A virus-like particle expressing mIL21 and 4-1BBL and its application in in vitro expansion of NK cells

By stimulating NK cells with virus-like particles (B21-VLP) expressing mIL21 and 4-1BBL, the problem of NK cell expansion is solved, efficient expansion and strong tumor killing ability are achieved, the risk of tumorigenesis is avoided, and it has broad application prospects.

CN120209100BActive Publication Date: 2025-09-05HEBEI JINYAO BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510382002.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-28
Publication Date
2025-09-05
Estimated Expiration
2045-03-28

AI Technical Summary

Technical Problem

Existing CAR-T cell therapies have problems such as complex production, high cost, and severe side effects. NK cells have natural advantages in tumor treatment, but their proportion in peripheral blood is low and they need to be expanded in large quantities for adoptive immunotherapy.

Method used

Virus-like particles (B21-VLP) expressing mIL21 and 4-1BBL were used to stimulate NK cells, and NK cells were modified through genetic engineering to achieve their efficient expansion and avoid the tumorigenic risk of K562 cells.

Benefits of technology

Efficient expansion of NK cells was achieved. On the 21st day of culture, NK cells accounted for more than 90% of the total cells. They have strong tumor-killing ability and broad application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120209100B_ABST
    Figure CN120209100B_ABST
Patent Text Reader

Abstract

The present invention discloses a virus-like particle expressing mIL21 and 4-1BBL and its application in in vitro expansion of NK cells. The present invention creatively constructs a new virus-like particle expressing mIL21 and 4-1BBL for the first time, achieves efficient expansion of NK cells and avoids the tumorigenic risk of K562 cells, and has broad application prospects in the technical field of in vitro expansion of NK cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular, relates to a virus-like particle expressing mIL21 and 4-1BBL and an application thereof in amplifying NK cells in vitro. Background Art

[0002] Genetically modifying immune cells through chimeric antigen receptors (CARs) to target and kill tumor cells is an effective cancer treatment. Currently, T-cell-based CAR-T cell therapy is in clinical use. Although CAR-T cells have significant anti-tumor activity, they still have certain clinical limitations. Allogeneic CAR-T cells can cause severe graft-versus-host disease (GVHD). Therefore, most CAR-T cells are currently produced based on autologous cells, which has a complex production process, long lead times, and high costs. In addition, some patients experience severe side effects after CAR-T treatment, such as cytokine release syndrome (CRS) and neurotoxicity.

[0003] Natural killer cells (NK cells), also immune cells, have a natural advantage in tumor treatment. NK cells have non-specific target recognition and killing mechanisms, and can kill tumor cells in a non-MHC-restricted manner without the need for antigen pre-sensitization. They have strong immune surveillance and killing functions, and possess multiple cytotoxic mechanisms. They can regulate immune responses by producing cytokines, playing a key role in both innate and adaptive immune responses. NK cells also have a killing function against almost all common tumor cells, including lung cancer, liver cancer, breast cancer, and lymphoma, and have a broad-spectrum anti-tumor effect.

[0004] NK cell-based CAR-NK cell therapy involves genetically modifying NK cells obtained from various sources to express chimeric antigen receptors (CARs), enhancing their biological function. These cells are then infused into the patient to specifically kill tumor cells. Currently, universal CAR-NK cells derived from umbilical cord blood have demonstrated efficacy in treating lymphomas. They have also been shown to be immune to severe graft-versus-host reactions, have a low risk of cytokine storms, are easily scalable, and are readily available for immediate use. Therefore, CAR-NK has great potential to be developed into a universal cell therapy product.

[0005] The application range of universal CAR-NK is 1×10 per kilogram of patient body weight. 6 -8×10 7 The number of CD3-CD56+ NK cells in the peripheral blood and umbilical cord blood is only about 5-15%, and only about 15%-30% in the umbilical cord blood. Therefore, it is necessary to expand NK cells in large quantities before using them for adoptive immunotherapy. Summary of the Invention

[0006] In view of this, the object of the present invention is to provide a virus-like particle expressing mIL21 and 4-1BBL and its use in in vitro expansion of NK cells in the art.

[0007] Virus-like particles (VLPs) are highly structured protein particles self-assembled from single or multiple viral structural proteins, similar in morphology and structure to native viral particles. VLPs lack regulatory proteins and infectious nucleic acids, are incapable of replication, and offer advantages such as high safety. The present invention aims to use VLPs to express mIL-21 and 4-1BBL, thereby expanding NK cells and mitigating the tumorigenic risk of K562 cells.

[0008] The present invention adopts the following technical solutions to achieve the above-mentioned invention objectives:

[0009] The first aspect of the present invention provides a virus-like particle B21-VLP expressing mIL21 and 4-1BBL.

[0010] Furthermore, the B21-VLP is composed of the following operably linked elements connected in sequence: mIL21, T2A, 4-1BBL, T2A, VSV-G;

[0011] The amino acid sequence of the mIL21 is shown in SEQ ID NO. 16, and the amino acid sequence of the 4-1BBL is shown in SEQ ID NO. 17.

[0012] Furthermore, the amino acid sequence of the VSV-G is shown in SEQ ID NO.18;

[0013] Optionally, the base sequence of mIL21 is shown as SEQ ID NO.20, and the base sequence of 4-1BBL is shown as SEQ ID NO.21;

[0014] Optionally, the base sequence of the VSV-G is shown in SEQ ID NO.22.

[0015] In the present invention, mIL21 is the same as mbIL21. mbIL21 is derived from mouse IL21 through molecular engineering. It typically contains the functional domains of IL21, which are crucial for receptor binding and biological activity. It exhibits immunomodulatory, anti-tumor, and antiviral effects. In a specific embodiment of the present invention, the amino acid sequence of mIL21 is shown in SEQ ID NO. 16.

[0016] In the present invention, the 4-1BBL refers to the 4-1BB ligand, also known as CD137L, which is a member of the tumor necrosis factor superfamily and plays an important role in the immune system. 4-1BBL is a type II transmembrane protein composed of 306 amino acids. Its extracellular region contains 171 amino acids and can be hydrolyzed by proteases to form soluble 4-1BBL. It has typical tumor necrosis factor superfamily structural characteristics, including a β-pleated sheet structure and multiple α-helices, which are crucial for its binding to receptors and signal transduction. In a specific embodiment of the present invention, the amino acid sequence of the 4-1BBL is shown in SEQ ID NO.17.

[0017] In the present invention, the T2A is a 2A peptide sequence from foot-and-mouth disease virus (FMDV). The 2A peptide is a short peptide that enables the viral polyprotein to undergo post-translational self-cleavage during viral infection, producing multiple independent functional proteins. The T2A peptide is typically composed of approximately 20 amino acids and has a specific amino acid sequence and spatial structure. T2A can be connected to different types of genes, whether encoding structural proteins or regulatory proteins, to effectively achieve co-expression. In a specific embodiment of the present invention, the amino acid sequence of the T2A is shown in SEQ ID NO.19.

[0018] In the present invention, the VSV-G refers to Vesicular Stomatitis Virus Glycoprotein, which is a transmembrane glycoprotein composed of 511 amino acids and has a molecular weight of approximately 67 kDa. In a specific embodiment of the present invention, the amino acid sequence of the VSV-G is shown in SEQ ID NO.18.

[0019] The second aspect of the present invention provides a method for constructing virus-like particles B21-VLP expressing mIL21 and 4-1BBL.

[0020] Furthermore, the construction method comprises the following steps:

[0021] (1) Construction of B21-VSVG envelope plasmid:

[0022] (2) Use B21-VSVG envelope plasmid to transfect host cells to construct B21-VLP.

[0023] Furthermore, the construction of the B21-VSVG envelope plasmid comprises the following steps:

[0024] (1) mIL21 and 4-1BBL fragments were obtained by gene synthesis, as fragment 1, the amino acid sequence of mIL21 is shown in SEQ ID NO. 16, and the amino acid sequence of 4-1BBL is shown in SEQ ID NO. 17;

[0025] (2) Using pMD2.G as the plasmid backbone, fragment 2 was obtained by digestion with EcoRI restriction endonuclease;

[0026] (3) Using pMD2.G as a plasmid template, PCR was performed to obtain fragment 3. Primer VSVG-F1 was designed, and the amino-terminal sequence from the 5' end to the 3' end was as shown in SEQ ID NO. 1. Homologous recombination was used to design a homology arm to be added to the 5' end, and the amino-terminal sequence was as shown in SEQ ID NO. 2. Primer VSVG-R1 was designed at the 3' end, and the amino-terminal sequence from the 5' end to the 3' end was as shown in SEQ ID NO. 3.

[0027] (4) The obtained fragments 1, 2, and 3 are connected using homologous recombinase to obtain a complete plasmid, namely the B21-VSVG envelope plasmid.

[0028] Furthermore, the use of B21-VSVG envelope plasmid to transfect host cells to construct B21-VLP includes the following steps:

[0029] (1) Mix the envelope plasmid B21-VSVG and the helper plasmids pMDLg and pRSV to form solution A, and mix PEI with culture medium to form solution B. Mix solutions A and B to obtain a mixed solution AB, add the mixed solution AB to the host cell culture medium, and culture the host cells;

[0030] (2) Perform fluid exchange after 3-5 hours;

[0031] (3) Feed after 20-22 hours;

[0032] (4) Harvest 48 hours after packaging to obtain B21-VLP.

[0033] In some embodiments, the host cells are cultured in a 37° C. 5% CO 2 incubator with shaking at 125 rpm.

[0034] Furthermore, the amounts of the envelope plasmid and helper plasmid were: B21-VSVG (1-10) μg, pMDLg (5-50) μg, pRSV (1-10) μg;

[0035] Optionally, the amounts of the envelope plasmid and helper plasmid are: B21-VSVG 5 μg, pMDLg 20 μg, pRSV 5 μg;

[0036] Optionally, the host cell is a 293T cell, a 293 cell, a HEK293F cell, a CHO cell, a Vero cell or a HeLa cell;

[0037] Optionally, the host cell is a 293T cell;

[0038] Optionally, the culture medium is Transient transfection medium, EmCD HEK293 Plus medium, CELL-WISE 293 medium CW001, complete medium M293TI, glutamine-free medium M293TIS, glutamine-free and phenol red-free medium M293TINPR, or union293 medium;

[0039] Optionally, the culture medium is Transient culture medium;

[0040] Optionally, when preparing the solution A, the amount of the culture medium is 0.5-5 mL;

[0041] Optionally, when preparing the solution A, the amount of the culture medium used is 1 mL;

[0042] Optionally, when preparing the solution B, the amounts of PEI and culture medium are 25-125 μL and 0.5-5 mL, respectively;

[0043] Optionally, when preparing the solution B, the amounts of PEI and culture medium are 75 μL and 1 mL, respectively;

[0044] Optionally, the feed includes supplementing glucose and glutamine.

[0045] In some embodiments, the fluid replacement operation comprises the following steps: centrifuging the host cells at 1000 rpm for 5 min, and then using 20 mL Resuspend the cells in transient culture medium, transfer to a 125 mL cell culture shake flask, and place in a 37°C 5% CO2 incubator with shaking at 125 rpm.

[0046] In some embodiments, the feeding comprises the following steps: adding 80 μL of 50% glucose injection and 800 μL of L-glutamine to a 125 mL cell culture shake flask, slowly shaking to mix, and placing in a 37° C. 5% CO 2 incubator with shaking at 125 rpm.

[0047] In some embodiments, the harvesting comprises the following steps: transferring the host cell suspension into a centrifuge tube, centrifuging at 2000 rpm for 10 min, taking the supernatant as the virus harvest solution, filtering the virus harvest solution using a 0.45 μm filter membrane, transferring the virus harvest solution into a centrifuge tube, centrifuging at 4°C, increasing the pressure to 9 and decreasing the pressure to 0, centrifuging at 18300 g for 2 h, and resuspending the virus precipitate in DPBS containing 2% HSA to obtain a B21-VLP virus concentrate.

[0048] The third aspect of the present invention provides a composition comprising the B21-VLP according to the first aspect of the present invention.

[0049] A fourth aspect of the present invention provides a culture for expanding NK cells.

[0050] Furthermore, the culture contains the B21-VLP described in the first aspect of the present invention or the composition described in the third aspect of the present invention.

[0051] The fourth aspect of the present invention provides a method for expanding NK cells in vitro, culturing or stimulating NK cells in vitro.

[0052] Furthermore, the method comprises: contacting NK cells with the B21-VLP of the first aspect of the present invention, the composition of the third aspect of the present invention, or the culture of the fourth aspect of the present invention;

[0053] Optionally, the NK cells are present in a cord blood mononuclear cell population.

[0054] In some embodiments, cord blood is rich in hematopoietic stem cells and various immune cells, including NK cells. NK cells in cord blood have unique characteristics and advantages, such as low immunogenicity, strong proliferation capacity, anti-tumor activity, and immunomodulatory effects.

[0055] A fifth aspect of the present invention provides any of the following applications:

[0056] (1) Use of the B21-VLP described in the first aspect of the present invention, the composition described in the third aspect of the present invention, or the culture described in the fourth aspect of the present invention in in vitro expansion of NK cells, in vitro culture, or stimulation of NK cells;

[0057] (2) Use of NK cells cultured with the B21-VLP described in the first aspect of the present invention, the composition described in the third aspect of the present invention, or the culture described in the fourth aspect of the present invention in the preparation of anti-tumor drugs.

[0058] In some embodiments, the present invention has no particular limitation on the specific source of the NK cells, and the source of the NK cells includes but is not limited to: NK cells derived from bone marrow, NK cells derived from peripheral blood, NK cells derived from peripheral lymphoid tissue, NK cells derived from thymus, and NK cells derived from non-lymphoid tissues such as liver, lung, and intestine.

[0059] In some embodiments, the tumor includes, but is not limited to, hematologic malignancies and solid tumors. Hematologic malignancies include, but are not limited to, acute myeloid leukemia, non-Hodgkin's lymphoma, acute lymphocytic leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, Hodgkin's lymphoma, and multiple myeloma. Solid tumors include, but are not limited to, melanoma, renal cell carcinoma, non-small cell lung cancer, small cell lung cancer, glioma, meningioma, nasopharyngeal carcinoma, oral cancer, breast cancer, esophageal cancer, mediastinal tumor, gastric cancer, liver cancer, colorectal cancer, pancreatic cancer, bladder cancer, prostate cancer, ovarian cancer, cervical cancer, osteosarcoma, Ewing's sarcoma, soft tissue sarcoma, skin cancer, and thyroid cancer.

[0060] Compared with the prior art, the present invention has the following beneficial effects:

[0061] The present invention creatively constructs for the first time a new virus-like particle (B21-VLP) expressing mIL21 and 4-1BBL, achieving efficient expansion of NK cells and avoiding the tumorigenic risk of K562 cells. In addition, the B21-VLP can selectively expand NK cells when stimulating CBMCs. On the 21st day of culture, NK cells account for more than 90% of the total cell content. NK cells cultured using the B21-VLP have a strong killing ability against tumor cells, and have broad application prospects in the technical field of in vitro expansion of NK cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 : B21-VSVG envelope plasmid map;

[0063] Figure 2 : Schematic diagram of the principle of B21-VLP expansion of NK cells in vitro;

[0064] Figure 3 : Schematic diagram of the structures of B21-VLP, B-VLP, 21-VLP, and no VSV-B21-VLP;

[0065] Figure 4 : Result graph showing the effect of the presence or absence of VSV-G structure on the physical titer of VLPs;

[0066] Figure 5 : Comparison of the cell proliferation effects of VLPs with and without VSV-G structure;

[0067] Figure 6 : The corresponding result graph shows that the proportion of NK cells in cultured CBMC cells increases with the increase of B21-VLP concentration;

[0068] Figure 7 : The corresponding result graph shows that 500ng of B21-VLP has a good expansion effect on NK cells in CBMC;

[0069] Figure 8 : Comparison of the stimulation effects of 500 ng of B21-VLP, B-VLP, and 21-VLP on CBMCs;

[0070] Figure 9 : Comparison of the effects of B21-VLP and K562-41BBL-mbIL21 on the expansion ability of NK cells;

[0071] Figure 10 : Comparison of the proportion of NK cells in the total cells between the B21-VLP group and the K562-41BBL-mbIL21 group;

[0072] Figure 11 : Comparison of the effects of B21-VLP and K562-41BBL-mbIL21 on CBMC stimulation;

[0073] Figure 12 : The corresponding result graph shows that the B21-VLP constructed by the present invention can selectively expand NK cells when stimulating CBMC;

[0074] Figure 13 : B21-VLP-cultured NK cells were used as effector cells, and K562 tumor cells were used as target cells. They were co-cultured at effector-target ratios of 10:1, 3:1, and 1:1, respectively. After 24 hours, the corresponding ratios of effector cells and target cells were detected by flow cytometry. DETAILED DESCRIPTION

[0075] The present invention will be further described below with reference to specific embodiments. The specific embodiments are intended only to explain the present invention and are not to be construed as limiting the present invention. Those skilled in the art will appreciate that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and intent of the present invention. The scope of the present invention is defined by the claims and their equivalents.

[0076] The reagents and raw materials used in the present invention are readily available to those of ordinary skill in the art and, unless otherwise specified, can be obtained commercially. Experimental methods not specifying specific conditions in the present invention are generally performed under conventional conditions or conditions recommended by the manufacturer. In particular, the following examples are intended only to illustrate the present invention and should not limit the scope of the present invention in any way. It should be noted that the experimental conditions and results described in the following examples are intended only to illustrate the present invention and should not, and will not, limit the present invention described in detail in the claims.

[0077] Example 1 Construction of B21-VSVG Envelope Plasmid

[0078] 1. Experimental Materials

[0079] The primers were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.;

[0080] PCR MIX enzyme: Jinsha Biotechnology, product number SF212;

[0081] AgeⅠ restriction endonuclease: Biolabs, product number R3552SVIAL;

[0082] XholⅠ restriction endonuclease: Biolabs, product number R0146VVIAL;

[0083] EcoRI restriction endonuclease: Biolabs, catalog number R0101VVIAL;

[0084] Homologous recombination enzyme: Jinsha Biotechnology, product number SC612;

[0085] Agarose gel DNA recovery kit: Tiangen Biochemical Technology, catalog number DP209-02;

[0086] Small-scale DNA extraction kit: Jinsha Biotechnology, product number PE707-50.

[0087] 2. Experimental methods

[0088] (1) Construction of B21-VSVG envelope plasmid

[0089] 1) Obtain mbIL21 and 4-1BBL (CD137L) fragments by gene synthesis as fragment 1;

[0090] 2) Using pMD2.G as the plasmid backbone, digest with EcoRI restriction endonuclease to obtain fragment 2;

[0091] 3) Using pMD2.G as a plasmid template, fragment 3 was obtained by PCR. Primer VSVG-F1 was designed with the 5' to 3' base sequence: GAATTCTGACACTATGAAGTGCCTTT (SEQ ID NO. 1). A homology arm was designed and added to the 5' end using homologous recombination, with the base sequence: GAGAACCCCGGCCCC (SEQ ID NO. 2). A 3' primer, VSVG-R1, was designed with the 5' to 3' base sequence: TGTGCAGGATTTGAGTTACTTTCCAAGT (SEQ ID NO. 3).

[0092] 4) The resulting fragments 1, 2, and 3 were ligated using homologous recombinase to obtain a complete plasmid named B21-VSVG. The B21-VLP is composed of the following operably linked elements connected in sequence: mbIL21, T2A, 4-1BBL, T2A, and VSV-G; wherein the amino acid sequences of mbIL21, 4-1BBL, VSV-G, and T2A are shown in SEQ ID NOs. 16-19, respectively, and the base sequences of mbIL21, 4-1BBL, VSV-G, and T2A are shown in SEQ ID NOs. 20-23, respectively.

[0093] 5) Use E. coli competent cells to transform the plasmid, plate the cells overnight, and then sequence to verify the correctness of the plasmid;

[0094] 6) Expand the culture of the verified correct plasmid colony and extract the plasmid DNA using a DNA extraction kit.

[0095] (2) Construction of IL21-VSVG envelope plasmid

[0096] 1) Using the B21-VSVG plasmid as the plasmid backbone, fragment 1 was obtained by digestion with AgeⅠ and XholⅠ restriction endonucleases;

[0097] 2) Using the B21-VSVG plasmid as a template, PCR was performed to obtain fragment 2. A 5' primer, IL21-VSVG-F1, was designed; the base sequence from the 5' end to the 3' end was TCAGCATCTGTCCTCGAGAACAC (SEQ ID NO. 4). A 3' primer was designed; the base sequence from the 5' end to the 3' end was TGGTCCTGGATTTTCCTCCACG (SEQ ID NO. 5). A homology arm was designed using homologous recombination and added to the 5' primer; the base sequence from the 5' end to the 3' end was GTACAGCAGGCACT (SEQ ID NO. 6).

[0098] 3) Using the B21-VSVG plasmid as a template, PCR was performed to obtain fragment 3. A 5' primer, IL21-VSVG-F2, was designed. The base sequence from the 5' end to the 3' end was CCAAGTGCCTGCTGTACCTGG (SEQ ID NO. 7). A homology arm was designed and added to the 5' end using homologous recombination. The base sequence was GGAAAATCCAGGA (SEQ ID NO. 8). A 3' primer, IL21-VSVG-R2, was designed. The base sequence from the 5' end to the 3' end was TTTATGGTGAAAGCAGGACCGGT (SEQ ID NO. 9).

[0099] 4) Run fragments 1, 2, and 3 on agarose gel electrophoresis, and use an agarose gel DNA recovery kit to extract the corresponding plasmid fragment bands and quantify them;

[0100] 5) The obtained fragments 1, 2, and 3 were connected using homologous recombinase to obtain a complete plasmid, which was named IL21-VSVG;

[0101] 6) Use E. coli competent cells to transform the plasmid, plate the cells overnight, and then sequence to verify the correctness of the plasmid;

[0102] 7) Expand the culture of the verified correct plasmid colony and extract plasmid DNA using a DNA extraction kit.

[0103] (3) Construction of B-VSVG envelope plasmid

[0104] 1) Using the B21-VSVG plasmid as the plasmid backbone, fragment 1 was obtained by digesting with EcoRI restriction endonuclease;

[0105] 2) Using the B21-VSVG plasmid as a plasmid template, PCR was performed to obtain fragment 2. A 5' primer, B-VSVG-F1, was designed. The base sequence from the 5' to 3' end was GAATACGCCTCTGACGCTTCAC (SEQ ID NO. 10). A homology arm was designed and added to the 5' end using homologous recombination. The base sequence was AAGCACGTGAGATCTGCCACCATG (SEQ ID NO. 11). A 3' primer, B-VSVG-R1, was designed. The base sequence was CTGCACTGGTGGGGTGAATTC (SEQ ID NO. 12).

[0106] 3) Run fragments 1 and 2 on agarose gel electrophoresis, extract the corresponding plasmid fragment bands using an agarose gel DNA recovery kit, and quantify them;

[0107] 4) The obtained fragments 1 and 2 were connected using homologous recombinase to obtain a complete plasmid, which was named B-VSVG;

[0108] 5) Use E. coli competent cells to transform the plasmid, plate the cells overnight, and then sequence to verify the correctness of the plasmid;

[0109] 6) Expand the culture of the verified correct plasmid colony and extract plasmid DNA using a small amount DNA extraction kit.

[0110] (4) Construction of B21-noVSVG envelope plasmid

[0111] 1) Using the B21-VSVG plasmid as the plasmid backbone, fragment 1 was obtained by digesting with EcoRI restriction endonuclease;

[0112] 2) Using the B21-VSVG plasmid as a plasmid template, PCR was performed to obtain fragment 2. A 5' primer, B21-F1, was designed. The base sequence from the 5' end to the 3' end was AAGCACGTGAGATCTGAATTCG (SEQ ID NO. 13). A 3' primer, TTCCGACCTCGGTGAAGGGA (SEQ ID NO. 14), was designed. Using homologous recombination, a homology arm was designed and added to the 5' end. The base sequence was CTGCACTGGTGGGGTTCTAGA (SEQ ID NO. 15).

[0113] Fragments 1 and 2 were electrophoresed on agarose gel, and the corresponding plasmid fragment bands were extracted and quantified using an agarose gel DNA recovery kit;

[0114] 3) The obtained fragments 1 and 2 were connected using homologous recombinase to obtain a complete plasmid, which was named B21-noVSVG;

[0115] 4) Transform the plasmid into competent E. coli cells, grow the cells overnight, and verify the correctness of the plasmid by sequencing;

[0116] 5) Expand the culture of the verified correct plasmid colony and extract plasmid DNA using a small amount DNA extraction kit.

[0117] 3. Experimental results

[0118] The constructed B21-VSVG envelope plasmid map is as follows Figure 1 The principle diagram of B21-VLP amplifying NK cells in vitro is shown in Figure 2 The structural diagrams of B21-VLP, B-VLP, 21-VLP and no VSV-B21-VLP are shown in Figure 3 shown.

[0119] Example 2 Construction of virus-like particles B21-VLP expressing mIL21 and 4-1BBL

[0120] 1. Experimental Materials

[0121] Transient culture medium: Kangsheng Bio, product number A21501;

[0122] KBM 581 culture medium: Corning, catalog number 88-591-CM;

[0123] PEI: Polyplus, product number 101000026;

[0124] 50% glucose injection: Henan Kelun Pharmaceutical;

[0125] L-glutamine: Solarbio, product number G0200;

[0126] Human serum albumin (HSA): Pacific Biopharmaceuticals;

[0127] Dulbecco's phosphate buffered saline (DPBS): Gibco, product number 14190250;

[0128] Recombinant human interleukin-2 (IL2) for injection: Shuanglu Pharmaceutical;

[0129] P24 ELISA test kit: Yisheng Bio, catalog number 99301ES24;

[0130] FITC Anti-Human CD3: Cosmos Biotechnology, catalog number 6610004;

[0131] PE anti-human CD56: Cosmos Biotechnology, catalog number A6803;

[0132] PE / Cyanine7 Anti-Human CD4 Antibody: Elabscience, Cat. No. E-AB-F1109H;

[0133] PerCP Anti-Human CD8 Antibody: Elabscience, catalog number AN00427F.

[0134] 2. Experimental methods

[0135] (1) Expression process of 293T cells transfected with the constructed envelope plasmid

[0136] 1) Two VLPs were prepared using B21-VSVG and B21-noVSVG envelope plasmids. First, 293T cells were inoculated and 5×10 6 cells, use 20 mL of Resuspend the transient culture medium in a 125mL cell culture shake flask, place it in a 37℃ 5% CO2 incubator, and shake and culture at 125rpm. Mix the two envelope plasmids (5μg) with the auxiliary plasmid (pMDLg 20μg, pRSV 5μg) as liquid A, and take 75μL of PEI and mix it with 1mL culture medium as liquid B. Gently mix liquid A and liquid B to avoid bubbles. After mixing, let it stand at room temperature for 5min. Add liquid B to liquid A, mix gently, and let it stand at room temperature for 20min. Slowly add the AB mixture to the cell culture shake flask, and shake it slowly to mix. Place the cell culture shake flask in a 37℃ 5% CO2 incubator and shake and culture at 125rpm.

[0137] 2) After 3-5 hours, perform the medium change operation. Centrifuge the cells at 1000 rpm for 5 minutes and use 20 mL Resuspend the cells in transient culture medium, transfer to a 125 mL cell culture shake flask, and place in a 37°C 5% CO2 incubator with shaking at 125 rpm.

[0138] 3) Feed after 20-22 hours. Add 80 μL of 50% glucose injection and 800 μL of L-glutamine to each 125 mL cell culture shake flask, gently shaking to mix. Place in a 37°C, 5% CO2 incubator with shaking at 125 rpm.

[0139] 4) Harvest 48 hours after packaging. Transfer the cell suspension to a centrifuge tube and centrifuge at 2000 rpm for 10 minutes. Remove the supernatant as the viral harvest solution and filter the viral harvest solution through a 0.45 μm filter. Transfer the viral harvest solution to a centrifuge tube and centrifuge at 18,300 g for 2 hours at 4°C. Resuspend the viral pellet in DPBS containing 2% HSA to obtain B21-VLP, B-VLP, 21-VLP, and B21-noVSVG-VLP viral concentrates, respectively.

[0140] 5) After sampling, measure the physical titer using P24 ELISA. Store the remaining aliquots at -80°C until use.

[0141] 6) Comparison of the physical titers of B21-VSVG and B21-noVSVG.

[0142] (2) Isolation and stimulation of umbilical cord blood mononuclear cells

[0143] 1) Isolation of mononuclear cells

[0144] 200 mL of umbilical cord blood was divided into centrifuge tubes and centrifuged at 2000 rpm and room temperature for 20 minutes. After removing the upper light yellow plasma, an equal volume of physiological saline was added to the upper light yellow plasma to obtain diluted umbilical cord blood. Another centrifuge tube was taken, lymphocyte separation fluid was added, and the diluted umbilical cord blood was added to the lymphocyte separation fluid to separate the diluted blood and lymphocyte separation fluid. The tubes were then centrifuged at 2000 rpm and room temperature for 30 minutes. After removing part of the supernatant, the middle buffy coat layer was aspirated into a centrifuge tube. An equal volume of physiological saline was added, and the tubes were centrifuged at 2000 rpm and room temperature for 10 minutes. The supernatant was removed, and the tubes were washed three times and counted. The volume ratio of the lymphocyte separation fluid to the diluted umbilical cord blood was 15:45-50.

[0145] 2) Seeding and stimulation of mononuclear cells

[0146] The precipitate after removing the supernatant in the previous step was plated at a cell density of 5.0×10 6 The cells were inoculated into KBM 581 medium containing 200 IU / mL of IL-2 to form a mixed solution. The mixed solution was placed in a coated T25 culture flask and then cultured in an incubator at 37°C and 5% CO2 saturated humidity.

[0147] 3) In vitro expansion of umbilical cord blood NK cells

[0148] After the cord blood mononuclear cells were separated in the previous step, they were divided into two bottles and placed in T25 bottles, with 5.0×10 6 Cells were cultured in a 5 mL volume. 500 ng of B21-VLP or B21-noVSVG-VLP was added to the coated T25 flask for stimulation, along with 5% autologous serum. The day of inoculation was designated as day 0.

[0149] Rehydration on the second day: add the same volume of KBM 581 medium containing IL-2 at a concentration of 200 IU / mL.

[0150] Rehydration on days 4-6: Observe the cells daily and add KBM 581 medium containing 200 IU / mL IL-2 based on the color of the cell suspension or the cell count. The volume added each time should not exceed twice the existing volume.

[0151] Count the cells on day 7 and adjust the cell density to 0.8-1.0×10 based on the color of the cell suspension and the number of cells. 6 cells / mL, and the NK phenotype was detected by flow cytometry. Starting from day 7, the cells were counted every 2 days and supplemented with KBM 581 medium containing IL-2 at a concentration of 200 IU / mL to maintain the cell concentration at 8-1.0×10 6 cells / mL. Cultured for 21 days.

[0152] 3. Experimental results

[0153] VSV-G (lentiviral packaging plasmid) plays an auxiliary role in the lentiviral packaging process. The plasmid contains the herpes stomatitis virus G protein (VSV-G) gene sequence. This gene replaces the viral envelope protein coding gene in the original virus, significantly enhancing the host cell infection range of the virus. Plasmids containing VSV-G and plasmids without VSV-G were used to package VLPs, and the P24 content of VLPs was measured by ELISA as its physical titer. The experiment showed that the presence or absence of VSV-G structure had a greater impact on the physical titer of VLPs. The physical titer of VLPs with VSV-G was significantly higher than that of VLPs without VSV-G ( Figure 4 ).

[0154] Cord blood mononuclear cells (CBMCs) were isolated. After determining the physical titer of VLPs, CBMCs were amplified with 500ng of B21-VLPs and B21-noVSVG-VLPs. 5% autologous serum was added, and cell counts were performed every 2-3 days starting on day 7 of culture. After 22 days of culture, the results showed that both VLPs with and without the VSV-G structure had an amplification effect on the cells, but B21-VLPs with VSV-G had a greater amplification effect. Figure 5 ).

[0155] Example 3B21-VLP has a good amplification effect on NK cells in CBMC

[0156] 1. Experimental Materials

[0157] Transient culture medium: Kangsheng Bio, product number A21501;

[0158] KBM 581 culture medium: Corning, catalog number 88-591-CM;

[0159] PEI: Polyplus, product number 101000026;

[0160] 50% glucose injection: Henan Kelun Pharmaceutical;

[0161] L-glutamine: Solarbio, product number G0200;

[0162] Human serum albumin (HSA): Pacific Biopharmaceuticals;

[0163] Dulbecco's phosphate buffered saline (DPBS): Gibco, product number 14190250;

[0164] Recombinant human interleukin-2 (IL2) for injection: Shuanglu Pharmaceutical;

[0165] P24 ELISA test kit: Yisheng Bio, catalog number 99301ES24;

[0166] FITC Anti-Human CD3: Cosmos Biotechnology, catalog number 6610004;

[0167] PE anti-human CD56: Cosmos Biotechnology, catalog number A6803;

[0168] PE / Cyanine7 Anti-Human CD4 Antibody: Elabscience, Cat. No. E-AB-F1109H;

[0169] PerCP Anti-Human CD8 Antibody: Elabscience, catalog number AN00427F.

[0170] 2. Experimental methods

[0171] (1) Expression process of 293T cells transfected with the constructed envelope plasmid

[0172] 1) Prepare B21-VLP using the envelope plasmid B21-VSVG. First, inoculate 293T cells and take 5×10 6 Cells were resuspended in a 125 mL cell culture shake flask using 20 mL of 293 culture medium, placed in a 37°C 5% CO2 incubator, and cultured with shaking at 125 rpm. The envelope plasmid B21-VSVG (5 μg) and the auxiliary plasmid (pMDLg 20 μg, pRSV 5 μg) were mixed as liquid A, and 75 μL of PEI was mixed with 1 mL of culture medium as liquid B. Liquids A and B were gently mixed to avoid bubbles, and allowed to stand at room temperature for 5 minutes after mixing. Liquid B was added to liquid A, gently mixed, and allowed to stand at room temperature for 20 minutes after mixing. The AB mixture was slowly added to the cell culture shake flask, and slowly shaken to mix. The cell culture shake flask was placed in a 37°C 5% CO2 incubator and cultured with shaking at 125 rpm.

[0173] 2) After 3-5 hours, perform a medium exchange. Centrifuge the cells at 1000 rpm for 5 minutes, resuspend the cells in 20 mL of 293 medium, and transfer them to a 125 mL cell culture shake flask. Place in a 37°C, 5% CO2 incubator with shaking at 125 rpm.

[0174] 3) Feed after 20-22 hours. Add 80 μL of 50% glucose injection and 800 μL of glutamine to each 125 mL cell culture shake flask, gently shaking to mix. Place in a 37°C, 5% CO2 incubator with shaking at 125 rpm.

[0175] 4) Harvest 48 hours after packaging.

[0176] 5) Transfer the cell suspension to a centrifuge tube and centrifuge at 2000 rpm for 10 minutes. Collect the supernatant to obtain the virus harvest. Filter the harvest through a 0.45 μm filter. Transfer the harvest to a centrifuge tube and centrifuge at 18,300 g for 2 hours at 4°C (9°C to 0°C). Resuspend the virus pellet in PBS containing 2% HSA to obtain the B21-VLP virus concentrate.

[0177] 6) After sampling, measure the physical titer using P24 ELISA. Store the remaining aliquots at -80°C until use.

[0178] (2) Isolation and stimulation of umbilical cord blood mononuclear cells

[0179] 1) Isolation of mononuclear cells

[0180] 200 mL of umbilical cord blood was divided into centrifuge tubes and centrifuged at 2000 rpm at room temperature for 20 minutes. After removing the upper light yellow plasma, an equal volume of physiological saline was added to the upper light yellow plasma to obtain diluted umbilical cord blood. Another centrifuge tube was taken, lymphocyte separation fluid was added, and the diluted umbilical cord blood was added to the lymphocyte separation fluid to separate the diluted blood and lymphocyte separation fluid. The tubes were then centrifuged at 2000 rpm at room temperature for 30 minutes. After removing part of the supernatant, the middle buffy coat layer was aspirated into a centrifuge tube. An equal volume of physiological saline was added, and the tubes were centrifuged at 2000 rpm at room temperature for 10 minutes. The supernatant was removed, and the tubes were washed three times and counted. The volume ratio of the lymphocyte separation fluid to the diluted umbilical cord blood was 15:45-50.

[0181] 2) Seeding and stimulation of mononuclear cells

[0182] The precipitate after removing the supernatant in the previous step was plated at a cell density of 5.0×10 6 The cells were inoculated into K581 serum-free medium at a concentration of 200 IU / mL, and IL2 factor was added at a concentration of 200 IU / mL to form a mixed solution. The mixed solution was placed in a coated T25 culture flask and then cultured in an incubator at a temperature of 37°C and a CO2 saturated humidity of 5% by volume.

[0183] 3) In vitro expansion of umbilical cord blood NK cells

[0184] After the cord blood mononuclear cells were separated in the previous step, they were divided into 3 bottles and placed in T25 bottles, with 5.0×10 6Cells were plated in a 5 mL volume. 1500 ng, 500 ng, and 150 ng of B21-VLPs were added to the coated T25 flasks for stimulation, along with 5% autologous serum. The day of inoculation was designated Day 0. The rehydration solution in this step was K581 medium containing 200 IU / mL of IL-2.

[0185] Rehydration on the second day: add the same volume of culture medium.

[0186] Rehydration on days 4-6: Observe the cells daily and add K581 complete medium based on the color of the cell suspension or the amount of cells. The volume added each time should not exceed twice the existing volume.

[0187] Count the cells on day 7 and adjust the cell density to 0.8-1.0×10 based on the color of the cell suspension and the number of cells. 6 cells / mL, and the NK phenotype was detected by flow cytometry. Starting from day 7, the cells were counted every 2 days and the expansion medium was added to maintain the cell concentration at 8-1.0×10 6 cells / mL. On day 10 of culture, the proportion of CD3+CD56- cells was determined using flow cytometry. On days 10, 13, 19, and 22 of culture, the number of cultured CBMCs was counted and their growth folds were calculated.

[0188] 3. Experimental results

[0189] Cord blood mononuclear cells (CBMCs) were isolated. After determining the physical titer of VLPs, CBMCs were stimulated with 1500ng, 500ng, and 150ng of B21-VLPs, respectively. After culturing for ten days, the proportion of CD3+CD56- cells was measured using flow cytometry. The results showed that with increasing B21-VLP concentrations, the proportion of NK cells in cultured CBMCs increased ( Figure 6 ).

[0190] On the 10th, 13th, 19th and 22nd day of culture, the cultured CBMCs were counted and their growth multiples were calculated. The results showed that there was little difference in cell proliferation when the B21-VLP mass was 1500ng and 500ng. Therefore, we believe that the use of 500ng of B21-VLP has a good expansion effect on NK cells in CBMCs ( Figure 7 ).

[0191] Example 4 Comparison of the stimulating effects of B21-VLP, B-VLP, and 21-VLP on CBMC

[0192] 1. Experimental Materials

[0193] Transient culture medium: Kangsheng Bio, product number A21501;

[0194] KBM 581 culture medium: Corning, catalog number 88-591-CM;

[0195] PEI: Polyplus, product number 101000026;

[0196] 50% glucose injection: Henan Kelun Pharmaceutical;

[0197] L-glutamine: Solarbio, product number G0200;

[0198] Human serum albumin (HSA): Pacific Biopharmaceuticals;

[0199] Dulbecco's phosphate buffered saline (DPBS): Gibco, product number 14190250;

[0200] Recombinant human interleukin-2 (IL2) for injection: Shuanglu Pharmaceutical;

[0201] P24 ELISA test kit: Yisheng Bio, catalog number 99301ES24;

[0202] FITC Anti-Human CD3: Cosmos Biotechnology, catalog number 6610004;

[0203] PE anti-human CD56: Cosmos Biotechnology, catalog number A6803;

[0204] PE / Cyanine7 Anti-Human CD4 Antibody: Elabscience, Cat. No. E-AB-F1109H;

[0205] PerCP Anti-Human CD8 Antibody: Elabscience, catalog number AN00427F.

[0206] 2. Experimental methods

[0207] (1) Expression process of 293T cells transfected with the constructed envelope plasmid

[0208] 1) Prepare VLPs using plasmids B21-VSVG, B-VSVG, and 21-VSVG. First, inoculate 293T cells and take 5×10 6 cells, use 20 mL of Resuspend the transient culture medium in a 125mL cell culture shake flask, place it in a 37℃ 5% CO2 incubator, and shake and culture at 125rpm. Mix the envelope plasmid B21-VSVG (5μg) and the auxiliary plasmid (pMDLg 20μg, pRSV 5μg) as liquid A, and take 75μL of PEI and mix it with 1mL culture medium as liquid B. Gently mix liquid A and liquid B to avoid bubbles, and let it stand at room temperature for 5min after mixing. Add liquid B to liquid A, mix gently, and let it stand at room temperature for 20min after mixing. Slowly add the AB mixture to the cell culture shake flask, and shake it slowly to mix. Place the cell culture shake flask in a 37℃ 5% CO2 incubator and shake and culture at 125rpm.

[0209] 2) After 3-5 hours, perform the medium change operation. Centrifuge the cells at 1000 rpm for 5 minutes and use 20 mL Resuspend the cells in transient culture medium, transfer to a 125 mL cell culture shake flask, and place in a 37°C 5% CO2 incubator with shaking at 125 rpm.

[0210] 3) Feed after 20-22 hours. Add 80 μL of 50% glucose injection and 800 μL of glutamine to each 125 mL cell culture shake flask, gently shaking to mix. Place in a 37°C, 5% CO2 incubator with shaking at 125 rpm.

[0211] 4) Harvest 48 hours after packaging.

[0212] 5) Transfer the cell suspension to a centrifuge tube and centrifuge at 2000 rpm for 10 minutes. Collect the supernatant to obtain the virus harvest. Filter the virus harvest using a 0.45 μm filter. Transfer the virus harvest to a centrifuge tube and centrifuge at 18,300 g for 2 hours at 4°C (9°C to 0°C). Resuspend the virus pellet in PBS containing 2% HSA to obtain B21-VLP, B-VLP, and 21-VLP virus concentrates.

[0213] 6) After sampling, measure the physical titer using P24 ELISA. Store the remaining aliquots at -80°C until use.

[0214] (2) Isolation and stimulation of umbilical cord blood mononuclear cells

[0215] 1) Isolation of mononuclear cells

[0216] 200 mL of umbilical cord blood was divided into centrifuge tubes and centrifuged at 2000 rpm at room temperature for 20 minutes. After removing the upper light yellow plasma, an equal volume of physiological saline was added to the upper light yellow plasma to obtain diluted umbilical cord blood. Another centrifuge tube was taken, lymphocyte separation fluid was added, and the diluted umbilical cord blood was added to the lymphocyte separation fluid to separate the diluted blood and lymphocyte separation fluid. The tubes were then centrifuged at 2000 rpm at room temperature for 30 minutes. After removing part of the supernatant, the middle buffy coat layer was aspirated into a centrifuge tube. An equal volume of physiological saline was added, and the tubes were centrifuged at 2000 rpm at room temperature for 10 minutes. The supernatant was removed, and the tubes were washed three times and counted. The volume ratio of the lymphocyte separation fluid to the diluted umbilical cord blood was 15:45-50.

[0217] 2) Seeding and stimulation of mononuclear cells

[0218] The precipitate after removing the supernatant in the previous step was plated at a cell density of 5.0×10 6 The cells were inoculated into K581 serum-free medium at a concentration of 200 IU / mL, and IL2 factor was added at a concentration of 200 IU / mL to form a mixed solution. The mixed solution was placed in a coated T25 culture flask and then cultured in an incubator at a temperature of 37°C and a CO2 saturated humidity of 5% by volume.

[0219] 3) In vitro expansion of umbilical cord blood NK cells

[0220] After the cord blood mononuclear cells were separated in the previous step, they were divided into 3 bottles and placed in T25 bottles, with 5.0×10 6 Cells were plated in a 5 mL volume. 500 ng of B-VLP, 21-VLP, or B21-VLP were added to the coated T25 flask for stimulation, along with 5% autologous serum. The day of inoculation was designated Day 0. The rehydration solution in this step was KBM 581 medium containing 200 IU / mL of IL-2.

[0221] Rehydration on the second day: add the same volume of KBM 581 complete medium.

[0222] Rehydration on days 4-6: Observe the cells daily and add KBM 581 complete medium based on the color of the cell suspension or the cell quantity. The volume added each time should not exceed twice the existing volume.

[0223] Count the cells on day 7 and adjust the cell density to 0.8-1.0×10 based on the color of the cell suspension and the number of cells. 6 cells / mL, and the NK phenotype was detected by flow cytometry. Starting from day 7, the cells were counted every 2 days and KBM581 complete medium was added to maintain the cell concentration at 8-1.0×10 6On day 22 of culture, the number of cultured CBMCs was counted and their growth fold was calculated.

[0224] 3. Experimental results

[0225] Cord blood CBMCs were isolated. The physical titers of B21-VLP, B-VLP, and 21-VLP were measured. CBMCs were stimulated with 500 ng of ... Figure 8 ), this synergistic effect is a technical effect that those skilled in the art could not have anticipated based on the prior art.

[0226] Example 5 Comparison of the Amplification Effects of B21-VLP and K562-41BBL-mbIL21 on NK Cells

[0227] 1. Experimental Materials

[0228] Transient culture medium: Kangsheng Bio, product number A21501;

[0229] KBM 581 culture medium: Corning, catalog number 88-591-CM;

[0230] PEI: Polyplus, product number 101000026;

[0231] 50% glucose injection: Henan Kelun Pharmaceutical;

[0232] L-glutamine: Solarbio, product number G0200;

[0233] Human serum albumin (HSA): Pacific Biopharmaceuticals;

[0234] Dulbecco's phosphate buffered saline (DPBS): Gibco, product number 14190250;

[0235] Recombinant human interleukin-2 (IL2) for injection: Shuanglu Pharmaceutical;

[0236] P24 ELISA test kit: Yisheng Bio, catalog number 99301ES24;

[0237] FITC Anti-Human CD3: Cosmos Biotechnology, catalog number 6610004;

[0238] PE anti-human CD56: Cosmos Biotechnology, catalog number A6803;

[0239] PE / Cyanine7 Anti-Human CD4 Antibody: Elabscience, Cat. No. E-AB-F1109H;

[0240] PerCP Anti-Human CD8 Antibody: Elabscience, catalog number AN00427F.

[0241] The K562-41BBL-mbIL21 is derived from the literature: Shman TV, Vashkevich KP, Migas AA, Matveyenka MA, Lasiukov YA, Mukhametshyna NS, Horbach KI, AleinikovaOV. Phenotypic and functional characterization of locally produced natural killer cells ex vivo expanded with the K562-41BBL-mbIL21 cell line. Clin ExpMed. 2023Oct; 23(6): 2551-2560. doi: 10.1007 / s10238-022-00974-2. Epub 2022Dec17. PMID: 36527513.

[0242] 2. Experimental methods

[0243] (1) Expression process of 293T cells transfected with the constructed envelope plasmid

[0244] 1) Prepare B21-VLP using the envelope plasmid B21-VSVG. First, inoculate 293T cells and take 5×10 6 cells, use 20 mL of The transient culture medium was resuspended in a 125 mL cell culture shake flask and placed in a 37°C 5% CO2 incubator with shaking at 125 rpm. The envelope plasmid B21-VSVG (5 μg) and the helper plasmid (pMDLg 20 μg, pRSV 5 μg) were mixed with 1 mL Mix the transient culture medium as liquid A, take 75 μL of PEI and 1 mL Mix the transient culture medium as Solution B. Gently mix Solution A and Solution B, avoiding bubbles. Let stand at room temperature for 5 minutes. Add Solution B to Solution A, gently mix, and let stand at room temperature for 20 minutes. Slowly add the AB mixture to the cell culture shaker flask, gently shaking to mix. Place the cell culture shaker flask in a 37°C, 5% CO2 incubator with shaking at 125 rpm.

[0245] 2) After 3-5 hours, perform the medium change operation. Centrifuge the cells at 1000 rpm for 5 minutes and use 20 mL Resuspend the cells in transient culture medium, transfer to a 125 mL cell culture shake flask, and place in a 37°C 5% CO2 incubator with shaking at 125 rpm.

[0246] 3) Feed after 20-22 hours. Add 80 μL of 50% glucose injection and 800 μL of glutamine to each 125 mL cell culture shake flask, gently shaking to mix. Place in a 37°C, 5% CO2 incubator with shaking at 125 rpm.

[0247] 4) Harvest 48 hours after packaging.

[0248] 5) Transfer the cell suspension to a centrifuge tube and centrifuge at 2000 rpm for 10 minutes. Collect the supernatant to obtain the virus harvest. Filter the harvest through a 0.45 μm filter. Transfer the harvest to a centrifuge tube and centrifuge at 18,300 g for 2 hours at 4°C (9°C to 0°C). Resuspend the virus pellet in PBS containing 2% HSA to obtain the B21-VLP virus concentrate.

[0249] 6) After sampling, measure the physical titer using P24 ELISA. Store the remaining aliquots at -80°C until use.

[0250] (2) Isolation and stimulation of umbilical cord blood mononuclear cells

[0251] 1) Isolation of mononuclear cells

[0252] 200 mL of umbilical cord blood was divided into centrifuge tubes and centrifuged at 2000 rpm and room temperature for 20 minutes. After removing the upper light yellow plasma, an equal volume of physiological saline was added to the upper light yellow plasma to obtain diluted umbilical cord blood. Another centrifuge tube was taken, lymphocyte separation fluid was added, and the diluted umbilical cord blood was added to the lymphocyte separation fluid to separate the diluted blood and lymphocyte separation fluid. The tubes were then centrifuged at 2000 rpm and room temperature for 30 minutes. After removing part of the supernatant, the middle buffy coat layer was aspirated into a centrifuge tube. An equal volume of physiological saline was added, and the tubes were centrifuged at 2000 rpm and room temperature for 10 minutes. The supernatant was removed, and the tubes were washed three times and counted. The volume ratio of the lymphocyte separation fluid to the diluted umbilical cord blood was 15:45-50.

[0253] 2) Seeding and stimulation of mononuclear cells

[0254] The precipitate after removing the supernatant in the previous step was plated at a cell density of 5.0×10 6 The cells were inoculated into K581 serum-free medium at a concentration of 200 IU / mL, and IL2 factor was added at a concentration of 200 IU / mL to form a mixed solution. The mixed solution was placed in a coated T25 culture flask and then cultured in an incubator at a temperature of 37°C and a CO2 saturated humidity of 5% by volume.

[0255] 3) In vitro expansion of umbilical cord blood NK cells

[0256] After the cord blood mononuclear cells were separated in the previous step, they were divided into two bottles and placed in T25 bottles, with 5.0×10 6 Cells were plated in a 5 mL volume. One of the coated vials was stimulated with 500 ng of B21-VLPs. The other vial was inoculated with K562-41BBL-mbIL21 cells at a 1:1 ratio of CBMCs and 5% autologous serum. The day of inoculation was designated Day 0. The rehydration solution in this step was K581 medium containing 200 IU / mL of IL-2.

[0257] Rehydration on the second day: add the same volume of culture medium.

[0258] Rehydration on days 4-6: Observe the cells every day and add K581 complete medium according to the color of the cell suspension or the cell amount. The volume added each time should not exceed twice the existing volume.

[0259] Count the cells on day 7 and adjust the cell density to 0.8-1.0×10 based on the color of the cell suspension and the number of cells. 6 cells / mL, and the NK phenotype was detected by flow cytometry. Starting from day 7, the cells were counted every 2-3 days and the expansion medium was added to maintain the cell concentration at 8-1.0×10 6 cells / mL, and the proportion of CD3-CD56+ NK cells was detected by flow cytometry on the 22nd day of culture.

[0260] 3. Experimental results

[0261] Experiments have shown that B21-VLP can achieve similar effects on NK cell proliferation as K562-41BBL-mbIL21. The proportion of NK cells in the total cells can reach more than 90% ( Figure 9-10 ).

[0262] CBMCs were isolated and the physical titer of B21-VLP was determined. CBMCs were stimulated with 500 ng of B21-VLP and K562-41BBL-mbIL21, respectively. The results showed that when B21-VLP stimulated CBMCs, flow cytometry results showed that cell debris was significantly reduced. Therefore, the B21-VLP constructed by the present invention has a greater advantage in stimulation ( Figure 11 ).

[0263] Example 6 B21-VLP can selectively expand NK cells when stimulating CBMC

[0264] 1. Experimental Materials

[0265] Transient culture medium: Kangsheng Bio, product number A21501;

[0266] KBM 581 culture medium: Corning, catalog number 88-591-CM;

[0267] PEI: Polyplus, product number 101000026;

[0268] 50% glucose injection: Henan Kelun Pharmaceutical;

[0269] L-glutamine: Solarbio, product number G0200;

[0270] Human serum albumin (HSA): Pacific Biopharmaceuticals;

[0271] Dulbecco's phosphate buffered saline (DPBS): Gibco, product number 14190250;

[0272] Recombinant human interleukin-2 (IL2) for injection: Shuanglu Pharmaceutical;

[0273] P24 ELISA test kit: Yisheng Bio, catalog number 99301ES24;

[0274] FITC Anti-Human CD3: Cosmos Biotechnology, catalog number 6610004;

[0275] PE anti-human CD56: Cosmos Biotechnology, catalog number A6803;

[0276] PE / Cyanine7 Anti-Human CD4 Antibody: Elabscience, Cat. No. E-AB-F1109H;

[0277] PerCP Anti-Human CD8 Antibody: Elabscience, catalog number AN00427F.

[0278] 2. Experimental methods

[0279] (1) Expression process of 293T cells transfected with the constructed envelope plasmid

[0280] 1) Prepare B21-VLP using the envelope plasmid B21-VSVG. First, inoculate 293T cells and take 5×10 6 cells, use 20 mL of The transient culture medium was resuspended in a 125 mL cell culture shake flask and placed in a 37°C 5% CO2 incubator with shaking at 125 rpm. The envelope plasmid B21-VSVG (5 μg) and the helper plasmid (pMDLg 20 μg, pRSV 5 μg) were mixed with 1 mL Mix the transient culture medium as liquid A, take 75 μL of PEI and 1 mL Mix the transient culture medium as Solution B. Gently mix Solution A and Solution B, avoiding bubbles. Let stand at room temperature for 5 minutes. Add Solution B to Solution A, gently mix, and let stand at room temperature for 20 minutes. Slowly add the AB mixture to the cell culture shaker flask, gently shaking to mix. Place the cell culture shaker flask in a 37°C, 5% CO2 incubator with shaking at 125 rpm.

[0281] 2) After 3-5 hours, perform the medium change operation. Centrifuge the cells at 1000 rpm for 5 minutes and use 20 mL Resuspend the cells in transient culture medium, transfer to a 125 mL cell culture shake flask, and place in a 37°C 5% CO2 incubator with shaking at 125 rpm.

[0282] 3) Feed after 20-22 hours. Add 80 μL of 50% glucose injection and 800 μL of glutamine to each 125 mL cell culture shake flask, gently shaking to mix. Place in a 37°C, 5% CO2 incubator with shaking at 125 rpm.

[0283] 4) Harvest 48 hours after packaging.

[0284] 5) Transfer the cell suspension to a centrifuge tube and centrifuge at 2000 rpm for 10 minutes. Collect the supernatant to obtain the virus harvest. Filter the harvest through a 0.45 μm filter. Transfer the harvest to a centrifuge tube and centrifuge at 18,300 g for 2 hours at 4°C (9°C to 0°C). Resuspend the virus pellet in PBS containing 2% HSA to obtain the B21-VLP virus concentrate.

[0285] 6) After sampling, measure the physical titer using P24 ELISA. Store the remaining aliquots at -80°C until use.

[0286] (2) Isolation and stimulation of umbilical cord blood mononuclear cells

[0287] 1) Isolation of mononuclear cells

[0288] 200 mL of umbilical cord blood was divided into centrifuge tubes and centrifuged at 2000 rpm and room temperature for 20 minutes. After removing the upper light yellow plasma, an equal volume of physiological saline was added to the upper light yellow plasma to obtain diluted umbilical cord blood. Another centrifuge tube was taken, lymphocyte separation fluid was added, and the diluted umbilical cord blood was added to the lymphocyte separation fluid to separate the diluted blood and lymphocyte separation fluid. The tubes were then centrifuged at 2000 rpm and room temperature for 30 minutes. After removing part of the supernatant, the middle buffy coat layer was aspirated into a centrifuge tube. An equal volume of physiological saline was added, and the tubes were centrifuged at 2000 rpm and room temperature for 10 minutes. The supernatant was removed, and the tubes were washed three times and counted. The volume ratio of the lymphocyte separation fluid to the diluted umbilical cord blood was 15:45-50.

[0289] 2) Seeding and stimulation of mononuclear cells

[0290] The precipitate after removing the supernatant in the previous step was plated at a cell density of 5.0×10 6 The cells were inoculated into K581 serum-free medium at a concentration of 200 IU / mL, and IL2 factor was added at a concentration of 200 IU / mL to form a mixed solution. The mixed solution was placed in a coated T25 culture flask and then cultured in an incubator at a temperature of 37°C and a CO2 saturated humidity of 5% by volume.

[0291] 3) In vitro expansion of umbilical cord blood NK cells

[0292] After the cord blood mononuclear cells were separated in the previous step, they were divided into two bottles and placed in T25 bottles, with 5.0×10 6 Cells were plated in a 5 mL volume. One of the coated vials was stimulated with 500 ng of B21-VLPs. The other vial was inoculated with K562-41BBL-mbIL21 cells at a 1:1 ratio of CBMCs and 5% autologous serum. The day of inoculation was designated Day 0. The rehydration solution in this step was K581 medium containing 200 IU / mL of IL-2.

[0293] Rehydration on the second day: add the same volume of culture medium.

[0294] Rehydration on days 4-6: Observe the cells every day and add K581 complete medium according to the color of the cell suspension or the cell amount. The volume added each time should not exceed twice the existing volume.

[0295] Count the cells on day 7 and adjust the cell density to 0.8-1.0×10 based on the color of the cell suspension and the number of cells. 6 cells / mL, and the NK phenotype was detected by flow cytometry. Starting from day 7, the cells were counted every 2-3 days and the expansion medium was added to maintain the cell concentration at 8-1.0×10 6 cells / mL, and the proportion of CD3-CD56+ NK cells was detected by flow cytometry on the 22nd day of culture.

[0296] 3. Experimental results

[0297] CBMC were isolated and the physical titer of B21-VLP was determined. CBMC were stimulated with 500ng of B21-VLP for 21 days. T cell, NKT cell, and NK cell counts were measured every 2 days using flow cytometry. The results showed that B21-VLP stimulation of CBMC could selectively expand NK cells, with NK cells accounting for more than 90% of the total cell count on day 21 of culture. Figure 12 ).

[0298] Example 7: NK cells cultured with B21-VLP have a strong killing ability against K562 cells

[0299] 1. Experimental Materials

[0300] Transient culture medium: Kangsheng Bio, product number A21501;

[0301] KBM 581 culture medium: Corning, catalog number 88-591-CM;

[0302] PEI: Polyplus, product number 101000026;

[0303] 50% glucose injection: Henan Kelun Pharmaceutical;

[0304] L-glutamine: Solarbio, product number G0200;

[0305] Human serum albumin (HSA): Pacific Biopharmaceuticals;

[0306] Dulbecco's phosphate buffered saline (DPBS): Gibco, product number 14190250;

[0307] Recombinant human interleukin-2 (IL2) for injection: Shuanglu Pharmaceutical;

[0308] P24 ELISA test kit: Yisheng Bio, catalog number 99301ES24;

[0309] FITC Anti-Human CD3: Cosmos Biotechnology, catalog number 6610004;

[0310] PE anti-human CD56: Cosmos Biotechnology, catalog number A6803;

[0311] PE / Cyanine7 Anti-Human CD4 Antibody: Elabscience, Cat. No. E-AB-F1109H;

[0312] PerCP Anti-Human CD8 Antibody: Elabscience, catalog number AN00427F.

[0313] 2. Experimental methods

[0314] (1) Expression process of 293T cells transfected with the constructed envelope plasmid

[0315] 1) Prepare B21-VLP using the envelope plasmid B21-VSVG. First, inoculate 293T cells and take 5×10 6 cells, use 20 mL of The transient culture medium was resuspended in a 125 mL cell culture shake flask and placed in a 37°C 5% CO2 incubator with shaking at 125 rpm. The envelope plasmid B21-VSVG (5 μg) and the helper plasmid (pMDLg 20 μg, pRSV 5 μg) were mixed with 1 mL Mix the transient culture medium as liquid A, take 75 μL of PEI and 1 mL Mix the transient culture medium as Solution B. Gently mix Solution A and Solution B, avoiding bubbles. Let stand at room temperature for 5 minutes. Add Solution B to Solution A, gently mix, and let stand at room temperature for 20 minutes. Slowly add the AB mixture to the cell culture shaker flask, gently shaking to mix. Place the cell culture shaker flask in a 37°C, 5% CO2 incubator with shaking at 125 rpm.

[0316] 2) After 3-5 hours, perform the medium change operation. Centrifuge the cells at 1000 rpm for 5 minutes and use 20 mL and 1 mL Resuspend the cells in transient culture medium, transfer to a 125 mL cell culture shake flask, and place in a 37°C 5% CO2 incubator with shaking at 125 rpm.

[0317] 3) Feed after 20-22 hours. Add 80 μL of 50% glucose injection and 800 μL of glutamine to each 125 mL cell culture shake flask, gently shaking to mix. Place in a 37°C, 5% CO2 incubator with shaking at 125 rpm.

[0318] 4) Harvest 48 hours after packaging.

[0319] 5) Transfer the cell suspension to a centrifuge tube and centrifuge at 2000 rpm for 10 minutes. Collect the supernatant to obtain the virus harvest. Filter the harvest through a 0.45 μm filter. Transfer the harvest to a centrifuge tube and centrifuge at 18,300 g for 2 hours at 4°C (9°C to 0°C). Resuspend the virus pellet in PBS containing 2% HSA to obtain the B21-VLP virus concentrate.

[0320] 6) After sampling, measure the physical titer using P24 ELISA. Store the remaining aliquots at -80°C until use.

[0321] (2) Isolation and stimulation of umbilical cord blood mononuclear cells

[0322] 1) Isolation of mononuclear cells

[0323] 200 mL of umbilical cord blood was divided into centrifuge tubes and centrifuged at 2000 rpm and room temperature for 20 minutes. After removing the upper light yellow plasma, an equal volume of physiological saline was added to the upper light yellow plasma to obtain diluted umbilical cord blood. Another centrifuge tube was taken, lymphocyte separation fluid was added, and the diluted umbilical cord blood was added to the lymphocyte separation fluid to separate the diluted blood and lymphocyte separation fluid. The tubes were then centrifuged at 2000 rpm and room temperature for 30 minutes. After removing part of the supernatant, the middle buffy coat layer was aspirated into a centrifuge tube. An equal volume of physiological saline was added, and the tubes were centrifuged at 2000 rpm and room temperature for 10 minutes. The supernatant was removed, and the tubes were washed three times and counted. The volume ratio of the lymphocyte separation fluid to the diluted umbilical cord blood was 15:45-50.

[0324] 2) Seeding and stimulation of mononuclear cells

[0325] The precipitate after removing the supernatant in the previous step was plated at a cell density of 5.0×10 6 The cells were inoculated into K581 serum-free medium at a concentration of 200 IU / mL, and IL2 factor was added at a concentration of 200 IU / mL to form a mixed solution. The mixed solution was placed in a coated T25 culture flask and then cultured in an incubator at a temperature of 37°C and a CO2 saturated humidity of 5% by volume.

[0326] 3) In vitro expansion of umbilical cord blood NK cells

[0327] After the separation of cord blood mononuclear cells in the previous step, 5.0×10 6Cells were plated in a 5 mL T25 flask. One of the coated flasks was stimulated with 500 ng of B21-VLPs at a 1:1 ratio of B21-VLPs to CBMCs, supplemented with 5% autologous serum. The day of inoculation was designated Day 0. The rehydration solution in this step was K581 medium supplemented with 200 IU / mL of IL-2.

[0328] 4) Rehydration on the second day: add the same volume of culture medium.

[0329] 5) Rehydration on Days 4-6: Observe the cells daily and add K581 complete medium based on the color of the cell suspension or the number of cells. The volume added each time should not exceed twice the existing volume.

[0330] 6) Count the cells on the 7th day and adjust the cell density to 0.8-1.0×10 based on the color of the cell suspension and the number of cells. 6 cells / mL, and the NK phenotype was detected by flow cytometry.

[0331] 7) NK cell killing experiment

[0332] B21-VLP-cultured NK cells served as effector cells, and K562 tumor cells served as target cells. Co-culture was performed at effector-target ratios of 10:1, 3:1, and 1:1, respectively. After 24 hours, the effector-to-target ratio was determined using flow cytometry.

[0333] 3. Experimental results

[0334] The experimental results are as follows Figure 13 As shown in the results, the effector cells and target cells were detected after 24 hours, and the target cell ratio was observed to be less than 1%, indicating that the NK cells cultured with the B21-VLP constructed by the present invention have a strong killing ability against K562 cells.

Claims

1. A virus-like particle B21-VLP expressing mIL21 and 4-1BBL, characterized in that: The B21-VLP is composed of the following operably linked elements connected in sequence: mIL21, T2A, 4-1BBL, T2A, VSV-G; The amino acid sequence of mIL21 is shown in SEQ ID NO. 16, and the amino acid sequence of 4-1BBL is shown in SEQ ID NO. 17; The amino acid sequence of VSV-G is shown in SEQ ID NO.

18.

2. The B21-VLP according to claim 1, characterized in that The base sequence encoding the mIL21 is shown in SEQ ID NO. 20, and the base sequence encoding the 4-1BBL is shown in SEQ ID NO.

21.

3. The B21-VLP according to claim 1, characterized in that The base sequence encoding the VSV-G is shown in SEQ ID NO.

22.

4. A method for constructing virus-like particles B21-VLP expressing mIL21 and 4-1BBL according to any one of claims 1 to 3, characterized in that: The construction method comprises the following steps: (1) Construction of B21-VSVG envelope plasmid; (2) Use B21-VSVG envelope plasmid to transfect host cells to construct B21-VLP.

5. The construction method according to claim 4, characterized in that The construction of the B21-VSVG envelope plasmid comprises the following steps: (1) mIL21 and 4-1BBL fragments were obtained by gene synthesis, as fragment 1, the amino acid sequence of mIL21 is shown in SEQ ID NO. 16, and the amino acid sequence of 4-1BBL is shown in SEQ ID NO. 17; (2) Using pMD2.G as the plasmid backbone, fragment 2 was obtained by digestion with EcoR Ⅰ restriction endonuclease; (3) Using pMD2.G as a plasmid template, PCR was performed to obtain fragment 3. Primer VSVG-F1 was designed, and the amino-terminal sequence from the 5' end to the 3' end was shown in SEQ ID NO.

1. Homologous recombination was used to design a homology arm to be added to the 5' end, and the amino-terminal sequence was shown in SEQ ID NO.

2. Primer VSVG-R1 was designed at the 3' end, and the amino-terminal sequence from the 5' end to the 3' end was shown in SEQ ID NO.

3. (4) The obtained fragments 1, 2, and 3 are connected using homologous recombinase to obtain a complete plasmid, which is the B21-VSVG envelope plasmid.

6. The construction method according to claim 4, characterized in that The method of using B21-VSVG envelope plasmid to transfect host cells to construct B21-VLP comprises the following steps: (1) Mix the envelope plasmid B21-VSVG and the helper plasmids pMDLg and pRSV as solution A, mix PEI with culture medium as solution B, mix solutions A and B to obtain a mixed solution AB, add the mixed solution AB to the host cell culture medium, and culture the host cells; (2) Perform fluid change after 3-5 hours; (3) Feed after 20-22 h; (4) Harvest 48 hours after packaging to obtain B21-VLP.

7. The construction method according to claim 6, characterized in that: The amounts of the envelope plasmid and helper plasmid used are: B21-VSVG (1-10) μg, pMDLg (5-50) μg, and pRSV (1-10) μg, respectively.

8. The construction method according to claim 7, characterized in that: The amounts of the envelope plasmid and helper plasmid used were: B21-VSVG 5 μg, pMDLg 20 μg, and pRSV 5 μg, respectively.

9. The construction method according to claim 4, characterized in that: The host cell is 293T cell, 293 cell, HEK293F cell, CHO cell, Vero cell or HeLa cell.

10. The construction method according to claim 9, characterized in that: The host cell is 293T cell.

11. The construction method according to claim 6, characterized in that: The culture medium is Wayne293® transient transfection medium, EmCD HEK293 Plus medium, CELL-WISE 293 medium CW001, complete medium M293TI, glutamine-free medium M293TIS, glutamine-free phenol red-free medium M293TINPR or union293 medium.

12. The construction method according to claim 11, characterized in that: The culture medium is Wayne293® transient transfection medium.

13. The construction method according to claim 6, characterized in that: When preparing the solution A, the amount of the culture medium used is 0.5-5 mL.

14. The construction method according to claim 13, characterized in that: When preparing the solution A, the amount of the culture medium used is 1 mL.

15. The construction method according to claim 6, characterized in that: When preparing the solution B, the amounts of PEI and culture medium used are 25-125 μL and 0.5-5 mL, respectively.

16. The construction method according to claim 15, characterized in that: When preparing the solution B, the amounts of PEI and culture medium used were 75 μL and 1 mL, respectively.

17. The construction method according to claim 6, characterized in that: The feed comprises supplementing glucose and glutamine.

18. A composition comprising the B21-VLP of any one of claims 1-3.

19. A culture for expanding NK cells, characterized in that The culture contains the B21-VLP according to any one of claims 1 to 3 or the composition according to claim 18.

20. A method for expanding NK cells, culturing or stimulating NK cells in vitro, characterized in that: The method comprises contacting NK cells with the B21-VLP of any one of claims 1 to 3, the composition of claim 18, or the culture of claim 19.

21. The method according to claim 20, characterized in that The NK cells are present in the cord blood mononuclear cell population.

22. Use of the B21-VLP according to any one of claims 1 to 3, the composition according to claim 18, or the culture according to claim 19 in in vitro expansion of NK cells, in vitro culture, or stimulation of NK cells.

Citation Information

Patent Citations

  • Recombinant lentiviral expression vector, reconstitution cell and application of reconstitution cell to culturing natural killer cell

    CN109371062A

  • Method for culturing cord blood-derived natural killer cells using transformed t-cells

    CN113383069A