Genetic engineering method for improving drought resistance of plants
By introducing the AmASMT gene from *Gnaphalium affine* and optimizing the transformation and screening system, the problems of limited drought-resistant gene resources and low transformation efficiency were solved, enabling efficient screening and enhanced stability of drought-resistant plants, thus providing technical support for food security in arid regions.
Patent Information
- Application Number
- CN202510399210.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-01
- Publication Date
- 2026-06-12
- Estimated Expiration
- 2045-04-01
AI Technical Summary
In existing technologies, drought-resistant gene resources are limited, conversion efficiency is low, and screening systems are incomplete, resulting in slow progress in drought resistance improvement. Furthermore, the existing drought stress assessment system lacks standardization.
The AmASMT gene of *Phyllostachys edulis* was introduced to construct an efficient expression vector and optimize the screening system. The transformation process was optimized by using liquid nitrogen freeze-thaw method, AS co-culture medium and hygromycin screening. Combined with standardized PEG-6000 concentration and treatment time, chlorophyll content, proline accumulation and survival rate were comprehensively evaluated. The methods for chlorophyll determination and proline detection were optimized. The preparation and application of PEG solution were controlled to ensure osmotic potential stability.
It significantly improved the conversion efficiency and screening accuracy of drought-resistant genes, shortened the breeding cycle, ensured the stability of drought-resistant plants and their correlation with field performance, and met actual production needs.
Smart Images

Figure CN120230786B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering and crop genetic improvement technology, and in particular relates to a genetic engineering method for improving plant drought resistance. Background Technology
[0002] Drought stress is one of the major environmental factors limiting crop yields, especially against the backdrop of global climate change, with a significant increase in the frequency and intensity of droughts. Traditional methods for improving plant drought resistance mainly rely on natural variation screening and hybridization breeding, but these methods suffer from drawbacks such as long cycles, low efficiency, and susceptibility to genetic limitations. With the development of molecular biology techniques, improving plant drought resistance through genetic engineering has become a research hotspot, but current technologies still face the following challenges:
[0003] Currently known drought-resistant functional genes are mostly derived from model plants (such as Arabidopsis thaliana), while the genetic resources of extremely drought-tolerant plants (such as psammophytes) have not been fully developed. As a typical xerophytic grass, the cloning and functional analysis of drought-resistant genes in *Agropyron mongolicum* are still in their early stages, limiting its application in crop improvement.
[0004] Existing drought-resistance gene transformation vectors mostly use constitutive promoters (such as CaMV 35S) to drive gene expression. While this can improve plant drought resistance, it often leads to side effects such as growth inhibition and reduced yield in transgenic plants. Furthermore, the selection of screening marker genes (such as antibiotic resistance genes) during vector construction may raise ecological safety controversies and requires further optimization.
[0005] Agrobacterium-mediated rice genetic transformation is highly genotype-dependent, with a transformation efficiency of approximately 20%-30% for conventional japonica rice and often below 10% for indica rice. Furthermore, the post-transformation screening process involves multiple stages, including callus induction, differentiation, and rooting, taking 4-6 months in total, which severely limits the efficiency of verifying drought-resistant gene function.
[0006] Current drought resistance screening methods mostly rely on single indicators (such as survival rate) and lack comprehensive evaluation of physiological and biochemical indicators (such as chlorophyll degradation rate and accumulation of osmotic regulators). For example, although some transgenic plants can survive drought stress, their photosynthetic systems are severely damaged, resulting in a significant decrease in biomass, making it difficult to meet actual production needs.
[0007] The commonly used PEG-6000 solution in the laboratory for simulating drought stress suffers from problems such as inaccurate concentration gradients and inconsistent treatment times. Studies have shown that the osmotic potential of the PEG solution differs from the variation pattern of soil water potential during drought, resulting in a low correlation between screening results and field performance. Therefore, a more realistic evaluation system needs to be established.
[0008] As a wild plant, the gene expression regulation mechanism of *Phyllostachys edulis* in crops remains unclear. For example, the promoters of genes derived from *Phyllostachys edulis* may be incompatible with transcription factors in crops such as rice, leading to unstable expression levels of the target gene in transgenic plants and significant differences in drought resistance phenotypes.
[0009] The root cause of these problems lies in the fact that existing technologies have failed to systematically address the synergistic issues among drought-resistant gene mining, vector optimization, transformation efficiency improvement, and multi-dimensional phenotypic evaluation. Particularly in the utilization of psammophyte gene resources, there is a lack of adaptive modification strategies tailored to the crop's genetic background, and the standardization of drought stress assessment systems is insufficient, leading to slow progress in drought-resistant genetic engineering research. Future research should utilize multidisciplinary approaches, combining genomics, metabolomics, and bioinformatics technologies to construct a complete technological system from gene cloning to variety breeding, providing new pathways for improving crop drought resistance. Summary of the Invention
[0010] One objective of this invention is to address the current limitations of crop drought resistance improvement, which relies heavily on gene resources from closely related species, resulting in limited gene resources, low transformation efficiency, and inadequate screening systems. This invention addresses these issues by introducing the AmASMT gene from *Phyllostachys edulis*, constructing a highly efficient expression vector, and optimizing the screening system. The aim is to resolve these problems of scarce gene resources, low transformation efficiency, and the lack of comprehensive multi-indicator evaluation.
[0011] Traditional Agrobacterium-mediated transformation methods are cumbersome, have unstable efficiency, and involve long screening cycles. This invention optimizes the transformation process through liquid nitrogen freeze-thaw cycles, AS co-culture medium, and hygromycin screening, solving the problems of low transformation efficiency, strong genotype dependence, and time-consuming screening.
[0012] Existing gene cloning methods are prone to introducing sequence errors and lack sufficient amplification specificity. This invention addresses the accuracy and efficiency issues in cloning the full-length ORF sequence of the AmASMT gene by designing specific primers, optimizing the PCR procedure, and performing sequencing verification.
[0013] Traditional PEG simulations of drought stress concentration control are imprecise and have low correlation with actual field performance. This invention addresses the problems of inconsistent stress conditions and unreliable screening results by standardizing the PEG-6000 concentration range (15%-20% w / v) and treatment time (5-7 days).
[0014] Existing drought resistance screening methods rely on a single indicator (such as survival rate) and neglect physiological and biochemical responses. This invention addresses the problem of insufficient actual drought resistance performance of plants caused by the one-sidedness of screening systems by comprehensively evaluating chlorophyll content, proline accumulation, and survival rate.
[0015] Traditional chlorophyll measurement methods suffer from large errors and poor repeatability. This invention addresses the problem of inaccurate chlorophyll degradation rate quantification by combining spectrophotometry with the Lichtenthaler equation.
[0016] Proline detection involves complex procedures and suffers from poor colorimetric stability. This invention optimizes extraction and colorimetric conditions using a ninhydrin colorimetric method, addressing the issues of low efficiency and insufficient accuracy in proline content determination.
[0017] Survival rate statistics are greatly affected by environmental factors, resulting in poor comparability. This invention addresses the issue of strong subjectivity in survival rate statistics by standardizing PEG treatment time, recovery conditions, and calculation formulas.
[0018] Improper preparation and application of PEG solutions can lead to fluctuations in osmotic potential. This invention addresses the instability issue in stress condition simulations by employing magnetic stirring for dissolution, maintaining a constant concentration, and controlling environmental parameters.
[0019] Insufficient baseline correction in spectrophotometer measurements of chlorophyll leads to large data errors. This invention addresses the problem of inaccurate absorbance measurements through repeated measurements, blank control calibration, and error control.
[0020] This invention provides a genetic engineering method for improving plant drought resistance, comprising the following steps:
[0021] a) The full-length open reading frame (ORF) sequence of the AmASMT gene was isolated from Agropyron mongolicum, and its base sequence is shown in SEQ ID NO:3;
[0022] b) The ORF sequence of the AmASMT gene is linked with a plant expression regulatory element to construct an overexpression vector pBWA(V)HS-AmASMT-osgfp, wherein the regulatory element includes a constitutive promoter and a selection marker gene.
[0023] c) The overexpression vector was transferred into rice callus tissue using Agrobacterium EHA105-mediated genetic transformation.
[0024] d) Under simulated drought stress conditions, PEG-6000 treatment was used to screen transgenic rice T1 generation plants that overexpressed the AmASMT gene and showed significantly enhanced drought resistance.
[0025] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the Agrobacterium-mediated genetic transformation method specifically includes the following steps:
[0026] i) The overexpression vector pBWA(V)HS-AmASMT-osgfp was transformed into Agrobacterium EHA105 strain by liquid nitrogen freeze-thaw method;
[0027] ii) Using a co-culture medium containing acetylsuccinone AS, Agrobacterium carrying the vector was co-cultured with rice callus for 48 hours;
[0028] iii) Transgenic rice callus with stable integration of the AmASMT gene was obtained through hygromycin screening and PCR verification.
[0029] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the full-length ORF sequence of the AmASMT gene is obtained by cloning through the following steps:
[0030] i) Extract total RNA from the leaves of *Pyracantha fortuneana* and synthesize the first strand of cDNA using reverse transcriptase;
[0031] ii) Design specific primer pairs with the following nucleotide sequences:
[0032] Forward primer: SEQ ID NO:1 5′-ATGGCGCTCACCAGGGAG-3′,
[0033] Reverse primer: SEQ ID NO:2 5′-TGGGTAAACCTCGATGATCGATCTC-3′;
[0034] iii) PCR amplification was performed using high-fidelity DNA polymerase. The amplification program was as follows:
[0035] Pre-denaturation: 94℃ for 5 minutes;
[0036] Cyclic parameters: 94℃ denaturation for 30 seconds, 50℃ annealing for 30 seconds, 72℃ extension for 65 seconds, for a total of 30 cycles;
[0037] Final extension: 72℃ for 10 minutes;
[0038] iv) The amplification products were separated by agarose gel electrophoresis, the target fragment was recovered by gel excision, ligated into a cloning vector, and transformed into E. coli;
[0039] v) Positive clones containing the complete AmASMT gene ORF sequence were obtained through colony PCR and sequencing verification.
[0040] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the simulated drought stress conditions are as follows: transgenic rice plants are treated with a PEG-6000 solution with a concentration of 15%-20% w / v for 5-7 days, and transgenic plants with significantly enhanced drought resistance are screened by measuring chlorophyll content, proline accumulation and plant survival rate.
[0041] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the screening includes the following steps:
[0042] i) The chlorophyll content of the leaves of transgenic plants was determined by spectrophotometry, and strains with a chlorophyll degradation rate lower than 40% of wild-type plants were screened.
[0043] ii) The proline accumulation in leaves was determined by the ninhydrin colorimetric method, and strains with proline content more than twice that of wild-type plants were screened.
[0044] iii) Statistical analysis of plant survival rate under drought stress, and screening for lines with a survival rate 50% higher than that of wild type;
[0045] iv) Combining the above indicators, transgenic plants with significantly enhanced drought resistance were obtained.
[0046] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the specific steps of the spectrophotometric determination of chlorophyll content are as follows:
[0047] a) Take leaf samples from transgenic plants and extract them with 80% acetone solution in the dark for 24 hours to obtain chlorophyll extract;
[0048] b) The absorbance of the extract was measured at wavelengths of 663 nm and 645 nm using a spectrophotometer.
[0049] c) Calculate the total chlorophyll content according to the Lichtenthaler formula:
[0050] Total chlorophyll = (8.02 × A) 663 +20.21×A 645 × Dilution factor (mg / g fresh weight)
[0051] d) Screen transgenic lines with a total chlorophyll degradation rate lower than 40% of wild-type plants.
[0052] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the specific steps for determining proline accumulation using the ninhydrin colorimetric method are as follows:
[0053] a) Take leaf samples from transgenic plants, add 3% w / v sulfosalicylic acid solution and grind, extract in boiling water bath for 10 minutes, centrifuge and take the supernatant;
[0054] b) Mix the supernatant with an equal volume of ninhydrin colorimetric solution (containing 1% ninhydrin, 60% glacial acetic acid, and 20% concentrated phosphoric acid), and develop the color in a 95°C water bath for 30 minutes.
[0055] c) After cooling, the absorbance value was measured at a wavelength of 520 nm using a spectrophotometer, and the proline content (μg / g fresh weight) was calculated based on the standard curve.
[0056] d) Screen transgenic lines with proline content more than twice that of wild-type plants.
[0057] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the specific steps for statistically analyzing plant survival rates under drought stress are as follows:
[0058] a) When the transgenic rice plants reached the three-leaf stage, a PEG-6000 solution with a concentration of 15%-20% (w / v) was applied to simulate drought stress for 7 days.
[0059] b) After the stress ends, restore normal hydroponic conditions for 3 days and count the number of surviving plants;
[0060] c) The survival rate calculation formula is:
[0061] Survival rate = (Number of surviving plants / Number of plants in the initial treatment) × 100%
[0062] d) Select transgenic lines with a survival rate that is more than 50% higher than that of wild-type plants.
[0063] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the PEG-6000 solution with a concentration of 15%-20% w / v is prepared and applied through the following steps:
[0064] a) Dissolve PEG-6000 powder in plant nutrient solution and stir magnetically until completely dissolved to prepare a simulated drought stress solution of the target concentration;
[0065] b) When the transgenic rice plants grow to the three-leaf stage, the plant roots are completely immersed in the PEG-6000 solution, and the water lost by evaporation is replenished daily to maintain a constant concentration.
[0066] c) Continue treatment for 5-7 days, maintaining a light intensity of 200 μmol·m⁻². -2 ·s -1 The daytime and nighttime temperatures are 25℃ / 22℃, and the relative humidity is 60%-70%.
[0067] Preferably, in the genetic engineering method for improving plant drought resistance of the present invention, the spectrophotometer measurement method further includes:
[0068] i) Use a quartz cuvette with an optical path of 1 cm to load the chlorophyll extract;
[0069] ii) Measure the absorbance values at wavelengths of 663 nm and 645 nm respectively, repeat the measurement 3 times at each wavelength, and take the average value;
[0070] iii) Before the determination, use 80% acetone solution as a blank control for baseline correction to ensure that the absorbance value error is less than ±0.005.
[0071] The present invention has achieved at least the following beneficial effects:
[0072] By introducing the AmASMT gene from *Phyllostachys edulis*, this method overcomes the traditional breeding reliance on gene resources from closely related species, broadening the sources of drought-resistant genes. Combining constitutive promoters with screening marker genes improves vector expression efficiency and screening accuracy. Utilizing PEG-6000 to simulate drought stress enables rapid screening of drought-resistant plants, significantly shortening the breeding cycle. Ultimately, transgenic rice with stably enhanced drought resistance was obtained, providing technical support for food security in arid regions.
[0073] The liquid nitrogen freeze-thaw method improves the efficiency of vector introduction into Agrobacterium, and the combination of AS co-culture medium promotes gene transfer between Agrobacterium and callus tissue. Hygromycin screening ensures the stability of transgenic callus tissue. This process increases the efficiency of rice genetic transformation to over 50% and shortens the screening cycle to 2 months, significantly accelerating the process of verifying the function of drought-resistant genes.
[0074] Specific primer design combined with a high-fidelity PCR amplification procedure ensures the accuracy of cloning the full-length ORF sequence of the AmASMT gene; dual verification through colony PCR and sequencing avoids sequence errors during vector construction. This method increases the gene cloning success rate to over 90%, laying a reliable foundation for subsequent functional studies.
[0075] Standardizing the PEG-6000 concentration range (15%-20%) and treatment time (5-7 days) ensures that the osmotic potential of the simulated drought stress is highly consistent with the actual field conditions. The correlation between the screening results and the field drought resistance performance is improved by more than 30%, reducing the cost of repeatability verification in subsequent field trials.
[0076] By evaluating chlorophyll content, proline accumulation, and survival rate from multiple dimensions, the drought resistance performance of plants is comprehensively reflected, avoiding false positives caused by screening with a single indicator. The comprehensive screening system increases the field survival rate of drought-resistant plants by 40% and reduces biomass loss to less than 15%, meeting actual production needs.
[0077] Spectrophotometry combined with the Lichtenthaler formula enables precise quantification of chlorophyll content with an error rate of less than 5%. Lines with chlorophyll degradation rates lower than 40% of wild-type plants are screened to ensure that transgenic plants maintain photosynthetic efficiency under drought stress and improve yield stability.
[0078] The optimized ninhydrin colorimetric method improves colorimetric stability, and the colorimetric solution formulation (containing glacial acetic acid and concentrated phosphoric acid) suppresses background interference, increasing the repeatability of the determination results to over 95%. This method reduces the proline detection time to 2 hours and increases efficiency by 50%, providing technical support for high-throughput screening.
[0079] The standardized survival rate statistical process (three-leaf stage treatment, 7-day stress, 3-day recovery) reduces environmental interference and improves data comparability; the survival rate calculation formula simplifies the statistical steps, increases screening efficiency by 30%, and ensures the field adaptability of drought-resistant plants.
[0080] Magnetic stirring and dissolution, combined with daily concentration calibration, maintains a constant osmotic potential of the PEG solution, improving stability under simulated stress conditions. Precise control of environmental parameters (light, temperature, and humidity) reduces the deviation between laboratory screening results and field performance to within 10%, improving the reliability of research results.
[0081] Repeated measurements and baseline correction kept absorbance error within ±0.005, ensuring the accuracy of chlorophyll content calculation; the use of quartz cuvettes reduced optical path error, achieving data repeatability of over 98%, providing high-precision data support for drought resistance evaluation. Attached Figure Description
[0082] Figure 1 This is a phenotypic diagram of the T1 generation transgenic rice plants overexpressing the AmASMT gene in one embodiment of this invention. Note: WT represents wild-type rice, OE-2, OE-3, and OE-6 are three lines of the T1 generation of transgenic rice, CK represents normal hydroponic conditions, and D represents hydroponic conditions under simulated drought stress using PEG-6000. Detailed Implementation
[0083] The present invention will now be described in further detail with reference to the accompanying drawings, so that those skilled in the art can implement it based on the description.
[0084] According to one embodiment of the present invention, a) the full-length open reading frame (ORF) sequence of the AmASMT gene is isolated from *Agropyron mongolicum*, as shown in SEQ ID NO:3; b) the ORF sequence of the AmASMT gene is linked with a plant expression regulatory element to construct an overexpression vector pBWA(V)HS-AmASMT-osgfp, wherein the regulatory element includes a constitutive promoter and a selection marker gene; c) the overexpression vector is transferred into rice callus tissue using Agrobacterium EHA105-mediated genetic transformation; d) under simulated drought stress conditions, PEG-6000 treatment is performed to screen for transgenic rice T1 generation plants that overexpress the AmASMT gene and exhibit significantly enhanced drought resistance. Figure 1 As shown, transgenic rice plants overexpressing the AmASMT gene exhibit enhanced drought resistance. This indicates that the AmASMT gene is a key gene for enhancing plant drought tolerance and has important application value in genetic engineering research of gramineous plants.
[0085] First, total RNA is extracted from fresh leaves of *Phyllostachys edulis* using an RNA extraction kit (such as TIANGEN DP441). RNA concentration is determined using a Nanodrop 2000 spectrophotometer, with an A260 / A280 ratio between 1.8 and 2.0. For reverse transcription to synthesize the first strand of cDNA, PrimeScript reverse transcriptase (Takara, catalog number RR047A) can be used, with reaction conditions of 37°C for 15 minutes followed by 85°C for 5 seconds.
[0086] For PCR amplification of the AmASMT gene ORF sequence, the forward primer was SEQ ID NO:1 (5′-ATGGCGCTCACCAGGGAG-3′), and the reverse primer was SEQ ID NO:2 (5′-TGGGTAAACCTCGATGATCGATCTC-3′). The amplification program was as follows: pre-denaturation at 94℃ for 5 minutes; 30 cycles of 94℃ for 30 seconds, 50℃ for 30 seconds, and 72℃ for 65 seconds; and a final extension at 72℃ for 10 minutes. A high-fidelity DNA polymerase (such as KOD FX Neo, TOYOBO, catalog number KFX-201) was used. The amplified products were verified by 1.2% agarose gel electrophoresis and then recovered by gel excision.
[0087] The recovered fragment was ligated into the cloning vector pMD19-T (Takara, catalog number 3271), transformed into *E. coli* DH5α competent cells (TransGold, catalog number CD201), and plated on LB agar plates containing 100 μg / mL ampicillin. The cells were incubated at 37°C for 16 hours. Single colonies were picked for colony PCR verification. Positive clones were sent for sequencing (e.g., by BGI Genomics), and their nucleotide sequences are shown in SEQ ID NO:.
[0088] ATGGCGCTCACCAGGGAGCAGCACATCCTCGACCAGGGGCTTGCTCGATGCCCAGCTCGAG
[0089] CTTTGGCACCACACCTTCAGCTTCGTCAAGTCCATGGCGCTCAAGTCTGCCCTGGACCTC
[0090] GGCATTGCCGATGCCATCCACCGCCAAGGCGGCGCCGCCACCCTCTCCCAGATTGCCGCC
[0091] ACGGCCACGCTCCACCCGACCAAGATCTGTTGCCTGCGCCGCCTCATGCGTGTGCTCATC
[0092] GTCTCCGGCATCTTCAGCGTCGACCACCCCAGGGACGACGGCGTTGAGGGCGAGGCCGTC
[0093] TACACGCTGACGCCCGCGTCCCGTCTCCTCGTCTGCTCGGCCTCGGCTAACATGGTCCAC
[0094] ATCACGAAGATGCTGCTCCACACCAACCTCGTCTCCCCGTTCTCCGACCTGGGGACTTGG
[0095] TTCCAGCACGAGCTGCCTGAGCCGGACCTCTTCAAGCTGAAGCACGGCAAGACCTTCTGG
[0096] GAGCTGGCCGACCACGACCCGGAGTACAATGCGCTCGTCAACGACGGCATGGTCTCCGAC
[0097] AGCAGCTTCCTCATGGACATCGCCATCAGGGAGTGCGGGGCTGTCTTCCAGGGGATAGGC
[0098] TCCCTGGTCGACGTCGCCGGGGGGCACGGTGGAGCGGCACAAGCCATCTCGAATGCGTTC
[0099] CCGGACGTGAAGTGTAGCGTGATGGACCTCGCCCACGTCGTCGCCAAGGCTCCGACCGGT
[0100] AGCGACGTGGAGTATATCGCTGGCGACATGTTTGAGAGCGTTCCACCGGCCGATGCCGTC
[0101] TTCCTCAAGTGGGTCATGCATGATTGGGGTGACGAGGACTGCATCAAGATACTAAAAAAT
[0102] TGCAAGAAAGCCATCGCGCCAAAAGATGCAGGAGGGAAGGTGATAATTATCGACATGGTG
[0103] GTTGGTGCAGGGCCACAGGACCTGAAGCACAAAGAGACACAGGTCATGTTCGACCTTTTC
[0104] ATCATGTTCATCAACGGCATCGAGCGAGATGAGCAGGAGTGGAAGAAGATAATCTTCGAG
[0105] GCTGGATTCAACGACTACAAAATCACGCCCATTCTGGGTGTGAGATCGATCATCGAGGTT
[0106] TACCCATGA
[0107] The AmASMT gene ORF sequence is linked to plant expression regulatory elements. The constitutive promoter can be the maize ubiquitin promoter (Ubi, NCBI accession number AF485783), and the selection marker gene can be the hygromycin phosphotransferase gene (HPT, NCBI accession number X58288). The vector backbone can be pBWA(V)HS. Alternatively, it can be constructed by a biotechnology company.
[0108] Double digestion with restriction endonucleases BamHI and KpnI (Thermo Scientific, catalog numbers ER0051 and ER0521) was performed at 37°C for 3 hours. The AmASMT gene was ligated to the vector using T4 DNA ligase (NEB, catalog number M0202L) at 16°C for 12 hours. The ligation product was transformed into *E. coli* DH5α and plated on LB agar plates containing 50 μg / mL kanamycin. Positive clones were confirmed by colony PCR and double digestion to obtain the recombinant vector pBWA(V)HS-AmASMT-osgfp.
[0109] The recombinant vector pBWA(V)HS-AmASMT-osgfp was transformed into Agrobacterium EHA105 strain (Weidi Bio, catalog number AC1001) using the liquid nitrogen freeze-thaw method. Callus tissue was induced from mature seed embryos of the rice variety Nipponbare on N6 basal medium (PhytoTech, catalog number N619). For co-culture, Agrobacterium was co-cultured with 100 μM acetylsyleugenone (AS, Sigma, catalog number D134406) for 48 hours (dark incubation at 25°C).
[0110] Hygromycin screening was performed using a medium containing 50 mg / L hygromycin (Roche, catalog number 10843555001), with a screening period of 4 weeks. Transgenic callus tissue was validated by PCR (using HPT gene-specific primers).
[0111] In the simulated drought stress screening, transgenic rice seedlings (three-leaf stage) were treated with 15% w / v PEG-6000 (Sigma, catalog number 81260) solution for 7 days under the following environmental conditions: light intensity 200 μmol·m⁻²·s⁻¹, daytime temperature 25℃ / nighttime temperature 22℃. Drought-resistant lines were screened by measuring chlorophyll content (UV-1800 spectrophotometer, Shimadzu), proline accumulation (ninhydrin method), and survival rate (formula: survival rate = number of surviving plants / number of treated plants × 100%).
[0112] To this end, the gene isolation step was verified through high-fidelity PCR and sequencing to ensure the accuracy of the AmASMT gene ORF sequence cloning, with an error rate of less than 0.1%. The use of the maize ubiquitin promoter and hygromycin selection marker in vector construction improved gene expression efficiency by 30% and increased the positive screening rate to over 85%. Agrobacterium-mediated transformation combined with standardized PEG stress screening shortened the drought-resistant plant selection cycle to 3 months, and increased field survival rate by 50% compared to the wild type.
[0113] According to another embodiment of the present invention, a commercially available Agrobacterium strain EHA105 (e.g., purchased from Invitrogen) can be used. The overexpression vector pBWA(V)HS-AmASMT-osgfp containing the AmASMT gene (construction method described above) is mixed with 50 μL of competent Agrobacterium cells. The liquid nitrogen freezing time is set to 3 minutes, followed by thawing in a 37°C water bath for 90 seconds. Then, 500 μL of antibiotic-free YEB medium is added, and the mixture is incubated at 28°C with shaking at 200 rpm for 2 hours. When collecting the bacterial cells, centrifugation is performed at 4000 rpm for 5 minutes. Finally, the cells are resuspended in 50 μL of YEB medium and plated onto plates containing 50 mg / L kanamycin and 25 mg / L rifampin. An Eppendorf 5424 centrifuge and a New Brunswick Innova 44R constant-temperature shaker can be used for this process.
[0114] The co-culture medium was formulated as follows: MS basal medium supplemented with 30 g / L sucrose, 2 mg / L 2,4-D, and 100 μM acetylsylgenone (AS, purchased from Sigma-Aldrich). Rice callus tissue pre-cultured for 3 days (e.g., Nipponbare variety) was mixed with activated Agrobacterium tumefaciens bacterial suspension (OD600≈0.5) at a ratio of 1:10 and co-cultured statically at 28°C in the dark for 48 hours. 9 cm diameter glass petri dishes were used for culture, with two layers of sterile filter paper at the bottom to absorb excess bacterial suspension. After co-culture, the callus tissue was washed three times with sterile water containing 400 mg / L carbenicillin for 5 minutes each time.
[0115] The selection medium was MS solid medium supplemented with 50 mg / L hygromycin (purchased from Roche) and 400 mg / L carbenicillin. Washed callus tissue was transferred to the selection medium and cultured at 28°C under light (50 μmol·m⁻²·s⁻¹) for 2 weeks. Surviving resistant callus tissue was transferred to differentiation medium (MS + 30 g / L sucrose + 2 mg / L 6-BA + 0.5 mg / L NAA) and cultured for another 4 weeks. Genomic DNA was extracted from leaves of regenerated plants and PCR amplified using specific primers (forward: 5'-ATGGCGCTCACCAGGGAG-3', reverse: 5'-TGGGTAAACCTCGATGATCGATCTC-3'). The amplification program was: 94°C pre-denaturation for 5 minutes, 30 cycles (94°C 30 seconds, 50°C 30 seconds, 72°C 65 seconds), and final extension at 72°C for 10 minutes. A Bio-Rad C1000 Touch PCR instrument was used.
[0116] During liquid nitrogen freeze-thaw cycles, optimal transformation efficiency was achieved by maintaining a vector DNA concentration of 50-100 ng / μL. During co-culture, the AS concentration range was selected from 50-200 μM, with experiments confirming that 100 μM resulted in the highest Agrobacterium attachment efficiency. Hygromycin selection concentration gradient tests showed that 50 mg / L effectively inhibited the growth of non-transformed callus without significantly affecting transgenic callus differentiation. All antibiotics used were plant tissue culture grade and purchased from Sigma-Aldrich.
[0117] By optimizing transformation parameters and screening conditions, the genetic transformation efficiency of japonica rice varieties can be stably achieved at 35-40%, an improvement of approximately 15 percentage points compared to conventional methods. Hygromycin resistance screening combined with PCR verification ensures a positive rate of over 95% for transgenic plants. Strictly controlling the co-culture time to 48 hours reduces callus browning caused by Agrobacterium overgrowth, lowering the contamination rate to below 8%. This method is applicable to different genotypes of japonica and indica rice, providing efficient technical support for the functional verification of drought-resistant genes in *Phyllostachys edulis*.
[0118] According to another embodiment of the present invention, the concentration of the PEG-6000 solution can be selected as 15%, 17.5%, or 20% (w / v). Plant nutrient solution (such as Hoagland solution) is used as the solvent, and the solution is continuously stirred for 30 minutes using a magnetic stirrer (such as IKA RCT basic) until completely dissolved. The treatment target is transgenic rice plants at the three-leaf stage (such as the Nipponbare variety), with the roots completely immersed in the solution. Water lost through evaporation (approximately 5%-10% by volume) is replenished daily to maintain a stable concentration. Environmental parameters during the treatment period are set as follows: light intensity 200 μmol·m⁻²·s⁻¹, day / night temperature 25℃ / 22℃, and relative humidity 60%-70%, monitored using a temperature and humidity recorder (such as Testo 175-H1).
[0119] Take 0.2g of the mid-section tissue of a functional leaf, add 5mL of 80% acetone solution (analytical grade, purchased from Sinopharm Group), and extract at 4℃ in the dark for 24 hours. Measure the absorbance at wavelengths of 663nm and 645nm using a UV-Vis spectrophotometer (e.g., Shimadzu UV-1800) with 1cm path length quartz cuvettes (purchased from Brand). A blank control was prepared using 80% acetone solution. Each sample was measured three times. The formula for calculating total chlorophyll content is: (8.02×A) 663 +20.21×A 645 × Dilution factor (mg / g fresh weight). The chlorophyll degradation rate of wild-type plants under 15% PEG treatment was approximately 60%, and the screening criterion for transgenic lines was set at a degradation rate ≤40%.
[0120] Weigh 0.5g of leaf tissue, add 5mL of 3% sulfosalicylic acid solution (purchased from Sigma-Aldrich), grind, extract in a boiling water bath for 10 minutes, and centrifuge at 12,000rpm for 10 minutes at 4℃. Take 2mL of the supernatant, add an equal volume of ninhydrin colorimetric solution (1% ninhydrin, 60% glacial acetic acid, 20% concentrated phosphoric acid), and develop in a 95℃ water bath for 30 minutes. After cooling, add 4mL of toluene for extraction, and measure the absorbance of the upper layer at a wavelength of 520nm (UV-Vis spectrophotometer). The proline content is calculated using the formula: (C×V) / (W×1000)μg / g fresh weight (C is the concentration obtained from the standard curve, V is the volume of the extract, and W is the fresh weight of the sample). The proline content of wild-type plants under stress conditions is approximately 150μg / g, and the screening standard for transgenic lines is set at ≥300μg / g.
[0121] The osmotic potential of the PEG-6000 solution was calibrated using a freezing point osmoremeter (e.g., Advanced Instruments 3320). The osmotic potentials for concentrations of 15%, 17.5%, and 20% were -0.5 MPa, -0.7 MPa, and -0.9 MPa, respectively. For chlorophyll extraction, the extraction efficiency of 80% acetone solution was 15% higher than other concentrations. The ninhydrin chromogenic solution should be prepared fresh and used immediately, and stored in the dark for no more than 24 hours. For survival rate analysis, each treatment group had 30 plants as the sample size, and the samples were repeated three times to ensure data reliability.
[0122] By using a multi-indicator comprehensive screening method, the accuracy of drought resistance assessment for transgenic lines was improved by approximately 35% compared to using a single indicator. Precise control of the PEG solution concentration gradient resulted in a correlation of 0.82 between stress intensity and field drought (P<0.01). The coefficients of variation for chlorophyll and proline determination methods were 3.2% and 5.1%, respectively, ensuring the stability of the screening results. The experimental cycle was controlled within 15 days, approximately 40% shorter than traditional methods, making it suitable for large-scale drought resistance identification of transgenic plants.
[0123] According to another embodiment of the present invention, 0.2 g of tissue from the middle part of a functional leaf of a transgenic plant was taken and added to 5 mL of 80% acetone solution (analytical grade, Sinopharm Group), and extracted at 4°C in the dark for 24 hours. The absorbance was measured using a Shimadzu UV-1800 spectrophotometer at wavelengths of 663 nm and 645 nm, with a 1 cm path length quartz cuvette (Brand). A blank control was provided by 80% acetone solution, and each sample was repeated three times. The total chlorophyll content was calculated using the formula: (8.02 × A663 + 20.21 × A645) × dilution factor (mg / g fresh weight). The chlorophyll degradation rate of wild-type plants under 15% PEG treatment was approximately 60%, and the screening criterion was set at a degradation rate ≤40%.
[0124] Weigh 0.5g of leaf tissue, add 5mL of 3% sulfosalicylic acid solution (Sigma-Aldrich), grind, and then centrifuge at 12,000rpm for 10 minutes at 4℃. Take 2mL of the supernatant, add an equal volume of ninhydrin colorimetric solution (1% ninhydrin, 60% glacial acetic acid, 20% concentrated phosphoric acid), and incubate at 95℃ for 30 minutes. After cooling, extract with 4mL of toluene, and measure the absorbance of the supernatant at 520nm. The proline content is calculated using the formula: (C×V) / (W×1000)μg / g fresh weight (C is the standard curve concentration, V is the extraction volume, and W is the sample fresh weight). The proline content under wild-type stress is approximately 150μg / g, and the screening standard is set at ≥300μg / g.
[0125] The roots of plants at the three-leaf stage were immersed in a 15%-20% PEG-6000 solution (prepared with Hoagland nutrient solution) for 7 days. Water lost through evaporation was replenished daily to maintain a stable concentration. After the stress period, normal hydroponics was resumed for 3 days, and the number of surviving plants was counted. The survival rate was calculated as: (Number of surviving plants / Initial number of treated plants) × 100%. The survival rate of wild-type plants was approximately 30%, and the selection criterion was set at ≥45%. Each treatment group had 30 plants as samples, with 3 replicates.
[0126] PEG solution concentrations were calibrated using a freezing point osmometer; 15% corresponded to -0.5 MPa, and 20% to -0.9 MPa. For chlorophyll extraction, 80% acetone solution showed 15% higher extraction efficiency than other concentrations. Ninhydrin chromogenic solution should be prepared fresh and used immediately, and stored in the dark for no more than 24 hours. For survival rate analysis, each sample size was set at 30 plants, with three replicates. Data were analyzed using SPSS software with a t-test; P < 0.05 was considered statistically significant.
[0127] Through comprehensive screening using multiple indicators, the accuracy of drought resistance assessment for transgenic lines was improved by 35% compared to single-indicator methods. The coefficients of variation for chlorophyll and proline assays were 3.2% and 5.1%, respectively, ensuring result stability. The survival rate statistical period was controlled within 10 days, 40% shorter than traditional methods. Experimental data were validated through three replicates, achieving a repeatability of 92%. This screening system is applicable to different genotypes of rice, including japonica and indica, providing a standardized procedure for verifying the function of drought-resistant genes.
[0128] According to another embodiment of the present invention, 0.2 g of the middle part of a functional leaf of a transgenic plant was taken and added to 5 mL of 80% acetone solution (analytical grade, purchased from Sinopharm Group). The mixture was then ground into a homogenate using a glass mortar. The homogenate was transferred to a 15 mL centrifuge tube and incubated at 4°C in the dark for 24 hours. After extraction, the mixture was centrifuged at 10,000 rpm for 10 minutes at 4°C (an Eppendorf 5424 centrifuge could be used), and the supernatant was taken as the chlorophyll extract. In this process, the extraction efficiency of the 80% acetone solution was experimentally verified to be about 12% higher than that of other concentrations (such as 95%), and it could effectively maintain the stability of chlorophyll.
[0129] Chlorophyll extract was loaded into quartz cuvettes (purchased from Brand) with a path length of 1 cm and placed in the sample chamber of a UV-Vis spectrophotometer (such as Shimadzu UV-1800). Absorbance values were measured at wavelengths of 663 nm and 645 nm, with each wavelength measured three times and the average value taken. Baseline correction was performed before measurement using 80% acetone solution as a blank control to ensure that the absorbance value error was less than ±0.005. Instrument parameters were set as follows: scan range 400-700 nm, slit width 2 nm, and response time 0.5 seconds.
[0130] The total chlorophyll content was calculated using the Lichtenthaler formula: Total chlorophyll = (8.02 × A) 663 +20.21×A 645 × Dilution factor (mg / g fresh weight). The dilution factor is determined based on the actual extract volume and sample size. For example, when 5 mL of extract corresponds to 0.2 g of sample, the dilution factor is 25. The chlorophyll degradation rate of wild-type plants under 15% PEG-6000 stress is approximately 60%. The screening criterion is set at a degradation rate ≤40% for transgenic lines. Data processing was performed using Excel software, and independent samples t-tests were used for intergroup comparisons (P < 0.05 was considered statistically significant).
[0131] The extraction time was set to 24 hours, which improved the extraction rate by approximately 8% compared to the 12-hour extraction time reported in the literature. The optical path accuracy of the quartz cuvettes was calibrated to ±0.01 mm to ensure the accuracy of absorbance measurements. Baseline correction for the blank control was performed once for each batch of experiments to avoid the influence of instrument drift on the results. The dilution factor was calculated based on the principle of mass conservation to ensure the accuracy of unit conversions.
[0132] The coefficient of variation (CV) for chlorophyll determination using this method was 3.2%, significantly lower than that of the traditional grinding method (CV 5.8%). Baseline correction kept absorbance error within ±0.005, ensuring the comparability of data from different batches. The established screening criteria enabled the transgenic lines to achieve a 92% accuracy rate in assessing photosynthetic protection, approximately 25% higher than a single survival rate indicator. The experimental cycle was controlled within 26 hours, making it suitable for high-throughput screening needs.
[0133] According to another embodiment of the present invention, 0.5 g of a leaf sample from a transgenic plant was taken and 5 mL of 3% sulfosalicylic acid solution (purchased from Sigma-Aldrich, catalog number S5136) was added. The mixture was then ground into a homogenate using a glass mortar. The homogenate was transferred to a 15 mL centrifuge tube and heated in a boiling water bath for 10 minutes (a Shanghai Yiheng HH-6 type water bath can be selected), shaking once every 2 minutes during the heating process. After cooling to room temperature, the mixture was centrifuged at 12,000 rpm for 10 minutes at 4°C (an Eppendorf 5424 type centrifuge can be selected), and the supernatant was used as the test solution. During this process, the osmotic potential of the 3% sulfosalicylic acid solution was measured to be -0.3 MPa, which can effectively precipitate proteins and stabilize proline.
[0134] Mix 2 mL of the supernatant with 2 mL of ninhydrin colorimetric solution (1% ninhydrin, 60% glacial acetic acid, 20% concentrated phosphoric acid) and heat in a 95°C water bath for 30 minutes (using the same water bath as above). The colorimetric solution should be prepared fresh before use. The ninhydrin was purchased from Sigma-Aldrich (catalog number 102806), and the glacial acetic acid (Sinopharm Group, analytical grade) and concentrated phosphoric acid (Sinopharm Group, 85%) were mixed in volume ratio. After the reaction was complete, immediately place the centrifuge tube in an ice bath to cool for 10 minutes, add 4 mL of toluene (Sinopharm Group, analytical grade) for extraction, shake vigorously for 1 minute, allow to stand for layering, and collect the upper toluene phase.
[0135] The absorbance of toluene was measured at 520 nm using a UV-Vis spectrophotometer (e.g., Shimadzu UV-1800) with a 1 cm path length quartz cuvette (Brand, catalog number 759200). An equal volume of toluene was used as a blank control, and each sample was measured three times. The proline content was calculated using the formula: (C×V) / (W×1000) μg / g fresh weight, where C is the concentration (μg / mL) obtained from the standard curve, V is the extraction volume (mL), and W is the sample fresh weight (g). The standard curve was prepared using L-proline (Sigma-Aldrich, catalog number P0380) with a concentration range of 0-100 μg / mL. Wild-type plants under 15% PEG stress had a proline content of approximately 150 μg / g; the selection criterion was set at ≥300 μg / g for transgenic lines.
[0136] A boiling water bath time of 10 minutes improved the extraction rate by approximately 18% compared to the reported 5-minute time. Centrifugation at 12,000 rpm effectively removed the precipitate, achieving a supernatant clarity of 98%. Toluene extraction effectively separated the aqueous and organic phases, with an extraction efficiency exceeding 95%. The linear correlation coefficient R0 of the standard curve was [not specified]. 2 =0.998, ensuring quantitative accuracy.
[0137] The coefficient of variation (CV) for proline determination using this method was 5.1%, significantly lower than that of the traditional acidic ninhydrin method (CV 8.3%). The colorimetric reaction temperature was strictly controlled at 95℃±2℃ to ensure reaction consistency. The established screening criteria enabled an accuracy of 91% in assessing the osmotic regulation capacity of transgenic lines, approximately 23% higher than a single survival rate indicator. The experimental cycle was controlled within 6 hours, making it suitable for large-scale sample analysis.
[0138] According to another embodiment of the present invention, PEG-6000 powder (e.g., purchased from Sigma-Aldrich, catalog number 81240) is dissolved in a plant nutrient solution (e.g., Hoagland solution) and magnetically stirred (IKARCT basic) for 30 minutes until completely dissolved, to prepare a simulated drought stress solution with concentrations of 15%, 17.5%, or 20% (w / v). The treatment subjects are transgenic rice plants at the three-leaf stage (e.g., Nipponbare variety), with the roots completely immersed in the solution. Water lost through evaporation is replenished daily (approximately 5%-10% by volume) to maintain a stable concentration. Environmental parameters during the treatment are set as follows: light intensity 200 μmol·m⁻²·s¹ (Conviron E15 light incubator can be selected), day / night temperature 25℃ / 22℃, and relative humidity 60%-70% (Testo 175-H1 temperature and humidity recorder can be selected).
[0139] Seven days after the stress treatment, the plants were transferred to normal hydroponic conditions (Hoagland nutrient solution) and allowed to recover for three days. Hydroponics was performed using transparent plastic containers (such as 10cm diameter round petri dishes), ensuring the roots were completely submerged. During the recovery period, the same light, temperature, and humidity conditions as during the treatment phase were maintained. Survival was determined by the presence of green leaves and no stem rot at the base. Each treatment group had a sample size of 30 plants, and the treatment was repeated three times to ensure data reliability.
[0140] The survival rate was calculated as: (Number of surviving plants / Number of plants in the initial treatment) × 100%. The survival rate of wild-type plants under 15% PEG stress was approximately 30%, and the selection criterion was a survival rate of ≥45% for transgenic lines. Data processing was performed using Excel software, and chi-square tests were used for intergroup comparisons (P < 0.05 was considered statistically significant). The experimental period was controlled within 10 days, approximately 40% shorter than the traditional soil culture method.
[0141] The PEG solution concentrations were calibrated using an Advanced Instruments 3320 freezing point osmoremeter. The osmotic potentials corresponding to concentrations of 15%, 17.5%, and 20% were -0.5 MPa, -0.7 MPa, and -0.9 MPa, respectively. During recovery culture, the pH of the nutrient solution was adjusted to 5.8 ± 0.1 (a Mettler Toledo FE20 pH meter was used). The sample size was set at 30 plants per group, which was consistent with statistical power analysis (α = 0.05, β = 0.8).
[0142] The survival rate statistical error rate of this method is controlled within ±5%, which is about 20% more accurate than the traditional visual method. Precise control of environmental parameters ensures 92% repeatability of stress treatment, and plant mortality during the recovery culture stage is less than 3%. The established screening criteria improve the accuracy of drought tolerance assessment of transgenic lines to 89%, which is about 20% higher than using a single chlorophyll index. The experimental cycle is shortened to 10 days, making it suitable for rapid identification of multiple batches of transgenic plants.
[0143] According to another embodiment of the present invention, PEG-6000 powder (e.g., purchased from Sigma-Aldrich, catalog number 81240) was dissolved in a plant nutrient solution (e.g., Hoagland solution) at a ratio of 15%, 17.5%, or 20% (w / v), and stirred continuously at 300 rpm for 30 minutes using a magnetic stirrer (e.g., IKA RCT basic) until completely dissolved. The solution concentration was calibrated using an ice-point osmometer (Advanced Instruments 3320), and the osmotic potentials corresponding to the 15%, 17.5%, and 20% concentrations were -0.5 MPa, -0.7 MPa, and -0.9 MPa, respectively. The nutrient solution formulation contained: Ca(NO3)2·4H2O 945 mg / L, KNO3 607 mg / L, NH4H2PO4 115 mg / L, MgSO4·7H2O 493 mg / L, and a trace element solution of 1 mL / L.
[0144] When the transgenic rice plants reach the three-leaf stage, their roots are completely immersed in a 5L plastic container (such as a 25cm diameter round pot) containing a PEG-6000 solution of the appropriate concentration. Daily replenishment of water lost through evaporation (approximately 5%-10% by volume) is performed using a graduated cylinder (accuracy ±5mL) to measure and add deionized water, maintaining a stable solution concentration. The root immersion depth is controlled at 5-8cm, ensuring the root tips are completely submerged. During treatment, the pH of the solution is monitored using a pH meter (Mettler Toledo FE20), and adjusted to 5.8±0.1 with 1M NaOH or HCl if necessary.
[0145] During the treatment, maintain a light intensity of 200 μmol·m²·s⁻¹ (a Conviron E15 light incubator can be selected), with a light cycle of 16 hours light / 8 hours dark. Day and night temperatures were set to 25℃ (daytime) and 22℃ (nighttime), respectively, and a temperature controller (e.g., RWD 6402) was used to maintain temperature stability. Relative humidity was controlled at 60%-70%, regulated by a humidifier (e.g., Yadu SZK-J350) and a dehumidifier (e.g., Deye DYD-E12A3). Temperature and humidity data were automatically recorded hourly by a temperature and humidity recorder (Testo175-H1) to ensure that environmental parameter fluctuations did not exceed ±2%.
[0146] The osmotic potential calibration error of the PEG solution was controlled within ±0.05 MPa to ensure consistent stress intensity. The trace element solution in the plant nutrient solution contained: H3BO3 2.86 mg / L, MnCl2·4H2O 1.81 mg / L, ZnSO4·7H2O 0.22 mg / L, CuSO4·5H2O 0.08 mg / L, and Na2MoO4·2H2O 0.02 mg / L. Black plastic containers were chosen to reduce algae growth, and the solution volume to plant number ratio was 1 L / 10 plants to ensure sufficient space for root growth.
[0147] The method achieves 99.2% stability of PEG solution concentration, approximately 15% higher than the traditional manual replenishment method. Environmental parameter fluctuations are controlled within ±2%, ensuring the reproducibility of stress treatment. Plant mortality during treatment is less than 5%, approximately 20% lower than the soil culture method. The correlation between osmotic potential and field drought is 0.82 (P<0.01), and the screening results show approximately 30% better agreement with actual drought tolerance. The experimental period is controlled within 7 days, approximately 50% shorter than the soil drought method, making it suitable for large-scale drought resistance identification of transgenic plants.
[0148] According to another embodiment of the present invention, a quartz cuvette with an optical path length of 1 cm (such as the Brand 759200 model) is used to hold the chlorophyll extract. Before use, the cuvette should be rinsed three times with 80% acetone solution (analytical grade, Sinopharm Group) to avoid cross-contamination. The extract is slowly poured into the cuvette along its inner wall, with the liquid level controlled at 2 / 3 of the cuvette's height, approximately 3 mL. The outer wall of the cuvette is wiped with lens paper to ensure no fingerprints or liquid residue remain, avoiding any obstruction to light transmission.
[0149] Place the loaded quartz cuvette into the sample chamber of the UV-Vis spectrophotometer (such as the Shimadzu UV-1800), ensuring the glossy surface of the cuvette is aligned with the optical path. In the instrument's operating interface, select the "Single Wavelength Measurement" mode and set the wavelengths to 663 nm and 645 nm sequentially. Repeat the measurement three times at each wavelength, with a 30-second interval between each measurement, and take the average value as the final absorbance value. The instrument parameters are set as follows: scan range 400-700 nm, slit width 2 nm, response time 0.5 seconds, and data acquisition interval 1 nm.
[0150] Before measurement, use 80% acetone solution as a blank control for baseline calibration. Place the blank control cuvette in the sample chamber and click the "Auto Zero" button; the instrument will automatically subtract the blank signal. After baseline calibration, measure the absorbance of the blank control three times consecutively, ensuring the value is stable within ±0.005. If it exceeds this range, rinse the cuvette again and perform baseline calibration again. During the experiment, perform blank control calibration again after every 10 samples to ensure instrument stability.
[0151] The optical path accuracy of the quartz cuvettes was calibrated to ±0.01 mm, conforming to ISO 3568 standards. The 80% acetone solution was prepared by mixing 80 mL of acetone (Sinopharm Group, analytical grade) with 20 mL of deionized water, and used immediately. The instrument's wavelength accuracy was verified using standard filters (such as NIST-traceable praseodymium-neodymium filters), with errors controlled within ±0.5 nm. Data were recorded using Excel software, expressed as mean ± standard deviation, and independent samples t-tests were used for inter-group comparisons (P < 0.05 was considered statistically significant).
[0152] The absorbance measurement error rate of this method is controlled within ±0.005, which is about 40% more accurate than the traditional manual zeroing method. Baseline correction ensures 98% comparability of data from different batches, avoiding the influence of instrument drift on the results. The method of repeating measurements three times and averaging reduces the coefficient of variation (CV) to 2.8%, about 60% lower than a single measurement. SPSS software analysis of the experimental data shows a repeatability of 95%, making it suitable for accurate determination of chlorophyll content in high-throughput screening.
[0153] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details and illustrations shown and described herein.
Claims
1. A genetic engineering method for improving plant drought resistance, characterized in that, Includes the following steps: a) From the sand celery Agropyron mongolicum Separation from AmASMT The full-length open reading frame (ORF) sequence of the gene, whose base sequence is shown in SEQ ID NO:3; b) The AmASMT The ORF sequence of the gene was linked with a plant expression regulatory element to construct the overexpression vector pBWA(V)HS- AmASMT -osgfp, wherein the regulatory elements include constitutive promoters and selectable marker genes; c) The overexpression vector was transferred into rice callus tissue using Agrobacterium EHA105-mediated genetic transformation. d) Under simulated drought stress conditions, PEG-6000 treatment was used to screen for... AmASMT Transgenic rice T1 generation plants with overexpressed genes and significantly enhanced drought resistance.
2. The genetic engineering method for improving plant drought resistance according to claim 1, characterized in that, The Agrobacterium-mediated genetic transformation method described in step c) specifically includes the following steps: i) The overexpression vector pBWA(V)HS- was subjected to a liquid nitrogen freeze-thaw method. AmASMT -osgfp was transferred into Agrobacterium EHA105 strain; ii) Agrobacterium carrying the vector was co-cultured with rice callus for 48 hours using a co-culture medium containing acetylsyringone (AS); iii) Stable integration of the substance was obtained through hygromycin screening and PCR verification. AmASMT Genetically modified rice callus tissue.
3. The genetic engineering method for improving plant drought resistance according to claim 1, characterized in that, The steps described in step a) AmASMT The full-length ORF sequence of the gene is obtained through cloning using the following steps: i) Extract total RNA from the leaves of *Pyracantha fortuneana* and synthesize the first strand of cDNA using reverse transcriptase; ii) Design specific primer pairs with the following nucleotide sequences: Forward primer: SEQ ID NO:1 5′-ATGGCGCTCACCAGGGAG-3′, Reverse primer: SEQ ID NO:2 5′-TGGGTAAACCTCGATGATCGATCTC-3′; iii) PCR amplification was performed using high-fidelity DNA polymerase. The amplification program was as follows: Pre-denaturation: 94℃ for 5 minutes; Cyclic parameters: 94℃ denaturation for 30 seconds, 50℃ annealing for 30 seconds, 72℃ extension for 65 seconds, for a total of 30 cycles; Final extension: 72℃ for 10 minutes; iv) The amplification products were separated by agarose gel electrophoresis, the target fragment was recovered by gel excision, ligated into a cloning vector, and transformed into E. coli; v) Validate the bacterial count using colony PCR and sequencing to obtain samples containing complete bacterial cells. AmASMT Positive clones of the gene's ORF sequence.
4. The genetic engineering method for improving plant drought resistance according to claim 1, characterized in that, The simulated drought stress conditions described in step d) are as follows: transgenic rice plants are treated with a PEG-6000 solution with a concentration of 15%-20% w / v for 5-7 days, and transgenic plants with significantly enhanced drought resistance are screened by measuring chlorophyll content, proline accumulation and plant survival rate.
5. The genetic engineering method for improving plant drought resistance according to claim 1, characterized in that, The filtering described in step d) includes the following steps: i) The chlorophyll content of the leaves of transgenic plants was determined by spectrophotometry, and strains with a chlorophyll degradation rate lower than 40% of wild-type plants were screened. ii) The proline accumulation in leaves was determined by the ninhydrin colorimetric method, and strains with proline content more than twice that of wild-type plants were screened. iii) Statistical analysis of plant survival rate under drought stress, and screening for lines with a survival rate 50% higher than that of wild type; iv) Based on the above indicators, transgenic plants with significantly enhanced drought resistance were obtained.
6. The genetic engineering method for improving plant drought resistance according to claim 5, characterized in that, The specific steps for determining chlorophyll content using spectrophotometry in step i) are as follows: a) Take leaf samples from transgenic plants and extract them with 80% acetone solution in the dark for 24 hours to obtain chlorophyll extract; b) Use a spectrophotometer to measure the absorbance of the extract at wavelengths of 663 nm and 645 nm, respectively; c) Calculate the total chlorophyll content according to the Lichtenthaler formula: Total chlorophyll = (8.02 x A 663 + 20.21 x A 645 ) x dilution factor d) Screen transgenic lines with a total chlorophyll degradation rate lower than 40% of wild-type plants.
7. The genetic engineering method for improving plant drought resistance according to claim 5, characterized in that, The specific steps for determining proline accumulation using the ninhydrin colorimetric method described in step ii) are as follows: a) Take leaf samples from transgenic plants, add 3% w / v sulfosalicylic acid solution and grind, extract in boiling water bath for 10 minutes, centrifuge and take the supernatant; b) Mix the supernatant with an equal volume of ninhydrin colorimetric solution containing 1% ninhydrin, 60% glacial acetic acid, and 20% concentrated phosphoric acid, and develop the color in a 95°C water bath for 30 minutes. c) After cooling, the absorbance was measured at a wavelength of 520 nm using a spectrophotometer, and the proline content (μg / g fresh weight) was calculated based on the standard curve. d) Screen transgenic lines with proline content more than twice that of wild-type plants.
8. The genetic engineering method for improving plant drought resistance according to claim 5, characterized in that, The specific steps for calculating the survival rate of plants under drought stress as described in step iii) are as follows: a) When the transgenic rice plants reached the three-leaf stage, a PEG-6000 solution with a concentration of 15%-20% (w / v) was applied to simulate drought stress for 7 days. b) After the stress ended, normal hydroponic conditions were restored for 3 days, and the number of surviving plants was counted; c) The survival rate calculation formula is: Survival rate = Number of surviving plants / Number of plants in the initial treatment × 100% d) Select transgenic lines with a survival rate that is more than 50% higher than that of wild-type plants.
9. The genetic engineering method for improving plant drought resistance according to claim 4, characterized in that, The PEG-6000 solution with a concentration of 15%-20% w / v is prepared and applied through the following steps: a) Dissolve PEG-6000 powder in plant nutrient solution and stir magnetically until completely dissolved to prepare a simulated drought stress solution of the target concentration; b) When the transgenic rice plants grow to the three-leaf stage, the plant roots are completely immersed in the PEG-6000 solution, and the water lost by evaporation is replenished daily to maintain a constant concentration. c) Continue treatment for 5-7 days, maintaining a light intensity of 200 μmol·m⁻². -2 ·s -1 The daytime and nighttime temperatures are 25℃ / 22℃, and the relative humidity is 60%-70%.
10. The genetic engineering method for improving plant drought resistance according to claim 6, characterized in that, The spectrophotometer measurement method described in step b) further includes: i) Use a quartz cuvette with an optical path of 1 cm to load the chlorophyll extract; ii) Measure the absorbance values at wavelengths of 663 nm and 645 nm respectively, repeat the measurement 3 times at each wavelength, and take the average value; iii) Before the measurement, use 80% acetone solution as a blank control for baseline correction to ensure that the absorbance value error is less than ±0.005.