High-yield free fatty acid escherichia coli with multi-gene synergistic overexpression as well as construction method and application thereof
By knocking out the fadE gene and overexpressing the fadR, rfaY, tesA' and yafL genes, a multi-gene recombinant Escherichia coli was constructed, which solved the problem of improving the fatty acid synthesis capacity of Escherichia coli and achieved efficient production of free fatty acids, reaching a test tube culture yield of 5736.1 mg/L and a fermentation tank yield of 39.6 g/L.
Patent Information
- Application Number
- CN202510453733.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-11
- Publication Date
- 2025-09-23
AI Technical Summary
Existing technologies make it difficult to efficiently transform the fatty acid synthesis pathway of Escherichia coli, resulting in limited room for improvement in its fatty acid synthesis capacity and an inability to meet the production needs of biofuels and chemical products.
By knocking out the fadE gene, overexpressing the fadR, rfaY and tesA' genes, and combining the synergistic expression of the yafL gene, a multi-gene recombinant Escherichia coli was constructed to regulate the fatty acid metabolic pathway and improve the fatty acid synthesis capacity.
The constructed recombinant Escherichia coli strain rfaY+-yafL+-fadR+ produced 5736.1 mg/L of fatty acids in test tube culture, an increase of 617.4% compared with the control strain. The yield in a 5L fermenter reached 39.6 g/L, becoming the highest fatty acid producer to date.
Smart Images

Figure CN120683144A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of producing fatty acids through microbial fermentation, and particularly relates to a multi-gene coordinated overexpression Escherichia coli high-yield free fatty acid and a construction method and application thereof. Background Art
[0002] Free fatty acids (FFAs) are important raw materials for biofuels and chemical products. Fatty acid-derived fuels have attracted considerable attention as a renewable resource due to their low hygroscopicity and good miscibility with diesel. Furthermore, as important platform compounds, FFAs can be converted into a variety of fuels and industrial chemicals, such as fatty acid methyl esters, fatty acid ethyl esters, fatty alcohols, and olefins, making FFAs and their derivatives an excellent alternative to petroleum fuels.
[0003] Currently, fatty acids are primarily obtained through direct extraction from animal and plant oils, chemical synthesis, and microbial fermentation. Direct extraction from plants and animals is affected by factors such as availability, region, and season. While chemical synthesis can produce fatty acids in large quantities, it may involve the use of hazardous chemicals and is relatively costly. Microbial fermentation is a relatively economical and eco-friendly method for obtaining fatty acids. Using synthetic biology to engineer Escherichia coli to directly and efficiently and economically produce FFAs from simple carbon sources such as glycerol is both low-cost and sustainable. The fatty acid biosynthetic pathway in E. coli exhibits regulatory flexibility, enabling the production of a diverse range of lipids to meet specific needs. The strategy of engineering E. coli to produce FFAs through synthetic biology not only provides a new resource for the biomanufacturing industry but also drives the industry towards a more environmentally friendly and efficient approach, potentially transforming the global production landscape of energy and chemical products.
[0004] In microbial metabolic engineering, engineering Escherichia coli to enhance its fatty acid synthesis capacity is an important research area. However, because the fatty acid synthesis pathway of E. coli has been extensively studied, improving and optimizing the existing pathway has become increasingly difficult. This is mainly because the core metabolic pathway of E. coli is already highly optimized, leaving limited room for further enhancement of its synthesis capacity. Therefore, identifying and analyzing non-pathway genes is of great significance for exploring the potential of E. coli to synthesize fatty acids. This approach not only enhances our understanding of the complexity of microbial metabolic networks but also may provide new pathways for the production of biofuels and other bio-based chemicals. Summary of the Invention
[0005] The first object of the present invention is to provide a recombinant Escherichia coli that produces free fatty acids.
[0006] The second object of the present invention is to provide a method for constructing the above-mentioned recombinant Escherichia coli for producing free fatty acids.
[0007] The third object of the present invention is to provide the use of the above-mentioned free fatty acid-producing recombinant Escherichia coli in synthesizing free fatty acids.
[0008] The technical solution of the present invention is summarized as follows:
[0009] A recombinant Escherichia coli strain for producing free fatty acids, its construction method, and use. The present invention uses Escherichia coli MG1655 (DE3) ΔfadE, in which the fadE gene in the fatty acid degradation metabolic pathway has been knocked out, as a base strain. An expression cassette overexpressing the fadR gene is seamlessly connected to a plasmid backbone overexpressing the rfaY and tesA' genes to construct a recombinant plasmid pRR, which is then transformed into Escherichia coli MG1655 (DE3) ΔfadE to obtain the recombinant strain rfaY. + -fadR + ; The plasmid pASKA-yafL that overexpresses the yafL gene + Transformed into recombinant strain rfaY + -fadR + The recombinant strain rfaY was obtained + -yafL + -fadR + .
[0010] A method for constructing a high-yield free fatty acid Escherichia coli with coordinated overexpression of multiple genes is characterized by comprising the following steps:
[0011] (1) The plasmid pASKA-fadR, which overexpresses the endogenous gene fadR in Escherichia coli MG1655 (DE3), was amplified by using the upper primer T5-fadR_Fw and the lower primer T5-fadR_Rv. + The fragment was obtained to obtain an expression cassette for overexpressing fadR;
[0012] The nucleotide sequence of T5-fadR_Fw is shown in SEQ ID NO.1;
[0013] The nucleotide sequence of the T5-fadR_Rv is shown in SEQ ID NO.2;
[0014] The nucleotide sequence of the gene fadR is shown in SEQ ID NO.3;
[0015] pASKA-fadR + The nucleotide sequence is shown in SEQ ID NO.4;
[0016] The nucleotide sequence of the fadR overexpression cassette fragment is shown in SEQ ID NO.5;
[0017] (2) Amplifying the fragment of plasmid pRF that co-overexpresses the endogenous genes rfaY and tesA' of Escherichia coli MG1655 (DE3) by priming rfaY-tesA'_Fw and rfaY-tesA'_Rv to obtain the pRF_rfaY_tesA' backbone;
[0018] The nucleotide sequence of rfaY-tesA'_Fw is shown in SEQ ID NO.6;
[0019] The nucleotide sequence of rfaY-tesA'_Rv is shown in SEQ ID NO.7;
[0020] The nucleotide sequence of the pRF plasmid is shown in SEQ ID NO.8;
[0021] The nucleotide sequence of the pRF_rfaY_tesA' skeleton is shown in SEQ ID NO.9;
[0022] The nucleotide sequence of the gene rfaY is shown in SEQ ID NO.10;
[0023] The nucleotide sequence of the gene tesA' is shown in SEQ ID NO.11;
[0024] (3) The fadR overexpression cassette fragment was connected to the pRF_rfaY_tesA' backbone by seamless cloning to construct the recombinant plasmid pRR;
[0025] The nucleotide sequence of the plasmid pRR is shown in SEQ ID NO.12;
[0026] (4) The recombinant plasmid pRR was transformed into Escherichia coli MG1655 (DE3) ΔfadE to obtain the free fatty acid synthesizing recombinant Escherichia coli strain rfaY + -fadR + .
[0027] (5) Plasmid pF overexpressing the thioesterase gene tesA' was transformed into Escherichia coli MG1655(DE3)ΔfadE to obtain the control strain F;
[0028] The nucleotide sequence of the pF plasmid is shown in SEQ ID NO.13;
[0029] (6) Plasmid pASKA-yafL, which overexpresses the endogenous gene yafL of Escherichia coli MG1655 (DE3), was used to + Transformed strain rfaY + -fadR + The recombinant strain rfaY was obtained + -yafL+ -fadR + ;
[0030] The nucleotide sequence of the gene yafL is shown in SEQ ID NO.14;
[0031] pASKA-yafL + The nucleotide sequence of the plasmid is shown in SEQ ID NO.15.
[0032] 2. The free fatty acid-producing recombinant Escherichia coli constructed by the construction method of claim 1.
[0033] 3. The use of recombinant Escherichia coli for producing free fatty acids according to claim 2 to synthesize free fatty acids
[0034] Advantages of the present invention:
[0035] 1. The free fatty acid producing recombinant Escherichia coli strain rfaY constructed by the present invention + -fadR + It can efficiently synthesize free fatty acids using glycerol as a carbon source by regulating endogenous genes related to fatty acid metabolism and genes not directly related to fatty acid metabolism in the cell. 3721.8 mg / L of free fatty acids was obtained through test tube culture, which was 365.5% higher than that of the control strain F.
[0036] 2. The free fatty acid producing recombinant Escherichia coli strain rfaY constructed by the present invention + -yafL + -fadR + Free fatty acids can be further efficiently synthesized by regulating fatty acid metabolic pathways and non-fatty acid metabolic pathways.
[0037] 3. The free fatty acid synthesis recombinant Escherichia coli strain rfaY constructed by the present invention + -yafL + -fadR + The free fatty acid yield of test tube fermentation can reach 5736.1 mg / L, which is higher than that of strains F and rfaY. + -fadR + An increase of 617.4% and 54.1% respectively.
[0038] 4. The free fatty acid synthesis recombinant Escherichia coli strain rfaY constructed by the present invention + -yafL + -fadR + In a 5L fermenter, the free fatty acid yield reached 39.6g / L by fed-batch fermentation, which is the highest yield of free fatty acids synthesized by Escherichia coli at present. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] Figure 1 Schematic diagram of the construction of recombinant plasmid pRR;
[0040] Figure 2 rfaY is a high-yield free fatty acid strain + -yafL + -fadR + Schematic diagram of the composition;
[0041] Figure 3 Recombinant Escherichia coli strain rfaY for free fatty acid synthesis + -fadR + and rfaY + -yafL + -fadR + Test tube fermentation yield graph;
[0042] Figure 4 Recombinant Escherichia coli strain rfaY for free fatty acid synthesis + -yafL + -fadR + Fed-batch fermentation yield graph;
[0043] Figure 5 This is a diagram of the solid fatty acid layer after centrifugation of the fermentation sample. DETAILED DESCRIPTION
[0044] The original strain Escherichia coli MG1655 (DE3) was purchased from ZOMANBIO (http: / / www.zomanbio.com / products_info.php?nid=4196) in September 2018. The E. coli MG1655 (DE3) ΔfadE chassis strain was constructed and stored in our laboratory.
[0045] rfaY gene: from Escherichia coli MG1655 (DE3);
[0046] yafL gene: from Escherichia coli MG1655 (DE3);
[0047] fadR gene: from Escherichia coli MG1655 (DE3);
[0048] The nucleotide sequence of the pRF plasmid is shown in SEQ ID NO.8.
[0049] The nucleotide sequence of the pRR plasmid is shown in SEQ ID NO.12.
[0050] The nucleotide sequence of the pF plasmid is shown in SEQ ID NO.13.
[0051] pASKA-fadR + The nucleotide sequence of the plasmid is shown in SEQ ID NO. 4 (Kitagawa M, Ara T, Arifuzzaman M, et al. Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research [J]. DNA Res, 2005, 12 (5): 291-299.).
[0052] pASKA-yafL + The nucleotide sequence of the plasmid is shown in SEQ ID NO. 15 (Kitagawa M, Ara T, Arifuzzaman M, et al. Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research [J]. DNA Res, 2005, 12 (5): 291-299.).
[0053] Product synthesis in microorganisms is the result of the combined regulation of product metabolic pathways and complex metabolic networks within the cell. Therefore, to fully tap the product synthesis potential of microorganisms, accelerate the construction of high-yield engineered strains, and decipher the complex regulatory mechanisms of product synthesis, it is necessary to identify potential genes within the cell that promote product synthesis and effectively regulate their expression. Therefore, identifying and regulating the expression of potential genes within microorganisms not only fully taps the potential of microbial product synthesis, but also allows for the rapid construction of artificial microbial cell factories and in-depth exploration of the cellular product synthesis and regulatory mechanisms.
[0054] The present invention will be further described below with reference to specific embodiments.
[0055] Example 1: A method for constructing a recombinant Escherichia coli strain for producing free fatty acids, characterized by comprising the following steps:
[0056] (1) The plasmid pASKA-fadR overexpressing the endogenous gene fadR (SEQ ID NO.3) of Escherichia coli MG1655 (DE3) was cloned by priming T5-fadR_Fw (SEQ ID NO.1) and priming T5-fadR_Rv (SEQ ID NO.2). + (SEQ ID NO.4) to obtain an expression cassette for overexpressing fadR (SEQ ID NO.5).
[0057] (2) By amplifying the fragment of the plasmid pRF (SEQ ID NO.8) that co-overexpresses the endogenous genes rfaY (SEQ ID NO.10) and tesA' (SEQ ID NO.11) of Escherichia coli MG1655 (DE3) through the upper primer rfaY-tesA'_Fw (SEQ ID NO.6) and the lower primer rfaY-tesA'_Rv (SEQ ID NO.7), the pRF_rfaY_tesA' skeleton (SEQ ID NO.9) was obtained.
[0058] (3) The fadR overexpression cassette fragment (SEQ ID NO. 5) was connected to the pRF_rfaY_tesA' backbone (SEQ ID NO. 9) by seamless cloning to construct the recombinant plasmid pRR (SEQ ID NO. 12).
[0059] (4) The recombinant plasmid pRR (SEQ ID NO.12) was transformed into Escherichia coli MG1655 (DE3) ΔfadE to obtain the free fatty acid synthesizing recombinant Escherichia coli strain rfaY + -fadR + .
[0060] (5) Plasmid pF (SEQ ID NO. 13) overexpressing the thioesterase gene tesA' was transformed into Escherichia coli MG1655 (DE3) ΔfadE to obtain the control strain F;
[0061] (6) Plasmid pASKA-yafL, which overexpresses the endogenous gene yafL (SEQ ID NO.14) of Escherichia coli MG1655 (DE3), was used to + (SEQ ID NO.15) Transformed strain rfaY + -fadR + The recombinant strain rfaY was obtained + -yafL + -fadR + .
[0062] Example 2: Recombinant Escherichia coli strains F, rfaY + -fadR +、rfaY + -yafL + -fadR + Production of free fatty acids by in vitro fermentation
[0063] 1. Strain activation
[0064] The recombinant Escherichia coli strain F, rfaY + -fadR + 、rfaY + -yafL + -fadR + Take out from -80℃ freezer and culture strains F, rfaY + -fadR + kanamycin was added at a final concentration of 50 μg / mL; strain rfaY was cultured + -yafL + -fadR + Chloramphenicol and kanamycin (50 μg / mL, final concentrations of 34 μg / mL) were added and cultured overnight at 30°C and 250 rpm to activate the strain.
[0065] 2. Test tube fermentation
[0066] The activated F, rfaY obtained in step 1 + -fadR + 、rfaY + -yafL + -fadR + The culture solution was transferred into test tubes containing 5 mL of the corresponding resistance test tube fermentation medium at a ratio of 1%, and cultured at 30°C and 250 rpm. 600 When it is 1, in F, rfaY + -fadR + 、rfaY + -yafL + -fadR + IPTG inducer was added to the culture medium at a final concentration of 100 μM, and the culture was continued at 30°C and 250 rpm for 40 h. The culture medium was used for product analysis.
[0067] The formula of the test tube fermentation medium is: 17.1g / L Na2HPO4·12H2O, 3g / L KH2PO4, 0.5g / L NaCl, 2g / L NH4Cl, 2g / L yeast extract, 30g / L glycerol, 0.25g / L MgSO4·7H2O, 11.1mg / L CaCl2, 1mL / L trace element stock solution, 10mg / L V B1, 0.1% (v / v) Triton-X100, and the balance is water. Strains F and rfaY were cultured. +-fadR + kanamycin was added at a final concentration of 50 μg / mL; strain rfaY was cultured + -yafL + -fadR + Chloramphenicol and kanamycin were added at a final concentration of 34 μg / mL and 50 μg / mL, respectively.
[0068] The trace element mother solution is: 27g / L FeCl3·6H2O, 2g / L ZnCl2, 2g / L Na2MoO4·2H2O, 1.9g / LCuSO4·5H2O and 0.5g / LH3BO3, and the balance is water.
[0069] 3. Extraction and analysis of free fatty acids
[0070] Take 500 μL of F and rfaY obtained in step 2 of this example respectively + -fadR + 、rfaY + -yafL + -fadR + To the culture medium, 50 μL of hydrochloric acid and 60 μg of heptadecanoic acid were added as an internal standard, followed by the addition of 500 μL of ethyl acetate, vortexing for 5 minutes, and centrifugation at 12,000 rpm for 2 minutes. 350 μL of the upper organic phase was collected, and 500 μL of ethyl acetate was added to the lower solution. The mixture was vortexed for 5 minutes and centrifuged at 12,000 rpm for 2 minutes. 500 μL of the upper organic phase was collected. The organic phases collected from these two steps were combined and filtered through a 0.22 μm organic filter. The filtrate was analyzed by gas chromatography (GC). A SHIMADZU Nexis GC-2030 instrument was used, equipped with a TG-WaxMSA column (30 m × 0.32 mm × 0.25 μm; Thermo Scientific) and a dielectric barrier discharge plasma detector (BID). Helium was used as the carrier gas at a flow rate of 1 mL / min, and a splitless injection volume of 1 μL was used. The column temperature program was as follows: initial temperature 50°C, hold for 1 minute, then increase to 245°C at a rate of 30°C / min, and hold at 245°C for 22.5 minutes. Fatty acid species were identified by reference to the elution time of the corresponding fatty acid standards. Fatty acid amounts were quantified by reference to the fatty acid peak area and the internal standard (heptadecanoic acid) peak area. The final fatty acid concentration was the sum of the concentrations of saturated and monounsaturated fatty acids with chain lengths of C12, C14, C16, and C18.
[0071] 4. Results
[0072] Depend on Figure 3It can be seen that the recombinant E. coli strain F cultured in test tubes produced 518.4 mg / L of free fatty acids; the recombinant E. coli strain rfaY + -fadR + It has good fatty acid synthesis ability, and the test tube culture yields 3721.8 mg / L free fatty acids, which is 365.5% higher than the control strain F. + -yafL + -fadR + It has the best fatty acid synthesis ability, and the test tube culture yields 5736.1 mg / L free fatty acids, which is higher than that of strains F and rfaY. + -fadR + An increase of 617.4% and 54.1% respectively.
[0073] Example 3: Recombinant E. coli strain rfaY + -yafL + -fadR + Fed-batch fermentation for free fatty acid production
[0074] 1. Strain activation
[0075] The recombinant Escherichia coli strain rfaY + -yafL + -fadR + The cells were taken out from a -80°C freezer and cultured overnight in LB liquid medium (containing chloramphenicol at a final concentration of 34 μg / mL and kanamycin at 50 μg / mL) at 30°C and 250 rpm to activate the strain.
[0076] 2. Fed-batch fermentation
[0077] The activated rfaY obtained in step 1 + -yafL + -fadR + The strain culture solution was transferred into 200 mL of seed fermentation medium at a ratio of 1%, and the OD 600 When the OD reaches 4, transfer all of it to a 5L fermenter containing 1.8L fermenter medium. The fermentation temperature is set to 30℃, the pH is adjusted to about 7 with ammonia water, and the air flow rate is set to 2L / min. The speed is set to 300-800rpm to ensure that the dissolved oxygen is above 30%. After about 12 hours of cultivation, the OD 600When the OD value is about 12, add IPTG inducer with a final concentration of 100 μM. When the glycerol in the culture medium is exhausted, fix the speed to 800 rpm and start feeding. Set the dissolved oxygen-linked feeding and adjust the feeding speed to control the dissolved oxygen not to be higher than 40%. After IPTG induction, 5 mL samples were taken at 0.0 h, 12.8 h, 15.9 h, 17.9 h, 26.0 h, 31.0 h, 35.0 h, 38.0 h, 41.1 h, 43.3 h, 45.9 h, 48.2 h and 52.6 h for OD determination. 600 , fatty acid content and glycerol content.
[0078] The formula of the seed fermentation medium is: 6 g / L NH4Cl, 8.5 g / L KH2PO4, 0.5 g / L sodium citrate, 5 g / L yeast extract, 15 g / L glycerol, 1 g / L MgSO4·7H2O, 0.07 g / L CaCl2·2H2O, 4 mL / L trace element stock solution, 10 mg / LVB1, 34 μg / mL chloramphenicol and 50 μg / mL kanamycin, and the balance is water.
[0079] The formula of the fermentation tank culture medium is: 6 g / L NH4Cl, 8.5 g / L KH2PO4, 0.5 g / L sodium citrate, 5 g / L yeast extract, 15 g / L glycerol, 1 g / L MgSO4·7H2O, 0.07 g / L CaCl2·2H2O, 4 mL / L trace element stock solution, 100 mg / L V B1, 34 μg / mL chloramphenicol and 50 μg / mL kanamycin, and the balance is water.
[0080] The trace element mother solution is: 27g / L FeCl3·6H2O, 2g / L ZnCl2, 2g / L Na2MoO4·2H2O, 1.9g / LCuSO4·5H2O and 0.5g / LH3BO3, and the balance is water.
[0081] The feed formula was: 2.47 g / L MgSO4·7H2O, 500 g / L glycerol and 100 g / L yeast extract, with the balance being water.
[0082] 3. Metabolite analysis
[0083] (1) Extraction and analysis of free fatty acids: 500 μL of the fermentation broth obtained in step 2 of this example with culture times of 0.0 h, 12.8 h, 15.9 h, 17.9 h, 26.0 h, 31.0 h, 35.0 h, 38.0 h, 41.1 h, 43.3 h, 45.9 h, 48.2 h and 52.6 h were taken respectively, and the extraction and analysis of free fatty acids in step 3 of Example 2 were performed.
[0084] (2) Extraction and analysis of glycerol: 1 mL of the fermentation broth obtained in step 2 of this embodiment was taken respectively, centrifuged at 14000 rpm for 5 min, and the supernatant was centrifuged again at 14000 rpm for 5 min. The collected supernatants were filtered with 0.22 μm water filter membranes. The filtrate was detected and analyzed by high performance liquid chromatography (HPLC). A Waters e2695 HPLC instrument, a Waters 2414 differential detector, and an Aminex HPX-87H chromatographic column (Bio-Rad) were used, the mobile phase was 5 mM H2SO4, the flow rate was 0.6 mL / min, the injection volume was 10 μL, and the 65°C maintenance time was 30 min. The peak time of the glycerol standard was used for qualitative analysis, and the standard curve of the concentration and peak area of the glycerol standard was used for quantitative analysis.
[0085] 4. Results
[0086] Depend on Figure 4 It can be seen that the recombinant E. coli strain rfaY + -yafL + -fadR + The strain was fermented in a 5L fermenter in a fed-batch manner to further improve the fatty acid production. At 45.9 h of fermentation, the OD 600 The yield of free fatty acids reached a maximum of 39.6 g / L, the production rate was 0.86 g / L / h, the glycerol consumption was 203.7 g / L, and the yield was 0.19 g fatty acid / g glycerol, which is about 47.5% of the maximum theoretical yield. This is the highest yield of free fatty acids synthesized by E. coli so far. After centrifugation of a sample with a fermentation time of 45.9 h, a solid fatty acid layer was clearly observed in the supernatant, indicating that there was a high concentration of free fatty acids in the fermentation broth ( Figure 5 )
[0087] Sequence Listing
[0088] SEQ ID NO.1
[0089] T5-fadR_Fw nucleotide sequence (artificially synthesized)
[0090] tcataaaaaatttatttgctttgtgagcg
[0091] SEQ ID NO.2
[0092] T5-fadR_Rv nucleotide sequence (artificially synthesized)
[0093] attctcaccaataaaaaacgccc
[0094] SEQ ID NO.3
[0095] fadR nucleotide sequence (from wild-type Escherichia coli MG1655(DE3))
[0096] atggtcattaaggcgcaaagcccggcgggtttcgcggaagagtacattattgaaagtatctggaataaccgcttccctcccgggactattttgcccgcagaacgtgaactttcagaattaattggcgtaacgcgtactacgttacgtgaagtgttacagcgtctggcacgagatggctggttgaccattcaacatggcaagccgacgaaggtgaataatttctgggaaacttccggtttaaatatccttgaaacactggcgcgactggatcacgaaagtgtgccgcagcttattgataatttgctgtcggtgcgtaccaatatttccactatttttattcgcaccgcgtttcgtcagcatcccgataaagcgcaggaagtgctggctaccgctaatgaagtggccgatcacgccgatgcctttgccgagctggattacaacatattccgcggcctggcgtttgcttccggcaacccgatttacggtctgattcttaacgggatgaaagggctgtatacgcgtattggtcgtcactatttcgccaatccggaagcgcgcagtctggcgctgggcttctaccacaaactgtcggcgttgtgcagtgaaggcgcgcacgatcaggtgtacgaaacagtgcgtcgctatgggcatgagagtggcgagatttggcaccggatgcagaaaaatctgccgggtgatttagccattcaggggcgataa
[0097] SEQ ID NO.4
[0098] pASKA-fadR + Nucleotide sequence (synthetic)
[0099]
[0100] SEQ ID NO.5
[0101]
[0102] SEQ ID NO.6
[0103] rfaY-tesA'_Fw nucleotide sequence (artificially synthesized)
[0104] tttattggtgagaatgcgactcctgcattaggaaatactagt
[0105] SEQ ID NO.7
[0106] rfaY-tesA'_Rv nucleotide sequence (artificially synthesized)
[0107] ataaattttttatgaataagggagagcgtcgagatccc
[0108] SEQ ID NO.8
[0109] pRF nucleotide sequence (artificially synthesized)
[0110]
[0111] SEQ ID NO.9
[0112] Nucleotide sequence of the pRF_rfaY_tesA' backbone (artificially synthesized)
[0113]
[0114] SEQ ID NO.10
[0115] rfaY nucleotide sequence (from wild - type Escherichia coli MG1655(DE3))
[0116] atgattcagaagagcaagatcaaagacttggttgtttttaccgatgaaaacaattcaaagtacctcaatgtattaaatgacttcttgtcttataatataaatatcatcaaggtttttcgttctattgatgatacaaaagttatgcttattgataccgattacggtaaattgattcttaaggttttttctccgaaagttaagcgtaacgaacgtttctttaagtctctgttaaaaggtgattattacgaacgcctttttgagcaaacccaaaaagtacgaaatgaagggttaaatacactcaatgacttttatttattggctgaacggaaaaccttacgttttgtccatacttatatcatgatcatcgagtatattgatggcatagagttgtgtgatatgcccgatattgatgatgcgctaaaaaataaaattcagcaatcaattaatgccttacatcaacatggcatggtttctggcgacccccatcgtggtaacttcattataaaaaatggtgaggttcgaattatcgatctctccggaaagcgtgcttcagcgcagcgtaaagcgaaagatcgtattgacttagagcgtcattacggtattaaaaatgagattagagatctaggctattatcttttagtatatcgtaaaaaaatgcgcaattttatgcggcgtttgaaagggaaaccagcgcgctaa
[0117] SEQ ID NO.11
[0118] tesA' nucleotide sequence (synthetic)
[0119] atggcggacacgttattgattctgggtgatagcctgagcgccgggtatcgaatgtctgccagcgcggcctggcctgccttgttgaatgataagtggcagagtaaaacgtcggtagttaatgccagcatcagcggcgacacctcgcaacaaggactggcgcgccttccggctctgctgaaacagcatcagccgcgttgggtgctggttgaactgggcggcaatgacggtttgcgtggttttcagccacagcaaaccgagcaaacgctgcgccagattttgcaggatgtcaaagccgccaacgctgaaccattgttaatgcaaatacgtctgcctgcaaactatggtcgccgttataatgaagcctttagcgccatttaccccaaactcgccaaagagtttgatgttccgctgctgcccttttttatggaagaggtctacctcaagccacaatggatgcaggatgacggtattcatcccaaccgcgacgcccagccgtttattgccgactggatggcgaagcagttgcagcctttagtaaatcatgactcataa
[0120] SEQ ID NO.12
[0121] pRR nucleotide sequence (synthetic)
[0122]
[0123] SEQ ID NO.13
[0124] pF plasmid nucleotide sequence (artificially synthesized)
[0125]
[0126] SEQ ID NO.14
[0127] yafL nucleotide sequence (from wild-type Escherichia coli MG1655(DE3))
[0128] atgtccttgccgtcgattccatcctttgtattgtcgggattactgttgatttgtttgccgttttcttcatttgccagcgccaccacatcacatatctctttcagctacgccgcccgccagcggatgcaaaaccgtgcgcgtttattaaaacagtaccaaactcatctgaaaaagcaggccagctatattgtggaaggcaatgccgaaagcaaaagggcgctacgccagcacaaccgggagcagataaaacagcatccagaatggtttcctgctccgctcaaggcgagtgacagacgctggcaggcgctggcggaaaacaaccactttttaagcagcgaccatctgcataacattaccgaagtggcgattcaccgcctggagcagcagcttggcaagccttacgtctggggcggtacgcggcctgataaaggctttgactgtagcgggttggttttttatgcctacaacaagatccttgaggctaagctcccgcgcacggccaatgagatgtaccactatcgccgggcaacgattgtggcgaacaacgacctgcgccggggagatttgctgtttttccatatccacagccgcgagatagccgatcatatgggcgtgtatttgggcgatgggcaatttatcgagtcgccacgtaccggcgaaaccattcggataagccgattagccgaacctttctggcaggaccattttttgggcgcgcgcaggattttgacggaagagacgattttgtag
[0129] SEQ ID NO.15
[0130] pASKA-yafL + Nucleotide sequence (synthetic)
[0131]
Claims
1. A method for constructing a high-yield free fatty acid Escherichia coli strain with coordinated overexpression of multiple genes, characterized by: The steps include: (1) The plasmid pASKA-fadR, which overexpresses the endogenous gene fadR in Escherichia coli MG1655 (DE3), was amplified by using the upper primer T5-fadR_Fw and the lower primer T5-fadR_Rv. + The fragment was obtained to obtain an expression cassette for overexpressing fadR; The nucleotide sequence of T5-fadR_Fw is shown in SEQ ID NO.1; The nucleotide sequence of the T5-fadR_Rv is shown in SEQ ID NO.2; The nucleotide sequence of the gene fadR is shown in SEQ ID NO.3; pASKA-fadR + The nucleotide sequence is shown in SEQ ID NO.4; The nucleotide sequence of the fadR overexpression cassette fragment is shown in SEQ ID NO.5; (2) Amplifying the fragment of plasmid pRF that co-overexpresses the endogenous genes rfaY and tesA' of Escherichia coli MG1655 (DE3) by priming rfaY-tesA'_Fw and rfaY-tesA'_Rv to obtain the pRF_rfaY_tesA' backbone; The nucleotide sequence of rfaY-tesA'_Fw is shown in SEQ ID NO.6; The nucleotide sequence of rfaY-tesA'_Rv is shown in SEQ ID NO.7; The nucleotide sequence of the pRF plasmid is shown in SEQ ID NO.8; The nucleotide sequence of the pRF_rfaY_tesA' skeleton is shown in SEQ ID NO.9; The nucleotide sequence of the gene rfaY is shown in SEQ ID NO.10; The nucleotide sequence of the gene tesA' is shown in SEQ ID NO.11; (3) The fadR overexpression cassette fragment was connected to the pRF_rfaY_tesA' backbone by seamless cloning to construct the recombinant plasmid pRR; The nucleotide sequence of the plasmid pRR is shown in SEQ ID NO.12; (4) The recombinant plasmid pRR was transformed into Escherichia coli MG1655 (DE3) ΔfadE to obtain the free fatty acid synthesizing recombinant Escherichia coli strain rfaY + -fadR + . (5) Plasmid pF overexpressing the thioesterase gene tesA' was transformed into Escherichia coli MG1655(DE3)ΔfadE to obtain the control strain F; The nucleotide sequence of the pF plasmid is shown in SEQ ID NO.13; (6) Plasmid pASKA-yafL, which overexpresses the endogenous gene yafL of Escherichia coli MG1655 (DE3), was used to + Transformed strain rfaY + -fadR + The recombinant strain rfaY was obtained + -yafL + -fadR + ; The nucleotide sequence of the gene yafL is shown in SEQ ID NO.14; pASKA-yafL + The nucleotide sequence of the plasmid is shown in SEQ ID NO.
15.
2. The free fatty acid-producing recombinant Escherichia coli constructed according to the construction method of claim 1.
3. The method of claim 2 for producing free fatty acids by recombinant Escherichia coli to synthesize free fatty acids.