or exogenous insertion of the following gene clusters: acetyl-CoA acetyltransferase atoB gene, 3-hydroxy-3-methylglutaryl-CoA synthase gene mvaS, 3-hydroxy-3-methylglutaryl-CoA hydratase gene liuC, glutaryl-CoA decarboxylase A subunit gene aibA, glutaryl-CoA decarboxylase B subunit gene aibB, acyl-CoA thioesterase gene paaI.

[0011] According to an exemplary embodiment of the present disclosure, the present disclosure provides a method for generating β-hydroxy-β-methylbutyric acid HMB, comprising: fermenting to produce HMB using the recombinant Escherichia coli described in any one of claims 1 to 2.

[0012] Optionally or alternatively, wherein the recombinant Escherichia coli ferments to produce HMB using a fatty acid or a substance containing a fatty acid component as a substrate. The fatty acids include saturated fatty acids such as stearic acid (C18), palmitic acid (C16), myristic acid (C14), lauric acid (C12), capric acid (C10), caprylic acid (C8) or hexanoic acid (C6); also include unsaturated fatty acids such as oleic acid (C18), linoleic acid (C18) and linolenic acid (C18); or include triglycerides mainly composed of fatty acids such as soybean oil, peanut oil, palm oil and olive oil, or include oil-containing waste such as kitchen waste oil and the like.

[0013] Optionally or alternatively, a polyoxyethylene ether Brij58 emulsifier is added during the fermentation of the recombinant Escherichia coli.

[0014] According to an exemplary embodiment of the present disclosure, the present disclosure provides a method for preparing a recombinant Escherichia coli capable of synthesizing β-hydroxy-β-methylbutyric acid HMB, comprising:

[0015] (1) Deletion, knockout or inhibitory expression: fatty acid metabolism regulator fadR gene, β-ketoacyl-ACP synthase II gene fabF, β-ketoacyl-ACP synthase III gene fabH; and

[0016] (2) Enhancement or exogenous insertion: acyl-CoA synthetase gene fadD, long-chain fatty acid transporter gene fadL, short-chain fatty acid degradation regulatory gene cluster gene atoSC.

[0017] Optionally or alternatively, the method further comprises:

[0018] Deletion, knockout, or inhibitory expression: fumarate reductase flavoprotein A subunit gene frdA, NAD(P) transhydrogenase gene sthA; and

[0019] Enhancement or exogenous insertion: acetyl-CoA acetyltransferase atoB gene, 3-hydroxy-3-methylglutaryl-CoA synthase gene mvaS, 3-hydroxy-3-methylglutaryl-CoA hydratase gene liuC, glutaryl-CoA decarboxylase A subunit gene aibA, glutaryl-CoA decarboxylase B subunit gene aibB, acyl-CoA thioesterase gene paaI

[0020] According to an exemplary embodiment of the present disclosure, the present disclosure provides the use of the strain described in any of the above aspects in the production of β-hydroxy-β-methylbutyric acid HMB.

[0021] The beneficial technical effects achieved by the present invention are as follows:

[0022] The present invention has developed a brand-new novel HMB production route based on the microbial fermentation method. This method can use inexpensive substances containing fatty acid components as substrates, and use microbial fermentation to directly synthesize high-purity HMB from scratch, with high conversion rate, low cost, and few side reactions. Detailed implementation mode

[0023] Definition

[0024] Unless otherwise defined or clearly indicated by the context, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art.

[0025] Throughout this specification and the appended claims, the words "comprising" and "including" and variations thereof shall be construed inclusively. That is, where the context allows, these words are intended to express that other elements or integers may be included that are not specifically recited.

[0026] The article "a / an" is used herein to refer to one or more (i.e., one or at least one of the grammatical objects of the article). For example, "an element / a kind of element" can mean one element / a kind of element or more than one element / more than one kind of element. When a noun (e.g., compound, additive, etc.) is mentioned in the singular form, it is intended to include the plural form. Thus, when referring to a specific part (e.g., "gene"), unless otherwise specified, this means "at least one" of the gene, e.g., "at least one gene".

[0027] Unless otherwise clearly indicated, the various embodiments of the present invention described herein can be combined crosswise.

[0028] The term "carbon source" refers to a source of carbon, preferably a carbon-containing compound or molecule, including sugars, glycerol, fatty acids, etc.

[0029] The term "cell" refers to a eukaryotic organism or a prokaryotic organism, preferably existing as a single cell. In the present invention, the cell can be recombinant Escherichia coli. That is, the recombinant cell is selected from the group of cells of the genus consisting of Escherichia coli.

[0030] As used herein, the term "recombinant" / "engineered" (e.g., referring to "recombinant Escherichia coli", "recombinant cell", "recombinant microorganism", and / or "recombinant strain") can refer to a cell, microorganism, or strain that contains a nucleic acid as a result of one or more genetic modifications. Simply put, the cell, microorganism, or strain contains a different combination of nucleic acids from one or more of its parents (any of them). To construct a recombinant cell, microorganism, or strain, one or more recombinant DNA techniques and / or one or more additional mutagenesis techniques can be used. For example, recombinant Escherichia coli and / or recombinant Escherichia coli cells can contain nucleic acids that are not present in the corresponding wild-type Escherichia coli and / or cells, and this nucleic acid has been introduced into the Escherichia coli or Escherichia coli cells using recombinant DNA techniques (i.e., transgenic Escherichia coli and / or cells), or this nucleic acid that is not present in the wild-type Escherichia coli and / or cells is the result of one or more mutations (e.g., using recombinant DNA techniques or another mutagenesis technique such as UV irradiation) in a nucleic acid sequence (such as a gene encoding a wild-type polypeptide) that is present in the wild-type Escherichia coli and / or Escherichia coli cells. In addition, the term "recombinant" can appropriately refer to, for example, a cell, microorganism, or strain from which a nucleic acid sequence has been removed using recombinant DNA techniques.

[0031] In this context, a recombinant Escherichia coli containing or having a certain activity is understood to mean that the recombinant Escherichia coli can contain one or more nucleic acid sequences encoding a protein having this activity. Thus, the recombinant Escherichia coli is allowed to functionally express this protein or enzyme.

[0032] The term "functionally express" means that there is functional transcription of the relevant nucleic acid sequence, allowing the nucleic acid sequence to actually be transcribed, for example, resulting in the synthesis of a protein.

[0033] As used herein, the term "transgenic" (e.g., referring to "transgenic Escherichia coli" and / or "transgenic cells") refers respectively to such Escherichia coli and / or cells that contain nucleic acids that are not naturally present in the Escherichia coli and / or cells and have been introduced into the Escherichia coli and / or cells using, for example, recombinant DNA techniques, such as recombinant yeast and / or cells.

[0034] As used herein, the term "mutation" with respect to a protein or polypeptide means that at least one amino acid has been replaced by a different amino acid, inserted into the amino acid sequence, or deleted from the amino acid sequence, as compared to the wild-type or naturally occurring protein or polypeptide sequence. The replacement, insertion, or deletion of amino acids can be achieved, for example, via mutagenesis of the nucleic acids encoding these amino acids. Mutagenesis is a well-known method in the art and includes, for example, site-directed mutagenesis by means of PCR or via oligonucleotide-mediated mutagenesis, as described in the following references: Sambrook et al., Molecular Cloning - A Laboratory Manual, 2nd Edition, Volumes 1-3 (1989), published by Cold Spring Harbor Publishing.

[0035] As used herein, the term "mutation" with respect to a gene means that at least one nucleotide in the nucleic acid sequence of the gene or its regulatory sequence has been replaced by a different nucleotide, inserted into the nucleic acid sequence, or deleted from the nucleic acid sequence, as compared to the wild-type or naturally occurring nucleic acid sequence. The replacement, insertion, or deletion of amino acids can be achieved, for example, via mutagenesis, resulting in, for example, the transcription of a protein sequence with a qualitatively or quantitatively altered function or the knockout of the gene. In the context of the present invention, "altered gene" has the same meaning as a mutant gene.

[0036] As used herein, the term "gene" refers to a nucleic acid sequence that can be transcribed into mRNA and then translated into a protein. A gene encoding a particular protein refers to one or more nucleic acid sequences encoding such a protein.

[0037] As used herein, the terms "nucleic acid" or "nucleotide" refer to monomeric units in a polymer of deoxyribonucleotides or ribonucleotides (i.e., polynucleotides) in single-stranded or double-stranded form, and unless otherwise restricted, encompass known analogs having the essential properties of natural nucleotides in that they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides (e.g., peptide nucleic acids). For example, a certain enzyme defined by a nucleotide sequence encoding the enzyme includes (unless otherwise restricted) nucleotide sequences that hybridize to a reference nucleotide sequence encoding the enzyme. A polynucleotide can be the full-length or a subsequence of a native or heterologous structural or regulatory gene. Unless otherwise indicated, the term includes reference to the specified sequence as well as its complementary sequence. Thus, DNA or RNA having a backbone modified for reasons of stability or otherwise is a polynucleotide as contemplated herein. In addition, DNA or RNA containing rare bases (such as inosine) or modified bases (such as tritylated bases) (to name but two examples) are polynucleotides as used herein. It will be understood that a wide variety of modifications have been made to DNA and RNA for many useful purposes known to those of skill in the art. The term polynucleotide as used herein includes such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells (including in particular simple and complex cells).

[0038] The terms "nucleotide sequence" and "nucleic acid sequence" are used interchangeably herein. An example of a nucleic acid sequence is a DNA sequence.

[0039] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to, for example, a polymer of amino acid residues displayed by an amino acid sequence. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers. The essential property of such analogs of naturally occurring amino acids is that when incorporated into a protein, the protein is specifically reactive with antibodies raised against the same protein consisting entirely of naturally occurring amino acids. The terms "polypeptide", "peptide" and "protein" also include modifications, including but not limited to glycosylation, lipid attachment, sulfation, γ-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation.

[0040] The term "enzyme" as used herein refers to a protein having catalytic function. In cases where a protein catalyzes a biological reaction, the terms "protein" and "enzyme" may be used interchangeably herein. When an enzyme is referred to by reference to an Enzyme Classification (EC), the EC is a classification where enzymes are classified or can be classified according to the enzyme nomenclature provided by the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB), which can be found at http: / / www.chem.qmul.ac.uk / iubmb / enzyme / . Other suitable enzymes that are not (yet) classified in the designated classes but can be so classified are intended to be included.

[0041] If a protein or nucleic acid sequence (such as a gene) is referred to herein by reference to an accession number, unless otherwise specified, the number is specifically used to refer to the protein or nucleic acid sequence (gene) having the sequence that can be found via www.ncbi.nlm.nih.gov / (available as of October 1, 2020).

[0042] Each nucleic acid sequence encoding a polypeptide herein also includes any conservatively modified variants thereof. By reference to the genetic code, this includes every possible silent variation of the nucleic acid. The term "conservatively modified variant" applies to both amino acid and nucleic acid sequences. With respect to a particular nucleic acid sequence, conservatively modified variants are those nucleic acids that, due to the degeneracy of the genetic code, encode the same amino acid sequence or a conservatively modified variant of the amino acid sequence. The term "degeneracy of the genetic code" refers to the fact that a large number of functionally identical nucleic acids encode any given protein. For example, the codons GCA, GCC, GCG, and GCU all encode the amino acid alanine. Thus, at each position where a codon specifies alanine, the codon can be changed to any of the corresponding codons described without changing the encoded polypeptide. Such nucleic acid variations are "silent variations" and represent one type of conservatively modified variation.

[0043] As used herein, a "functional homolog" (or simply "homolog") of a polypeptide and / or amino acid sequence having a specific sequence (e.g., "SEQ ID NO:X") or of a certain gene refers to a polypeptide and / or amino acid sequence that includes the said specific sequence, or to a nucleic acid sequence that includes the polypeptide and / or amino acid sequence encoding the said specific sequence, provided that one or more amino acids are mutated, substituted, deleted, added, and / or inserted, and the polypeptide has (qualitatively) the same enzyme function for substrate conversion.

[0044] As used herein, a "functional homolog" (or simply "homolog") of a polynucleotide and / or nucleic acid sequence having a specific sequence (e.g., "SEQ ID NO:X") refers to a polynucleotide and / or nucleic acid sequence that includes the specific sequence, provided that one or more nucleic acids are mutated, substituted, deleted, added, and / or inserted, and the polynucleotide encodes a polypeptide sequence having (qualitatively) the same enzymatic function for substrate conversion. With respect to nucleic acid sequences, the term functional homolog is intended to include nucleic acid sequences that differ from another nucleic acid sequence due to the degeneracy of the genetic code and encode the same polypeptide sequence.

[0045] Sequence identity is defined herein as a relationship between two or more amino acid (polypeptide or protein) sequences or between two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. Typically, sequence identity or similarity is compared over the entire length of the sequences being compared. In the art, "identity" also refers to the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the matching between strings of such sequences.

[0046] When a certain level of similarity is exhibited, amino acid or nucleotide sequences are said to be homologous. The fact that two sequences are homologous indicates a common evolutionary origin. Whether two homologous sequences are closely related or more distantly related is indicated by the "percent identity" or "percent similarity", which are high or low, respectively. Although controversial, "level of homology" or "percent homology" are often used interchangeably to indicate the "percent identity" or "percent similarity". The comparison of sequences and the determination of the percent identity between two sequences can be accomplished using mathematical algorithms. Those skilled in the art will be aware of the fact that several different computer programs are available for aligning two sequences and determining the homology between the two sequences (Kruskal et al., "An overview of sequence comparison: Time warps, string edits, and macromolecules", ["Sequence comparison overview: Time warps, string edits, and macromolecules"], (1983), Society for Industrial and Applied Mathematics (SIAM) [Industrial and Applied Mathematics Society (SIAM)], Vol. 25, No. 2, pp. 201-237 and the handbook edited by D. Sankoff and J.B. Kruskal (editors), "Time warps, string edits and macromolecules: the theory and practice of sequence comparison", ["Time warps, string edits, and macromolecules: the theory and practice of sequence comparison"], (1983), pp. 1-44, published by Addison-Wesley Publishing Company, Massachusetts USA [Addison-Wesley Publishing Company, Massachusetts, USA]).

[0047] The Needleman and Wunsch algorithm can be used to align two sequences to determine the percentage identity between two amino acid sequences. (Needleman et al., "A General Method Applicable to the Search for Similarities in the Amino Acid Sequence of Two Proteins" (1970) J. Mol. Biol. Vol. 48, pp. 443-453). This algorithm aligns amino acid sequences as well as nucleotide sequences. The Needleman-Wunsch algorithm has been implemented in the computer program NEEDLE. For the purposes of the present invention, the NEEDLE program from the EMBOSS package (version 2.8.0 or higher, see Rice et al., "EMBOSS: The European Molecular Biology Open Software Suite", (2000), Trends in Genetics Vol. 16, (6) pp. 276-277, http: / / emboss.bioinformatics.nl / ) is used. For protein sequences, EBLOSUM62 is used as the substitution matrix. For nucleotide sequences, EDNAFULL is used. Other matrices can be specified. Optional parameters for amino acid sequence alignment are a gap opening penalty of 10 and a gap extension penalty of 0.5. Those skilled in the art will understand that all these different parameters will produce slightly different results, but the overall percentage identity between the two sequences does not change significantly when different algorithms are used.)

[0048] Homology or identity is the percentage of identical matches over the total alignment region between two complete sequences including any gaps or extensions. Homology or identity between two aligned sequences is calculated as follows: the number of corresponding positions in the alignment that show the same amino acid in both sequences divided by the total length of the alignment including gaps. Identity as defined herein can be obtained from NEEDLE and is labeled "IDENTITY" in the output of the program.)

[0049] The homology or identity between two aligned sequences is calculated as follows: the number of corresponding positions in the alignment that show the same amino acid in the two sequences is divided by the total length of the alignment after subtracting the total number of gaps in the alignment. Identity as defined herein can be obtained from NEEDLE using the NOBRIEF option and is labeled "longest-identity" in the output of the program.

[0050] Variants of the nucleotide or amino acid sequences disclosed herein can also be defined as nucleotide or amino acid sequences having one or more mutations, substitutions, insertions, and / or deletions as compared to the nucleotide or amino acid sequences specifically disclosed herein (e.g., in the sequence listing).

[0051] Optionally, when determining the degree of amino acid similarity, one of ordinary skill in the art can also consider so-called "conservative" amino acid substitutions, which will be clear to one of ordinary skill in the art. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxy side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. In one embodiment, the group of conservative amino acid substitutions is: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitution variants of the amino acid sequences disclosed herein are variants in which at least one residue in the disclosed sequence has been removed and a different residue has been inserted in its place. Preferably, the amino acid changes are conservative. In one embodiment, the conservative substitutions for each naturally occurring amino acid are as follows: Ala to Ser; Arg to Lys; Asn to Gln or His; Asp to Glu; Cys to Ser or Ala; Gln to Asn; Glu to Asp; Gly to Pro; His to Asn or Gln; Ile to Leu or Val; Leu to Ile or Val; Lys to Arg; Gln or Glu; Met to Leu or Ile; Phe to Met, Leu or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and Val to Ile or Leu.

[0052] The nucleotide sequences of the present invention can also be defined by their ability to hybridize, under moderate hybridization conditions or preferably under stringent hybridization conditions, to portions of the specific nucleotide sequences disclosed herein. Stringent hybridization conditions are defined herein as conditions that allow nucleic acid sequences of at least about 25 nucleotides, preferably about 50, 75, or 100 nucleotides, and most preferably about 200 or more nucleotides to hybridize in a solution containing about 1 M salt (preferably 6x SSC or any other solution with equivalent ionic strength) at a temperature of about 65°C, and to be washed in a solution containing about 0.1 M or less salt (preferably 0.2x SSC or any other solution with equivalent ionic strength) at 65°C. Preferably, hybridization is carried out overnight, i.e., for at least 10 hours; and preferably, washing is carried out for at least one hour, with the washing solution being changed at least twice. These conditions will generally allow specific hybridization of sequences having about 90% or higher sequence identity. Moderate conditions are defined herein as conditions that allow nucleic acid sequences of at least 50 nucleotides, preferably about 200 or more nucleotides, to hybridize in a solution containing about 1 M salt (preferably 6x SSC or any other solution with equivalent ionic strength) at a temperature of about 45°C, and to be washed in a solution containing about 1 M salt (preferably 6x SSC or any other solution with equivalent ionic strength) at room temperature. Preferably, hybridization is carried out overnight, i.e., for at least 10 hours; and preferably, washing is carried out for at least one hour, with the washing solution being changed at least twice. These conditions will generally allow specific hybridization of sequences having up to 50% sequence identity. Those skilled in the art will be able to modify these hybridization conditions in order to specifically identify sequences with sequence identity varying between 50% and 90%.

[0053] "Expression" refers to the transcription of a gene into structural RNA (rRNA, tRNA) or messenger RNA (mRNA), followed by translation into a protein.

[0054] "Overexpression" refers to the expression of a gene (correspondingly a nucleic acid sequence) by a recombinant cell that exceeds its expression in the corresponding wild-type cell. Such overexpression can be arranged, for example, by increasing the transcription frequency of one or more nucleic acid sequences, e.g., by operably linking the nucleic acid sequence to a promoter functional in the recombinant cell; and / or by increasing the copy number of a certain nucleic acid sequence.

[0055] The term "upregulation" and its variants refer to the process by which a cell increases the amount of a cellular component such as RNA or protein. Such upregulation can occur in response to or be caused by a genetic modification.

[0056] The term "pathway" or "metabolic pathway" is understood herein to mean a series of chemical reactions in a cell for building and breaking down molecules.

[0057] A nucleic acid sequence (i.e., polynucleotide) or a protein (i.e., polypeptide) can be native or heterologous to the genome of a host cell.

[0058] "Native," "homologous," or "endogenous" with respect to a host cell means that the nucleic acid sequence is indeed naturally present in the genome of the host cell, or the protein is naturally produced by that cell. The terms "native," "homologous," and "endogenous" are used interchangeably herein.

[0059] As used herein, "heterologous" or "exogenous" can refer to a nucleic acid sequence or a protein. For example, with respect to a host cell, "heterologous" can refer to a polynucleotide that does not naturally exist in the genome of the host cell in that manner, or a polypeptide or protein that is not naturally produced by that cell in that manner. A heterologous nucleic acid sequence is a nucleic acid derived from a foreign species, or if from the same species, has been substantially modified in composition and / or genomic locus relative to its native form by deliberate human intervention. For example, a promoter operably linked to a native structural gene is from a species different from the species from which the structural gene is derived, or if from the same species, one or both have been substantially modified relative to their original forms. A heterologous protein can be derived from a foreign species, or if from the same species, has been substantially modified relative to its original form by deliberate human intervention. That is, heterologous protein expression involves the expression of a protein that is not naturally expressed in that manner in a host cell. The term "heterologous expression" refers to the expression of a heterologous nucleic acid in a host cell. The expression of heterologous proteins in eukaryotic host cell systems such as E. coli is well known to those skilled in the art. A polynucleotide comprising a nucleic acid sequence encoding a certain protein or enzyme having a specific activity can be expressed in such a eukaryotic system. In some embodiments, transformed / transfected cells can be used as an expression system for expressing the enzyme. The expression of heterologous proteins in E. coli is well known. A recognized work published by Cold Spring Harbor Laboratory describes various methods that can be used to express proteins in E. coli.

[0060] As used herein, a "promoter" is a DNA sequence that directs the transcription of a (structural) gene or other (partial) nucleic acid sequence. Appropriately, the promoter is located in the 5' region of the gene, near the transcription start site of the (structural) gene. The promoter sequence can be constitutive, inducible, or repressible. In one embodiment, no (external) inducer is required.

[0061] As used herein, the term "vector" includes references to both autosomal expression vectors and integration vectors for integration into the chromosome.

[0062] The term "expression vector" refers to a linear or circular DNA molecule that contains a segment encoding a polypeptide of interest, which is under the control (i.e., operably linked) of additional nucleic acid segments that provide for its transcription. Such additional segments can include promoter and terminator sequences and can optionally include one or more origins of replication, one or more selectable markers, enhancers, polyadenylation signals, etc. Expression vectors are usually derived from plasmid or viral DNA or can contain elements of both.

[0063] "Plasmid" refers to an extrachromosomal DNA that replicates autonomously, does not integrate into the genome of a microorganism, and is usually circular in nature.

[0064] As used herein, "host cell" is understood to mean a cell (such as an Escherichia coli cell) that will be transformed with one or more nucleic acid sequences encoding one or more heterologous proteins to create a transformed cell (also referred to as a recombinant cell). For example, the transformed cell can contain a vector and can support the replication and / or expression of the vector.

[0065] As used herein, "transformation" refers to the insertion of foreign polynucleotides into a host cell, regardless of the method used for insertion, such as direct uptake, transduction, f-conjugation, or electroporation. The foreign polynucleotide can be maintained as a non-integrating vector (e.g., a plasmid) or alternatively can integrate into the host cell genome. As used herein, "transformation" refers to the insertion of foreign polynucleotides (i.e., foreign nucleic acid sequences) into a host cell, regardless of the method used for insertion, such as direct uptake, transduction, f-conjugation, or electroporation. The foreign polynucleotide can be maintained as a non-integrating vector (e.g., a plasmid) or alternatively can integrate into the host cell genome.

[0066] The present disclosure will be further described in detail below in conjunction with specific embodiments. The examples given are only for clarifying the present disclosure and not for limiting the scope of the present disclosure. The experimental methods in the following examples are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can all be obtained from commercial sources unless otherwise specified.

[0067] In the following examples, the strain Escherichia coli BW25113 was purchased from the E. coli Genetic Stock Center CGSC at Yale University, USA.

[0068] In the present invention, the fumarate reductase flavoprotein subunit frdA gene is as shown in eco:b4154 in the KEGG database.

[0069] In the present invention, the nucleotide sequence of the fatty acid degradation repressor fadR gene is as shown by Gene ID: 94865 in Gene Bank, and the amino acid sequence of the fatty acid degradation repressor encoded by this gene is as shown by the reference sequence number NP_415705 in NCBI.

[0070] In the present invention, the nucleotide sequence of the fatty acyl-CoA synthetase fadD gene is as shown by Gene ID: 94632 in Gene Bank, and the amino acid sequence of the fatty acyl-CoA synthetase encoded by this gene is as shown by the reference sequence number NP_416319 in NCBI.

[0071] In the present invention, the nucleotide sequence of the long-chain fatty acid transport protein fadL gene is as shown by Gene ID: 946820 in Gene Bank, and the amino acid sequence of the long-chain fatty acid transport protein encoded by this gene is as shown by the reference sequence number NP_416846 in NCBI.

[0072] In the present invention, the nucleotide sequence of the NAD(P) transhydrogenase sthA gene is as shown by Gene ID: 94846 in Gene Bank, and the amino acid sequence of the NAD(P) transhydrogenase encoded by this gene is as shown by the reference sequence number NP_418397 in NCBI.

[0073] In the present invention, the nucleotide sequence of the atoS gene in the short-chain fatty acid degradation regulatory gene cluster is as shown by Gene ID: 949011 (submission date: May 2, 2024) in Gene Bank, and the amino acid sequence of the atoS protein encoded by the atoS gene is as shown by the reference sequence number NP_416723 (submission date: March 9, 2022) in NCBI.

[0074] In the present invention, the nucleotide sequence of the 3-oxoacyl-[acyl carrier protein] synthase 2 (fabF) gene is as shown by Gene ID: 946665 (submission date: May 2, 2024) in Gene Bank, and the amino acid sequence of the 3-oxoacyl-[acyl carrier protein] synthase 2 encoded by this gene is as shown by the reference sequence number NP_415613 (submission date: March 9, 2022) in NCBI.

[0075] In the present invention, the nucleotide sequence of the β-ketoacyl-ACP synthase III (3-oxoacyl-[acyl carrier protein] synthase 3) fabH gene is as shown in Gene Bank with Gene ID: 946003 (submission date: 2024.05.02), and the amino acid sequence of the β-ketoacyl-ACP synthase III encoded by this gene is as shown in NCBI with reference sequence number NP_415609 (submission date: 2022.03.09).

[0076] In the present invention, the atoSC gene cluster contains the atoS gene and the atoC gene. The nucleotide sequences of the atoS gene and the atoC gene are respectively as shown in Gene Bank with Gene ID: 949011 and Gene ID: 947444, and the amino acid sequences of the atoS protein and the atoC protein encoded by the atoS gene and the atoC gene are respectively as shown in NCBI with reference sequence number NP_416723 and reference sequence number NP_416724.

[0077] In the present invention, the acetyl-CoA acetyltransferase atoB gene is as shown in the KEGG database as eco:b2224.

[0078] In the present invention, the 3-hydroxy-3-methylglutaryl-CoA synthase gene mvaS is as shown in Gene Bank with reference number NC_007795.1.

[0079] In the present invention, the 3-hydroxy-3-methylglutaryl-CoA hydratase gene liuC is as shown in Gene Bank with reference number: CP070500.1.

[0080] In the present invention, the glutaryl-CoA decarboxylase A subunit gene aibA is as shown in GenBank: CP070500.1.

[0081] In the present invention, the glutaryl-CoA decarboxylase B subunit gene aibB is as shown in GenBank: CP080534.1.

[0082] In the present invention, the acyl-CoA thioesterase EcpaaI gene is as shown in the KEGG database as eco:b1396.

[0083] Example 1. Construction of recombinant Escherichia coli FA01 - FA08.

[0084] The preparation method of the relevant strains is obtained according to the following steps (1)-(2):

[0085] (1)Starting from Escherichia coli BW25113, the fadR gene, a fatty acid metabolism regulatory factor in this strain, was knocked out to obtain strain FA01.

[0086] The specific steps are as follows:

[0087] (1-a)Preparation of the targeting fragment K01

[0088] The DNA fragment was synthesized by GenScript as follows: from 5' to 3', it consists of fadRup (fragment 21), FRT-Kan-FRT (fragment 1), and fadRdown (fragment 22) in sequence. Using fadR-1 / fadR-2 as primers, PCR amplification was performed with the synthesized DNA fragment as the template to obtain the targeting fragment K01.

[0089] (1-b)Preparation of the host bacterium containing plasmid pKD46

[0090] The pKD46 plasmid (derived from the E. coli Genetic Stock Center CGSC at Yale University, USA) was transformed into Escherichia coli BW25113 by the calcium chloride transformation method. After overnight culture at 30 °C on an LB plate containing ampicillin, clones were selected to obtain the recombinant Escherichia coli BW25113 / pKD46 containing the plasmid pKD46. After induction with arabinose, BW25113 / pKD46 expressed three recombinant proteins of λ phage, and the host bacterium acquired the ability of homologous recombination. Then, BW25113 / pKD46 competent cells were prepared by washing with 10% glycerol.

[0091] (1-c)Homologous recombination

[0092] The targeting fragment K01 prepared in (1-a) was electrotransformed into the BW25113 / pKD46 competent cells prepared in (1-b), and cultured overnight at 37 °C on an LB plate containing kanamycin (concentration: 50 μg / ml). Clones were selected, and genomic DNA was extracted. PCR amplification was performed with fadR-3 / Kan-R as primers for identification. An amplified target band of approximately 1000 bp was considered positive, and the positive clone was named FA01-kan. The sequencing analysis results showed that the genome of FA01-kan contained the K01 fragment. FA01-kan was cultured overnight at 42 °C to eliminate the temperature-sensitive plasmid pKD46.

[0093] (1-d)Elimination of resistance

[0094] The pCP20 plasmid (derived from the E. coli Genetic Stock Center CGSC of Yale University, USA) was transformed into FA01-kan by the calcium chloride transformation method. It was cultured overnight at 30 °C on an LB plate containing ampicillin, and the kanamycin resistance fragment was eliminated using the FLP recombinase on the pCP20 plasmid. It was cultured overnight at 42 °C to eliminate the temperature-sensitive plasmid pCP20.

[0095] (2)Obtaining of Strains FA02 to FA08

[0096] The construction process of each strain in this step adopted exactly the same method as in Example 1(1).

[0097] Including the following strain modifications:

[0098] Starting from strain FA01, the genes fabF and fabH in this strain were knocked out in sequence to obtain strain FA02 and strain FA03 in sequence.

[0099] Starting from strain FA03, the promoters of the genes fadD, fadL, and atoSC in this strain were replaced with the P119 promoter in sequence to obtain strain FA04, strain FA05, and strain FA06 in sequence.

[0100] Starting from strain FA06, the gene frdA encoding the fumarate reductase flavoprotein A subunit in this strain was replaced with the expression cassettes of the E. coli acetyl-CoA acetyltransferase EcatoB (Ec is the abbreviation of E. coli), the Staphylococcus aureus 3-hydroxy-3-methylglutaryl-CoA synthase gene SamvaS (Sa is the abbreviation of Staphylococcus aureus), and the Myxococcus xanthus 3-hydroxy-3-methylglutaryl-CoA hydratase gene MxliuC (Mx is the abbreviation of Myxococcus xanthus) to obtain strain FA07.

[0101] Starting from strain FA07, the gene sthA encoding the NAD(P) transhydrogenase in this strain was replaced with the expression cassettes of the Myxococcus xanthus glutaroyl-CoA decarboxylase A subunit gene MxaibA, the Myxococcus xanthus glutaroyl-CoA decarboxylase B subunit gene MxaibB, and the E. coli acyl-CoA thioesterase gene EcpaaI to obtain strain FA08.

[0102] The difference in the construction process of each strain from Example 1(1) is that different starting strains, different targeting fragments, and different primers were used. The specific experimental materials used and the strain information obtained are shown in Tables 1, 2, and 3.

[0103] Table 1. Construction Process of FA02 to FA13

[0104] Serial number Starting strain Name of targeting fragment Targeting fragment sequence (successively containing the following fragments from 5'-3') Amplification primer Identification primer Obtained strain 1 BW25113 K01 fadRup (fragment 21), FRT-Kan-FRT (fragment 1), fadRdown (fragment 22) fadR-1 / fadR-2 fadR-3 / KanR FA01 2 FA01 K02 fabF (fragment 23), FRT-Kan-FRT (fragment 1), fabFdown (fragment 24) fabF-1 / fabF-2 fabF-3 / KanR FA02 3 FA02 K03 fabH (fragment 25), FRT-Kan-FRT (fragment 1), fabH (fragment 26) fabH-1 / fabH-2 fabH-3 / KanR FA03 4 FA03 P01 fadDup (fragment 27), FRT-Kan-FRT (fragment 1), P119 promoter (fragment 2), fadDdown (fragment 28) fadD-1 / fadD-2 fadD-3 / KanR FA04 5 FA04 P02 fadLup (fragment 29) FRT-Kan-FRT (fragment 1), P119 promoter (fragment 2), fadLdown (fragment 30) fadL-1 / fadL-2 fadL-3 / KanR FA05 6 FA05 P03 atoSCup (fragment 31), FRT-Kan-FRT (fragment 1), P119 promoter (fragment 2), atoSCdown (fragment 32) atoSC-1 / atoSC-2 atoSC-3 / KanR FA06 7 FA06 F01 frdAup (fragment 33), FRT-Kan-FRT (fragment 1), P119 promoter (fragment 2), EcatoB (fragment 11), RBS (fragment 4), SamvaS (fragment 12), TrrnB terminator (fragment 3), P119 promoter (fragment 2), MxliuC (fragment 13), TrrnB terminator (fragment 3), frdAdown (fragment 34) frdA-1 / frdA-2 frdA-3 / KanR FA07 8 FA07 F02 sthAup (fragment 35), FRT-Kan-FRT (fragment 1), P119 promoter (fragment 2), MxaibA (fragment 14), RBS (fragment 4), MxaibB (fragment 15), TrrnB terminator (fragment 3), P119 promoter (fragment 2), EcpaaI (fragment 16), TrrnB terminator (fragment 3), sthAdown (fragment 36) sthA-1 / sthA-2 sthA-3 / KanR FA08

[0105] Table 2 Gene Editing Fragments and Sequences of Example 1

[0106] Serial number Fragment number Fragment name Sequence (5'-3') SEQ ID No.1 Fragment 1 FRT-Kan-FRT aaatgggaaatttactgagccaatcccattccggggatccgtcgacctgcagttcgaagttcctattctctagaaagtataggaacttcagagcgcttttgaagctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctaataaggggatcttgaagttcctattccgaagttcctattctctagaaagtataggaacttcgaagcagctccagcctacaaaacatgaatgtcatgaaaatggtccc SEQ ID No.2 Fragment 2 P119 promoter atggcttgtcatgcttaattgacagctagctcagtcctaggtataatgctagcagggagaccacaacggtttccctctacaaataattttgtttaactttcgcgcgcgtaacaggaggaattaacc SEQ ID No.3 Fragment 3 TrrnB terminator tattgagaattagaaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctt SEQ ID No.4 Fragment 4 RBS aggaggaattaacc SEQ ID No.5 Fragment 11 EcatoB atgaaaaattgtgtcatcgtcagtgcggtacgtactgctatcggtagttttaacggttcactcgcttccaccagcgccatcgacctgggggcgacagtaattaaagccgccattgaacgtgcaaaaatcgattcacaacacgttgatgaagtgattatgggtaacgtgttacaagccgggctggggcaaaatccggcgcgtcaggcactgttaaaaagcgggctggcagaaacggtgtgcggattcacggtcaataaagtatgtggttcgggtcttaaaagtgtggcgcttgccgcccaggccattcaggcaggtcaggcgcagagcattgtggcggggggtatggaaaatatgagtttagccccctacttactcgatgcaaaagcacgctctggttatcgtcttggagacggacaggtttatgacgtaatcctgcgcgatggcctgatgtgcgccacccatggttatcatatggggattaccgccgaaaacgtggctaaagagtacggaattacccgtgaaatgcaggatgaactggcgctacattcacagcgtaaagcggcagccgcaattgagtccggtgcttttacagccgaaatcgtcccggtaaatgttgtcactcgaaagaaaaccttcgtcttcagtcaagacgaattcccgaaagcgaattcaacggctgaagcgttaggtgcattgcgcccggccttcgataaagcaggaacagtcaccgctgggaacgcgtctggtattaacgacggtgctgccgctctggtgattatggaagaatctgcggcgctggcagcaggccttacccccctggctcgcattaaaagttatgccagcggtggcgtgccccccgcattgatgggtatggggccagtacctgccacgcaaaaagcgttacaactggcggggctgcaactggcggatattgatctcattgaggctaatgaagcatttgctgcacagttccttgccgttgggaaaaacctgggctttgattctgagaaagtgaatgtcaacggcggggccatcgcgctcgggcatcctatcggtgccagtggtgctcgtattctggtcacactattacatgccatgcaggcacgcgataaaacgctggggctggcaacactgtgcattggcggcggtcagggaattgcgatggtgattgaacggttgaattaa SEQ ID No.6 Fragment 12 SamvaS atgacaataggtatcgacaaaataaacttttacgttccaaagtactatgtagacatggctaaattagcagaagcacgccaagtagacccaaacaaatttttaattggaattggtcaaactgaaatggctgttagtcctgtaaaccaagacatcgtttcaatgggcgctaacgctgctaaggacattataacagacgaagataaaaagaaaattggtatggtaattgtggcaactgaatcagcagttgatgctgctaaagcagccgctgttcaaattcacaacttattaggtattcaaccttttgcacgttgctttgaaatgaaagaagcttgttatgctgcaacaccagcaattcaattagctaaagattatttagcaactagaccgaatgaaaaagtattagttattgctacagatacagcacgttatggattgaattcaggcggcgagccaacacaaggtgctggcgcagttgcgatggttattgcacataatccaagcattttggcattaaatgaagatgctgttgcttacactgaagacgtttatgatttctggcgtccaactggacataaatatccattagttgatggtgcattatctaaagatgcttatatccgctcattccaacaaagctggaatgaatacgcaaaacgtcaaggtaagtcgctagctgacttcgcatctctatgcttccatgttccatttacaaaaatgggtaaaaaggcattagagtcaatcattgataacgctgatgaaacaactcaagagcgtttacgttcaggatatgaagatgctgtagattataaccgttatgtcggtaatatttatactggatcattatatttaagcctaatatcattacttgaaaatcgtgatttacaagctggtgaaacaatcggtttattcagttatggctcaggttcagttggtgaattttatagtgcgacattagttgaaggctacaaagatcatttagatcaagctgcacataaagcattattaaataaccgtactgaagtatctgttgatgcatatgaaacattcttcaaacgttttgatgacgttgaatttgacgaagaacaagatgctgttcatgaagatcgtcatattttctacttatcaaatattgaaaataacgttcgcgaatatcacagaccagagtaa SEQ ID No.7 Fragment 13 MxliuC atggccaccaaggcggaagagctcgaggtgaagcagggcttctcgtaccaggtggagggcggcgtcgccgtcatcaccttcgacctgccggactcgccggtgaacacgctgtcgccggagacgggcgaggccttcctgcgcgtcatgatgcgcgcggagcgcgagcccgaggtgaaggccgtcgtcttcacgtccggcaagaaggactcgttcgtcgccggggcgaaaatcgacttcctgcagaccatcaagacggcggaggaggccaccgccatcagccgcaacgggcaggagggcttcgacaagctggccgacttccccaagcccgtcgtcgcggccatccacggcgcatgtctgggaggcggcctggagtgggcgctggcgtgtgactaccgcatcgccaccgacagcccgaagacgtcgctggggctgccggaggtgcagttgggcctgattccgggcgcgggcggcacgcagcggctgccggcgctgattggcgtgcaggcggcgctggacctcatcctcaccggcaagagcctcaagcccgcgaaggcgaagaagctgggcgtggtggatgaggtggtgccgacgcccatcctccgcgccatcgcggtgctgcgcgcgaaggagctggccgacgggaagctgaaggtggaccgccgtcatggccagggcttcaagggcgtggccgcgaacggcaaggccaaggggcttgcgggcttcatccagggcctggccaacaaggagctgtgggcggaggtggcgctggaggacaacccgctgggccgcaaggtcctcttcgaccaggcgcgcaagcagctcctgaagaagacgcgcggcaagttccccgcgccggagaaggcgctccaggtcgtgcgcgtgggcctggagtccgggcacaaggcgggccaggaggcggaagcgaaggcctttggcgagctggtggtgtcggacgtctccaagaggctggtggagatcttcttcgccaccacggcgctgaagaaggagaacggcacctccaaccccgacgcgaagccgcgcgaggtgaagaaggtggcggtgctgggcggcgggctgatgggcggcggcatcgcctatgtcaccagcgtgctccagggcgtgcccgtgcgcgtgaaggacaaggatgacgcgggcgtgggccgggccatgaagcaggtgcagtccatcttggacgagcgtgtgaagcggcgctcgctcacgcgccgcgaggccacggcgaagtcggccctggtgacggcgggcacggactacagcggcttcaagtccgcggacctggtcatcgaggcggtgttcgaggacctcaagctcaagcaccgcatcatcgcggaggtggaggccgtcaccggcgaccagaccatcttcgcgtccaacacctccagcatcccgattacggagctggccaagggcagccgccggccggcgcaagtcattggcatgcattacttcagcccggtccacaagatgccgctgctggagatcatcacccacgcgggcaccgcggactgggtgacggccacctgcgtggaggtggggcgcaagcagggcaagacggtcatcgtcgtcaacgacgggccgggcttctacacctcgcgcatcctcgccccgtacatgaacgaggcggcttacctgctggcagaaggcgcggacatcgcggagctggacagggcgctggtcgagttcggcttccccgtgggcccgattaccctcctggacgaggtgggcatcgacgtggcgcagaaggtgggccccatcatggaggccgccttcggcaagcgcatggcggcgcccaaggccctggagaaggtggtggccgacggccgcctgggccgcaagacgcagaagggcttctacctgtacgaggacgggaaaaagcaggaggtggacagctccatctacgccctgctgccgcacggcacggagcgccgctccttcgaccgcgcggagatggcggagcgcgtggtgctgcagatggtcaacgaggccatccgctgcctgggcgagggcatcctccgcagcgcgcgtgacggcgacgtgggcgccatcttcggcctgggcttcccgcccttcctgggggggcccttccactacgtggacagccgcggccccgccgaggtgctgcgcaagctggagcactaccacgacaagctcggggagcgtttcgcccccgcgccgcacctggtggagatggtgaaggcgggcaagacgttctacccgcgctga SEQ ID No.8 Fragment 14 MxaibA atgaagacggcgcgctggtgctcgctggaggaggcggtggcttccattccggatggcgcgtcgctggccaccggcggtttcatgctgggtcgcgcccccatggcgctggtgatggagctcatcgcgcagggcaagcgcgacctgggcctcatctccctccccaacccgctgcccgcggagttcctcgtggcgggcggctgtctggccaggctggagattgccttcggcgcgctgagcctccagggccgcgtgcgtcccatgccctgcctcaagcgggccatggagcaaggcaccctcgcctggcgcgaacatgatggctaccgcgtcgtccagcggctgcgcgccgcgtccatggggctgcccttcatccccgcgccggacgcggacgtgtccgggctggcacggacggagccgcctcccacggtggaggaccccttcaccggcctgcgcgtggcggtggagcctgccttctatccggacgtggcgttgctccacgcgcgcgccgcggacgagcgcggcaacctctacatggaagacccgaccacggacctgctggtggcgggcgcggcgaagcgggtgattgccacggtggaggagcgggtggcgaagctgcctcgcgccaccctgcccggcttccaggtggaccgcatcgtcctggctcccggcggcgccctgcccaccggctgcgccggactctacccgcacgacgacgaaatgctggcccgctacctgtcgctggcggagacgggccgtgaagcggagttcctggaaacgttgctgacgcggagggcggcatga SEQ ID No.9 Fragment 15 MxaibB atgagcgcgacgctggacatcaccccagcggagaccgtggtctccctgctggcgcggcagattgatgacggcggcgtggtggccacgggcgtggcgtcaccgctggccatcctggccatcgccgtggcgcgcgcgacgcacgcgccggacctgacgtacctggcctgcgtgggctcgttggatccggagattcccacgctgctgccctcctccgaggacctgggctacctggatggccggtccgcggaaatcaccattccggacctgttcgaccacgcgcggcgcggccgggtggacaccgtcttcttcggcgcggccgaggtggatgccgagggccgcaccaacatgacggccagcggcagcctggacaagccgcggacgaagttccccggcgtggcgggcgcagcgacgctgcggcagtgggtgcgccggccggtgctgttggtgccgcgccagtcgcgccgcaacctggtgccggaggtgcaggtcgccaccacgagagatccgcgccggccggtgacgctcatctccgacctgggcgtgttcgaactgggcgcgtccggcgcgcggctgctcgcgcgacacccctgggcctcggaagagcacatcgcggagcgcacgggcttcgccttccaggtctccgaagcgctgtccgtcacctcgcttccggatgcccggacggtggcggccattcgcgccatcgatccgcacggctaccgcgacgcgctcgtcggcgcctga SEQ ID No.10 Fragment 16 EcpaaI atgagtcataaggcctggcaaaatgcccatgcaatgtatgagaacgatgcctgcgccaaagcgcttggcatcgacattatctcaatggatgaaggctttgctgtagtgaccatgaccgtcactgcacaaatgcttaacggtcatcaaagttgccacggcgggcagctattttcactggctgatactgcctttgcctacgcctgcaatagccaggggctggcagccgtcgcttctgcctgcacgattgattttttgcgtccaggctttgccggagacaccttaactgctactgcgcaggtacgtcatcagggcaagcaaaccggtgtttacgacatcgaaattgttaaccaacaacaaaaaacggttgcgctgtttcgcggtaaatctcaccgcatcggcggcaccattacaggagaagcctga SEQ ID No.11 Fragment 21 fadRup gctatcagcgtagttagccctctggtatgatgagtccaactttgttttgctgtgttatggaaatctcact SEQ ID No.12 Fragment 22 fadRdown aagaatgggaaatctgtaaaaacaacaaaaaacccctcgtttgaggggtttgctctttaaacggaaggga SEQ ID No.13 Fragment 23 fabFup gtcgttcgaccgcctgagttttatctttttgtcccactagaatcattttttccctccctggaggacaaac SEQ ID No.14 Fragment 24 fabFdown aacaagtcggaataaaagctaagaaaaaaggcccgcaagcggaccttttataagggtggaaaatgacaac SEQ ID No.15 Fragment 25 fabHup tagcaggacgctgccagcgaactcgcagtttgcaagtgacggtatataaccgaaaagtgactgagcgtac SEQ ID No.16 Fragment 26 fabHdown gcattccaacggtttgagaaccctgtccagggaacacaaatgcaaattgcgtcatgttttaatccttatc SEQ ID No.17 Fragment 27 fadDup gtccgctgtttctgcattcttacggtaaagataaaaataaatagtgacgcgcttcgcaaccttttcgttg SEQ ID No.18 Fragment 28 fadDdown attgataacggtcagggttgatctccgtcggaacgtccgcgggataacggttaagccaaaccttcttcaa SEQ ID No.19 Fragment 29 fadLup gataagtgaccgaaatcacacttaaaaatgatctaaaacaaaattcacccgaatccatgagtgcgccacc SEQ ID No.20 Fragment 30 fadLdown aggcctgggtggagataagtgccactgcgactgcgagagcagactttgtaaacagggttttctggctcat SEQ ID No.21 Fragment 31 atoSCup tggttaaggtagcggtaaaagcgtgttaccgcaatgttctctcttctctggaatatgatacaccgccgag SEQ ID No.22 Fragment 32 atoSCdown ccatcaggattgccatcaggatcatttgattgcgtaagcggcgtggataaatccacttcatataatgcat SEQ ID No.23 Fragment 33 frdAup cagaccgtaactttcaggtacttaccctgaagtacgtggctgtgggataaaaacaatctggaggaatgtc SEQ ID No.24 Fragment 34 frdAdown gaatgcgctatgcggtgcggtatcgacttccgggttatagcgcaccacctcaattttcaggtttttcatc SEQ ID No.25 Fragment 35 sthAup caattggcttacccgcgataaaatgttaccattctgttgcttttatgtataagaacaggtaagccctacc SEQ ID No.26 Fragment 36 sthAdown gctgcgcagccgctatgagcagctggcagaggccatccgcgcaagaatggatggccatttcgataaagtt

[0107] Table 3 Primers of Example 1

[0108] Primer Sequence (5'-3') fadR-1 gctatcagcgtagttagccctctgg fadR-2 aagaatgggaaatctgtaaaaacaa fadR-3 agccttgatccctttttcttctttttgtct fabF-1 gtcgttcgaccgcctgagttttatc fabF-2 aacaagtcggaataaaagctaagaa fabF-3 ccaccaggcgtaagtgaacatctccaggcg fabH-1 tagcaggacgctgccagcgaactcg fabH-2 gcattccaacggtttgagaaccctg fabH-3 ctggacggtggcaaaagcggaactctgcgg fadD-1 gtccgctgtttctgcattcttacgg fadD-2 attgataacggtcagggttgatctc fadD-3 ttgtttttaaagaaaaagaaacagcggctg fadL-1 gataagtgaccgaaatcacacttaa fadL-2 aggcctgggtggagataagtgccac fadL-3 gctgctccagttgttaattctgcaaaatcg atoSC-1 tggttaaggtagcggtaaaagcgtg atoSC-2 ccatcaggattgccatcaggatcat atoSC-3 gaagctccgcctcaggtgaccgatggagtg frdA-1 cagaccgtaactttcaggtacttac frdA-2 gaatgcgctatgcggtgcggtatcg frdA-3 acctataaaggagcagtggaatagcgttcg sthA-1 caattggcttacccgcgataaaatg sthA-2 gctgcgcagccgctatgagcagctg sthA-3 tcaggatatagccagataaatgacggggat Kan-R tcgtcaagaaggcgatagaa

[0109] Example 2. Application of Recombinant Bacteria in the Preparation of HMB

[0110] 1. Culture Medium Components

[0111] (1-a) The components and final concentrations of the growth medium are as follows:

[0112] The solvent is water, the pH is 7.0 - 7.2, and the solutes and their concentrations are: 25 mM NaHPO4, 25 mM KH2PO4, 50 mM NH4Cl, 5 mM Na2SO4, 2 mM MgSO4, glycerol with a volume percentage concentration of 5%, yeast powder with a mass percentage concentration of 0.5%, 50 μM FeCl3, 20 μM CaCl2, 10 μM MnCl2, 10 μM ZnSO4, 2 μM CoCl2, 2 μM NiCl2, 2 μM Na2MO4, 2 μM Na2SeO3, and 2 μM H3BO3.

[0113] (1-b) The components and final concentrations of the transformation medium are as follows (the solvent is water):

[0114] Na2HPO4: 100 mM;

[0115] KH2PO4: 100 mM;

[0116] MgCl2: 5 mM;

[0117] Palmitic Acid: 10 g / 100 mL

[0118] Glucose: 0.5 g / 100 mL

[0119] Glycerol: 0.5 g / 100 mL

[0120] Polyoxyethylene Ether Brij58 Emulsifier: 0.2 g / 100 mL

[0121] 2. Cultivation of Bacteria and Induction of Enzymes

[0122] The overnight-cultured wild-type Escherichia coli strain BW25113, recombinant Escherichia coli FA06 and FA08 were each inoculated into a shake flask containing 200 ml of the corresponding growth medium for the strain at an inoculation amount of 1%, cultured at 37 °C for 16 h, and the cells were collected by centrifugation at 8000 g for 10 min.

[0123] 3. Whole-cell catalyzed synthesis of HMB

[0124] The cells collected above were respectively resuspended in a beaker containing 10 ml of the corresponding transformation medium for the strain. During the reaction process, the pH was regularly detected using pH test paper and adjusted with 0.1 M NaOH and HCl solutions to maintain the pH at 7.0. After reacting at 37 °C for 24 h, the reaction product was centrifuged at 8000 g for 10 minutes, and the supernatant was filtered through a 0.22 μm filter membrane, and the content of HMB in the supernatant was detected by HPLC.

[0125] The concentration of HMB was determined using an HPLC system (Dionex UltiMate 3000 Series, Thermo Scientific, USA). This system was equipped with an Aminex HPX-87H ion exchange column (7.8×300 mm, Bio-Rad Laboratories, USA), the column temperature was 35 °C, the flow rate was 0.6 mL / min, the mobile phase was 5 mM sulfuric acid solution, and the injection volume was 10 μL. The concentration of HMB in the sample was calculated through the HMB (the standard product was purchased from Jizhi Chemistry, product number: H68580) concentration standard curve.

[0126] The conversion rate was calculated as the ratio of the amount of HMB produced to the amount of palmitic acid consumed in the whole-cell catalysis stage (step 3) * 100%.

[0127] Table 4. HMB production and conversion rates of various engineered bacteria

[0128] Example Strain HMB yield (g / L) Conversion rate WT BW25113 0 0% Example 1 FA06 0 0% Example 1 FA08 3.4 34%

[0129] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including those that deviate from the scope disclosed in this application but are made using conventional techniques known in the art. Some basic features can be applied according to the scope of the following appended claims.

[0130] The above-described embodiments merely represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims, and the specification can be used to explain the content of the claims.

Claims

1. A recombinant Escherichia coli for synthesizing β-hydroxy-β-methylbutyrate HMB, comprising deletion, knockout or inhibitory expression of the following gene clusters: fatty acid metabolism regulator fadR gene, β-ketoacyl-ACP synthase II gene fabF, β-ketoacyl-ACP synthase III gene fabH; And it contains the enhancement or exogenous insertion of the following gene clusters: fatty acyl-CoA synthetase gene fadD, long-chain fatty acid transporter gene fadL, and short-chain fatty acid degradation regulatory gene cluster gene atoSC.

2. The recombinant Escherichia coli according to claim 1, further comprising the following modifications: The method comprises deletion, knockout or inhibited expression of the following gene clusters: fumarate reductase flavoprotein A subunit gene frdA, NAD(P) transhydrogenase gene sthA; and And it contains the enhancement or exogenous insertion of the following gene clusters: acetyl-CoA acetyltransferase atoB gene, 3-hydroxy-3-methylglutaryl-CoA synthase gene mvaS, 3-hydroxy-3-methylglutaryl-CoA hydratase gene liuC, glutaryl-CoA decarboxylase A subunit gene aibA, glutaryl-CoA decarboxylase B subunit gene aibB, and acyl-CoA thioesterase gene paaI.

3. A method for producing β-hydroxy-β-methylbutyrate HMB, comprising: The recombinant Escherichia coli according to any one of claims 1 to 2 is used to ferment and produce HMB.

4. The method according to claim 3, wherein: The recombinant E. coli produces HMB by fermentation using fatty acids or substances containing fatty acid components as substrates.

5. The method according to claim 4, wherein: The fatty acids include saturated fatty acids such as stearic acid (C18), palmitic acid (C16), myristic acid (C14), lauric acid (C12), capric acid (C10), caprylic acid (C8) or caproic acid (C6); also include unsaturated fatty acids such as oleic acid (C18), linoleic acid (C18) and linolenic acid (C18); or include triglycerides whose main components are fatty acids, such as soybean oil, peanut oil, palm oil and olive oil, or include oil-containing waste such as waste cooking oil.

6. The method according to claim 4, wherein: Polyoxyethylene ether Brij58 emulsifier was also added during the fermentation of recombinant Escherichia coli.

7. A method for preparing a recombinant Escherichia coli capable of synthesizing β-hydroxy-β-methylbutyrate HMB, comprising: (1) Deletion, knockout or inhibitory expression of the following genes: fatty acid metabolism regulator fadR gene, β-ketoacyl-ACP synthase II gene fabF, and β-ketoacyl-ACP synthase III gene fabH; and (2) Enhancement or exogenous insertion: fatty acyl-CoA synthetase gene fadD, long-chain fatty acid transporter gene fadL, and short-chain fatty acid degradation regulatory gene cluster gene atoSC.

8. The method according to claim 7, further comprising: Deletion, knockout or inhibitory expression: fumarate reductase flavoprotein A subunit gene frdA, NAD(P) transhydrogenase gene sthA; as well as Enhancement or exogenous insertion: acetyl-CoA acetyltransferase atoB gene, 3-hydroxy-3-methylglutaryl-CoA synthase gene mvaS, 3-hydroxy-3-methylglutaryl-CoA hydratase gene liuC, glutaryl-CoA decarboxylase A subunit gene aibA, glutaryl-CoA decarboxylase B subunit gene aibB, acyl-CoA thioesterase gene paaI.

9. Use of the strain according to claims 1 to 2 in producing β-hydroxy-β-methylbutyrate HMB.