Tagolose-4-epimerase mutant as well as coding gene and application thereof

Abstract

The invention belongs to the field of biological pharmacy and biotransformation, and particularly relates to a tagatose-4-epimerase mutant as well as a coding gene and application thereof. The tagatose-4-epimerase mutant disclosed by the invention is obtained by carrying out single mutation or combined mutation on an amino acid residue at a specific position of an amino acid sequence as shown in SEQ ID NO.1. Compared with wild type tagatose-4-epimerase, the mutant has the advantage that the catalytic activity is improved when the D-tagatose is prepared through conversion. The obtained tagatose-4-epimerase mutant has the advantages of being mild in reaction condition, green, environmentally friendly, single in product and easy to separate and purify, and the production cost is greatly reduced.

Description

[0001] This invention is a divisional application of Chinese Patent Application No. 202411874516.9 with an application date of December 19, 2024. The original invention name was "A Tagatose-4-Epimerase Mutant and Its Application". Technical Field

[0002] This invention belongs to the fields of biopharmaceuticals and biotransformation, and specifically relates to a tagatose-4-epimerase mutant, a mutant-encoding gene, a recombinant vector containing the mutant-encoding gene, a recombinant genetically engineered bacterium containing the mutant-encoding gene, and the application of the tagatose-4-epimerase mutant in the preparation of D-tagatose. Background Art

[0003] Tagatose is an epimer of fructose, in which five carbon molecules and one oxygen molecule form a cyclic structure. It is a natural six-carbon ketose that exists in nature but is relatively rare. Its sweetening characteristics are similar to those of sucrose, and the calories produced are only one-third of those of sucrose. Tagatose has the advantages of low energy, blood sugar lowering, improving the intestinal flora, and anti-caries, etc., so it has broad application prospects in the fields of medicine, health products, etc.

[0004] The content of tagatose in nature is extremely low. Currently, it is mainly synthesized by chemical or biological methods. The chemical method uses D-galactose as a raw material and prepares D-tagatose through two-step reactions. However, the chemical method has the disadvantages of violent and uncontrollable reaction conditions, easy generation of pollution, complex process, and many by-products that are not conducive to separation and purification. The biological method for preparing D-tagatose has the advantages of environmental friendliness, single product, and simple separation and purification, so it has become the main method for D-tagatose synthesis at present. Currently, the double-enzyme method is mainly used, that is, D-tagatose is synthesized by the synergistic catalysis of β-galactosidase and L-arabinose isomerase on lactose. This method requires two-step reactions to synthesize D-tagatose: First, β-galactosidase hydrolyzes lactose to generate the intermediate product D-galactose, and then D-tagatose is synthesized by the catalysis of L-arabinose isomerase. However, due to the high cost of the substrate lactose in this method and the need for two-step reactions resulting in a complex process; at the same time, limited by the hydrolysis of lactose in the first step, the utilization rate of the substrate is low, further increasing the cost of this method. Therefore, finding other efficient ways to synthesize D-tagatose is of great research significance and application value.

[0005] Tagatose-4-epimerase can synthesize D-tagatose through an epimerization reaction using inexpensive D-fructose as a substrate. It not only has the characteristics of environmental friendliness, simple separation and purification, and mild reaction conditions, but also has the advantages of single reaction and low cost, and has good application prospects. Summary of the Invention

[0006] The present invention aims to overcome the defects of the existing D-tagatose synthesis process, such as cumbersome process steps, complex separation and purification, severe reaction conditions, difficult control, and high preparation cost. It provides a tagatose-4-epimerase mutant, a mutant encoding gene, a recombinant vector containing the mutant encoding gene, a recombinant genetic engineering bacterium containing the mutant encoding gene, and applies the tagatose-4-epimerase mutant to the process of preparing D-tagatose.

[0007] To achieve the above-mentioned invention object, the present invention is realized through the following technical solutions: A tagatose-4-epimerase mutant is derived from the amino acid shown in SEQ ID NO.1 by site-directed mutagenesis, and the mutated site is one or more of the following: (1) the 75th position, (2) the 140th position, (3) the 165th position, (4) the 361st position.

[0008] Preferably, a tagatose-4-epimerase mutant is derived from the amino acid shown in SEQ ID NO.1 by site-directed mutagenesis, and the mutated site is one or more of the following: (1) the 75th position, (2) the 140th position, (3) the 165th position, (4) the 361st position, (5) the 69th position, (6) the 70th position.

[0009] Preferably, the tagatose-4-epimerase mutant is derived from the amino acid shown in SEQ ID NO.1 by site-directed mutagenesis, and the mutated site is one or two of the following: (1) the 75th position, (4) the 361st position.

[0010] Preferably, the mutant is obtained by mutating the amino acid shown in SEQ ID NO.1 at one or more of the following sites: (1) mutating glutamic acid at the 75th position to alanine (E75A), (2) mutating proline at the 140th position to leucine (P140L), (3) mutating arginine at the 165th position to alanine (R165A), (4) mutating phenylalanine at the 361st position to histidine (F361H).

[0011] Preferably, the mutant is obtained by mutating the amino acid shown in SEQ ID NO.1 at one or more of the following sites: (1) mutating glutamic acid at the 75th position to alanine (E75A), (2) mutating proline at the 140th position to leucine (P140L), (3) mutating arginine at the 165th position to alanine (R165A), (4) mutating phenylalanine at the 361st position to histidine (F361H), (5) mutating arginine at the 69th position to alanine (R69A), (6) mutating asparagine at the 70th position to alanine (N70A).

[0012] As a further preference, the mutant is obtained by mutating the glutamic acid at the 75th position to alanine (E75A) and the phenylalanine at the 361st position to histidine (F361H) in the amino acids shown in SEQ ID NO.1, and its amino acid sequence is preferably as shown in SEQ ID NO.3.

[0013] A gene encoding a tagatose-4-epimerase mutant as described above, and the gene encoding the tagatose-4-epimerase mutant is preferably as shown in SEQ ID NO.4.

[0014] A recombinant vector constructed from the encoding gene as described above.

[0015] A recombinant genetically engineered bacterium transformed from the recombinant vector as described above.

[0016] The tagatose-4-epimerase mutant of the present invention is obtained by mutating multiple amino acids of the wild-type tagatose-4-epimerase, thereby improving its relative enzyme activity. First, the present invention ligates the wild-type tagatose-4-epimerase encoding gene (the sequence is as shown in SEQ ID NO.2) with the expression vector pET28a(+), and constructs a recombinant expression plasmid. Then the constructed recombinant expression plasmid is transformed into E. coli BL21(DE3). Using the recombinant expression plasmid containing the tagatose-4-epimerase encoding gene as a template, gene modification is carried out by site-directed mutagenesis technology, and then the recombinant expression plasmid is transformed into E. coli BL21(DE3) to obtain an E. coli BL21(DE3) recombinant genetically engineered bacterium containing the tagatose-4-epimerase mutant encoding gene. The obtained recombinant genetically engineered bacterium is induced to culture, the culture solution is separated to obtain cell bodies containing the recombinant tagatose-4-epimerase mutant, and the culture solution is separated from the cell bodies to obtain a crude enzyme solution of the tagatose-4-epimerase mutant. The relative activities of the mutant type tagatose-4-epimerase and the wild-type tagatose-4-epimerase are compared, and a tagatose-4-epimerase mutant with higher activity is screened.

[0017] Use of the tagatose-4-epimerase mutant as described above in the preparation of D-tagatose.

[0018] As a preference, the use is as follows: using the wet cell bodies obtained by fermentation culture of the recombinant genetically engineered bacterium containing the tagatose-4-epimerase mutant encoding gene, or the crude enzyme extracted after ultrasonic disruption of the wet cell bodies, or the purified pure enzyme as a catalyst, using D-fructose as a substrate, in the presence of Ni 2+ and reacting at 70-80 °C in a sodium phosphate buffer solution with a pH value of 7-9. After the reaction is complete, the reaction solution is separated and purified to obtain D-tagatose.

[0019] As a further preference, the application is as follows: using the wet bacterial cells obtained by fermenting and culturing a recombinant genetically engineered bacterium containing the coding gene of tagatose-4-epimerase mutant, or the crude enzyme extracted after ultrasonic disruption of the wet bacterial cells or the purified pure enzyme as a catalyst, using D-fructose as a substrate, and using a sodium phosphate buffer solution with a pH value of 8 as a reaction medium to form a reaction system. React at 75 °C, 1 mM Ni 2+ , 1000 rpm for 30 min, separate and purify the reaction solution to obtain D-tagatose; wherein, the dosage of the catalyst is 40 g / L based on the weight of the wet bacterial cells, and the initial concentration of the substrate is 50 g / L.

[0020] The wet bacterial cells obtained by fermenting and culturing the recombinant genetically engineered bacterium containing the coding gene of tagatose-4-epimerase mutant in the present invention are prepared as follows: inoculate the recombinant genetically engineered bacterium containing the coding gene of tagatose-4-epimerase mutant into an LB liquid medium containing kanamycin resistance with a final concentration of 50 μg / mL, culture at 37 °C and 180 rpm for 10 h, and then inoculate into a fresh LB liquid medium containing kanamycin resistance with a final concentration of 50 μg / mL at an inoculation amount of 2% (v / v), culture at 37 °C and 180 rpm until the OD600 of the bacterial cells reaches 0.6 - 0.8, add IPTG with a final concentration of 0.1 mM, induce and culture at 28 °C for 12 h, then centrifuge at 4 °C and 8000 rpm for 10 min, discard the supernatant, and collect the wet bacterial cells.

[0021] Preparation of the crude enzyme of the mutant type tagatose-4-epimerase in the present invention: Resuspend the wet bacterial cells of the recombinant genetically engineered bacterium containing the coding gene of tagatose-4-epimerase mutant with 9.8 mL of 50 mM sodium phosphate buffer solution with a pH of 7.0 per 0.2 g of wet bacterial cells, and perform ultrasonic disruption under ice bath conditions (200 W power, continuous for 1 s, intermittent for 2 s, continuously disrupt for 15 min) to obtain a cell lysate. Centrifuge the cell lysate obtained after ultrasonic disruption at 8000 rpm and 4 °C for 10 min, and the obtained supernatant is the required crude enzyme solution.

[0022] Therefore, the present invention has the following beneficial effects: The present invention prepares a tagatose-4-epimerase mutant with high catalytic activity and high stereoselectivity for D-tagatose. The obtained mutant has the advantages of mild reaction conditions, environmental friendliness, single product, and simple separation and purification. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is the SDS-PAGE diagram of tagatose-4-epimerase.

[0024] Figure 2Schematic diagram of the enzymatic synthesis pathway of D-tagatose.

[0025] Figure 3 Schematic diagram of HPLC detection of the substrate D-fructose and the product D-tagatose.

[0026] Figure 4 Histogram of relative enzyme activities of wild-type tagatose-4-epimerase and tagatose-4-epimerase mutants. Detailed implementation manners

[0027] The present invention will be further described below in conjunction with the accompanying drawings of the specification and specific embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are usually only some embodiments of the present invention, rather than all embodiments. Therefore, all other embodiments obtained by those of ordinary skill in the art without creative efforts based on the embodiments of the present invention shall fall within the scope of protection of the present invention.

[0028] Example 1: Gene engineering bacteria of wild-type tagatose-4-epimerase E. coli Construction of BL21(DE3) / DTE After codon optimization of the gene sequence of tagatose-4-epimerase derived from Thermotoga petrophila in the gene bank, the pET28a(+)-DTE plasmid was obtained by total gene synthesis. This plasmid was transformed into E. coli BL21(DE3) to obtain wild-type E. coli BL21(DE3) / DTE, denoted as DTE.

[0029] Example 2: Site-directed mutagenesis to construct E. coli BL21(DE3) / DTE-muts By site-directed mutagenesis technology, site-directed mutations were introduced into tagatose-4-epimerase DTE. The primers were designed as follows: R69A: Upstream primer 1: 5’-CTTTTTCTTTTGCGAGgcgAACCATGAAAATC-3’ Downstream primer 2: 5’- CTCGCAAAAGAAAAAGCTCACGCCTTCC-3’ N70A: Upstream primer 1: 5’-CTTTTTCTTTTGCGAGCGCgcgCATGAAAATC-3’ Downstream primer 2: 5’- CTCGCAAAAGAAAAAGCTCACGCCTTCC-3 E75A: Forward primer 1: CCATGAAAATCTGgcgGTGCTGCGCAAATAT Reverse primer 2: 5’- CAGATTTTCATGGTTGCGCTCGCAAAAG-3’ P140L: Forward primer 3: 5’- TACCTGGCGCGATGTTctgGATGATGCGAC-3’ Reverse primer 4: 5’- AACATCGCGCCAGGTACGACCAGTACGTTC-3’ R165A: Forward primer 5: 5’- GCGGATCATGTGAAAgcgCCGGAAGATTTGG-3’ Reverse primer 6: 5’-TTTCACATGATCCGCATCCGCGCCAAAGC-3’ F361H: Forward primer 7: 5’- GTGCGACTGGTGGTCTGcatCTGGTGAAAAC-3’ Reverse primer 8: 5’- CAGACCACCAGTCGCACTCGCAAACGC -3’ The site-directed mutagenesis primers are as described above, and the mutated sites are marked with lowercase letters. Similarly, using plasmid DNA containing the DTE gene as a template, mutations were introduced by PCR. The PCR reaction procedure was as follows: 95°C for 5 min; 95°C for 30 s, 55°C for 10 s, 72°C for 3 min 30 s, repeated for 35 cycles; continued extension at 72°C for 10 min. The PCR products were treated with DpnI at 37°C for 3 h and inactivated at 80°C for 10 min, and then transformed into the E. coli BL21(DE3) recipient bacteria, and spread on an LB solid plate containing a final concentration of 50 mg / L kanamycin resistance. After culturing at 37°C for 12 h, single colonies were randomly selected for sequencing analysis to obtain the DTE mutants DTE-R69A, DTE-N70A, DTE-E75A, DTE-P140L, DTE-R165A, DTE-F361H, DTE-E75A / F361H.

[0030] Example 3: Preparation of recombinant tagatose-4-epimerase mutant wet cells The recombinant Escherichia coli E. coli BL21(DE3) / DTE-muts containing the recombinant gene expressing the mutant tagatose-4-epimerase gene obtained in Example 2 was inoculated into LB liquid medium containing kanamycin resistance at a final concentration of 50 μg / mL, cultured at 37 °C and 180 rpm for 10 h, and then inoculated into fresh LB liquid medium containing kanamycin resistance at a final concentration of 50 μg / mL at an inoculation amount of 2% (v / v). The culture was carried out at 37 °C and 180 rpm until the OD600 of the cells reached 0.6 - 0.8. IPTG with a final concentration of 0.1 mM was added, and after induction culture at 28 °C for 12 h, centrifugation was carried out at 4 °C and 8000 rpm for 15 min. The supernatant was discarded, and the precipitate was collected to obtain the wet cells of the recombinant tagatose-4-epimerase mutant. The wet cells can be directly used as a biocatalyst or for protein purification.

[0031] Example 4: Isolation and purification of tagatose-4-epimerase mutant Preparation of the pure enzyme solution of the mutant type tagatose-4-epimerase of the present invention: The wet cells of the recombinant genetic engineering bacteria containing the tagatose-4-epimerase mutant coding gene were resuspended in 9.8 mL of 100 mM sodium phosphate buffer solution with pH 8.0 according to 0.2 g of wet cells, and ultrasonic disruption was carried out under ice bath conditions (power of 200 W, continuous for 1 s, intermittent for 2 s, continuously disrupted for 15 min) to obtain a cell disruption solution. The cell disruption solution obtained after ultrasonic disruption was centrifuged at 8000 rpm and 4 °C for 10 min, and the supernatant obtained was the required crude enzyme solution. The crude enzyme solution can be further purified to obtain a pure enzyme solution. The SDS-PAGE diagram of tagatose-4-epimerase is as Figure 1 shown. Among them, Figure 1 Lane 1 from the left is the protein molecular weight Marker, lane 2 is the crude enzyme of tagatose-4-epimerase, and lane 3 is the pure enzyme of the tagatose-4-epimerase mutant.

[0032] Example 5: Catalytic activity determination of tagatose-4-epimerase mutant The crude enzyme of wild-type tagatose-4-epimerase and the crude enzymes of recombinant tagatose-4-epimerase mutants DTE-R69A, DTE-N70A, DTE-E75A, DTE-P140L, DTE-R165A, DTE-F361H, DTE-E75A / F361H separated and purified by the method in Example 4 were respectively used to catalyze the substrate (D-fructose).

[0033] The composition and catalytic conditions of the enzyme catalytic system are as follows: The wet cells were resuspended and diluted with phosphate buffer (100 mM, pH 8.0), and D-fructose with a final concentration of 50 g / L and Ni with a final concentration of 1 mM were added 2+, A 1 mL reaction system was constituted with phosphate buffer (50 mM, pH 8.0). After reacting at 75 °C and 1000 rpm for 30 min, the reaction was terminated by boiling in water for 10 min. After centrifuging at 13000 rpm for 10 min, the supernatant was taken, diluted by an appropriate multiple and then filtered through a membrane, and the conversion rate was detected by high performance liquid chromatography (HPLC). The schematic diagram of the enzymatic synthesis pathway of D-tagatose is as Figure 2 shown.

[0034] The HPLC detection method is as follows: It was detected by a Thermo high performance liquid chromatography (HPLC) system (Milford, USA) and a differential detector. The analytical chromatographic column was Sugar-park (300×6.5 mm). The mobile phase was 0.5 mg / mL calcium disodium EDTA, and the solvent was ultrapure water. The column temperature was set at 80 °C, the flow rate was maintained at 0.4 mL / min, and the injection volume was 10 μL. The external standard method was adopted, and the conversion rate of D-fructose and the yield of D-tagatose were determined according to the retention time and peak area of the peaks. The schematic diagram of the HPLC detection of the substrate D-fructose and the product D-tagatose is as Figure 3 shown. The bar graph of the relative enzyme activities of wild-type tagatose-4-epimerase and tagatose-4-epimerase mutants is as Figure 4 shown.

[0035] The relative activity results of wild-type DTE and tagatose-4-epimerase mutants are shown in Table 1 below: Table 1: Relative activity results of wild-type DTE and tagatose-4-epimerase mutants Tagatose-4-epimerase mutant Relative activity (%) WT 100 R69A 98 N70A 65 E75A 120 P140L 123 R165A 120.3 F361H 120.6 E75A / F361H 126 Example 6: Application of recombinant tagatose-4-epimerase wild-type DTE in the preparation of D-tagatose Using the recombinant Escherichia coli BL21(DE3) / DTE wet cells containing the expression recombinant plasmid obtained in Example 4 as a biocatalyst and D-fructose as a substrate, a catalytic reaction was carried out to prepare D-tagatose. Example 7 was taken as a control.

[0036] The composition and catalytic conditions of the enzyme catalytic system are as follows: The crude enzyme was diluted with phosphate buffer (100 mM, pH 8.0), D-fructose with a final concentration of 50 g / L and Ni with a final concentration of 1 mM were added 2+ , A 1 mL reaction system was constituted with phosphate buffer (50 mM, pH 8.0). After reacting at 75 °C and 1000 rpm for 30 min, the reaction was terminated by boiling in water for 10 min. After centrifuging at 13000 rpm for 10 min, the supernatant was taken, diluted by an appropriate multiple and then filtered through a membrane, and detected by high performance liquid chromatography (HPLC).

[0037] Example 7: Application of Recombinant Tagatose-4-Epimerase Mutant E75A / F361H in the Preparation of D-Tagatose Using the crude enzyme solution of recombinant Escherichia coli BL21(DE3) / DTEE75A / F361H containing the expression recombinant plasmid obtained in Example 4 as a biocatalyst, and D-fructose as a substrate, enzymatic synthesis of D-tagatose was carried out.

[0038] The catalytic reaction system and catalytic conditions are as follows: the final concentration of tagatose-4-epimerase is 40 g / L, the final concentration of D-fructose is 50 g / L, and Ni with a final concentration of 1 mM is added 2+ , using sodium phosphate buffer solution (pH 8.0) as the reaction medium to form a 1 mL conversion system, at 75 °C, 1000 rpm, and analyzed by HPLC. The catalytic results show that its relative enzyme activity is 1.26 times higher than that of the original strain.

[0039] The above is only a detailed description of the preferred embodiments and principles of the present invention. For those of ordinary skill in the art, according to the idea provided by the present invention, there will be changes in the specific implementation manners, and these changes should also be regarded as the protection scope of the present invention.

Claims

1. A tagatose-4-epimerase mutant, characterized in that: The amino acid sequence is derived from SEQ ID NO.1 by site-directed mutagenesis, wherein the mutation sites are: (1) proline at position 140 is mutated to leucine.

2. A gene encoding the tagatose-4-epimerase mutant according to claim 1.

3. A recombinant vector constructed from the encoding gene according to claim 2.

4. A recombinant genetically engineered bacterium transformed by the recombinant vector according to claim 3.

5. Use of the tagatose-4-epimerase mutant according to claim 1 in the preparation of D-tagatose.

6. The use according to claim 5, characterized in that: The application is: using wet bacteria obtained by fermentation culture of recombinant genetically engineered bacteria containing a gene encoding a mutant of tagatose-4-epimerase, or crude enzyme extracted from wet bacteria after ultrasonic crushing, or purified pure enzyme as a catalyst, using D-fructose as a substrate, and reacting with Ni 2+ In the presence of , the reaction is carried out at 70-80°C in a sodium phosphate buffer solution with a pH value of 7-9. After the reaction is complete, the reaction solution is separated and purified to obtain D-tagatose.

Images