A subunit vaccine for Haemonchus contortus

Abstract

The present invention discloses a subunit vaccine for Haemonchus contortus, which belongs to the field of veterinary vaccines. The subunit vaccine of the present invention comprises galactosylation-modified antigenic proteins MEP3, antigenic protein AP1, antigenic protein AP8, antigenic protein H11‑2, antigenic protein H11‑4, and antigenic protein AP5 of Haemonchus contortus, and the galactosylation modification of the antigenic proteins is achieved by expressing the glycosyltransferase HcGALT of Haemonchus contortus together with one or more of the above proteins in eukaryotic cells. The galactosylation-modified antigenic proteins in the subunit vaccine of the present invention are closer to the glycosylation modification of natural proteins, which can provide effective immune protection after goats are infected with Haemonchus contortus, and the egg-laying rate is reduced by 81.43%. The present invention lays a foundation for the development of subunit vaccines for Haemonchus contortus, provides an effective technical means for the prevention and treatment of the disease, and has important application value and promotion prospects.

Description

Technical Field

[0001] The present invention belongs to the field of veterinary vaccines, and in particular relates to a subunit vaccine of Haemonchus contortus. Background Art

[0002] Haemonchus contortus is a disease caused by the nematode Haemonchus contortus of the genus Haemonchus in the family Trichoderma. Haemonchus contortus Haemonchus contortus (H. contortus) is a blood-sucking parasitic nematode that infects the abomasum of ruminants such as sheep and cattle. It is one of the most important parasitic diseases of small ruminants. Clinical symptoms primarily include emaciation, weakness, and anemia, and in severe cases, death can occur in infected animals. The disease is highly pathogenic and widespread, endemic in temperate, subtropical, and tropical regions. Prevalence of Haemonchus contortus has been reported in nearly all provinces in my country, causing significant economic losses to the ruminant industry and severely hindering the development of my country's cattle and sheep industries.

[0003] Currently, the prevention and control of Haemonchus contortus disease still relies primarily on chemical drugs. Frequently used anti-helminthic drugs include benzimidazoles (such as albendazole), imidazothiazoles (such as levamisole), macrolides (such as ivermectin and avermectin), and aminoacetylcyanide derivatives. However, irrational drug use has led to a serious global problem of drug resistance in Haemonchus contortus. The only commercially available vaccine for Haemonchus contortus is Barbervax®, which consists of natural H11 and H-gal-GP proteins derived from the worm's intestine. However, since the worm cannot be cultured in vitro and must be obtained from infected animals, the yield of the natural protein antigens is low, making large-scale production difficult to meet control needs. However, various forms of recombinant proteins failed to achieve good protective effects after immunization. When four subtypes of natural H11 (H11, H11-1, H11-2, and H11-4) were recombinantly expressed in Hi5 insect cells and mixed with goats, the protective effect in terms of egg reduction rate was 66.29%, with no significant difference (Liu et al., 2025). When the components MEP1, MEP3, and MEP4 of H-gal-GP were recombinantly expressed in Sf9 insect cells and another component PEP1 was expressed in Escherichia coli, the protective effect in terms of egg reduction rate was 2.5% after mixed immunization in goats (Cachat, Newlands, Ekoja, McAllister, & Smith, 2010). Other recombinant proteins also failed to induce good immune protection in goats (Roberts et al., 2013; Smith, Newlands, Smith, Pettit, & Skuce, 2003; Smith, Skuce, Newlands, Smith, & Pettit, 2003).

[0004] References:

[0005] Cachat, E., Newlands, G. F. J., Ekoja, S. E., McAllister, H., &Smith, W. D. (2010). Attempts to immunize sheep against Haemonchus contortususing a cocktail of recombinant proteases derived from the protectiveantigen, H-gal-GP. PARASITE IMMUNOLOGY, 32(6), 414 - 419.

[0006] Liu, H., Zhang, Y., Li, J., Liu, F., Ye, L., Liu, X.,... Hu, M.(2025). Identification and validation of protective glycoproteins inHaemonchus contortus H11. FRONTIERS IN IMMUNOLOGY, 16, 1521022.

[0007] Roberts, B., Antonopoulos, A., Haslam, S. M., Dicker, A. J.,McNeilly, T. N., Johnston, S. L.,... Britton, C. (2013). Novel expressionof Haemonchus contortus vaccine candidate aminopeptidase H11 using the free-living nematode Caenorhabditis elegans. VETERINARY RESEARCH, 44.

[0008] Smith, WD, Newlands, GFJ, Smith, SK, Pettit, D., & Skuce,PJ (2003). Metalloendopeptidases from the intestinal brush border of Haemonchus contortus as protective antigens for sheep. PARASITE IMMUNOLOGY, 25(6), 313-323.

[0009] Smith, WD, Skuce, PJ, Newlands, GFJ, Smith, SK, &Pettit, D. (2003). Aspartyl proteases from the intestinal brush border of Haemonchus contortus as protective antigens for sheep. PARASITE IMMUNOLOGY, 25(11-12), 521-530. Summary of the Invention

[0010] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art, provide a combination of Haemonchus contortus antigens and their use in the preparation of Haemonchus contortus subunit vaccines, and aim to solve the problems raised in the above-mentioned background technology.

[0011] The purpose of the present invention is achieved through the following technical solutions:

[0012] A combination of Haemonchus contortus antigenic proteins comprises galactosylation-modified Haemonchus contortus antigenic proteins MEP3, AP1, AP8, H11-2, H11-4, and AP5. Galactosylation is preferably achieved by co-expressing the Haemonchus contortus glycosyltransferase HcGALT with one or more of the aforementioned proteins in eukaryotic cells. Such eukaryotic cells include mammalian cells, insect cells, and plant cells. Mammalian cells include human embryonic blastocyst (HEK) 293 cells and Chinese hamster ovary (CHO) cells, while insect cells include Sf9 cells, Hi5 cells, and Sf21 cells. The amino acid sequence of the glycosyltransferase HcGALT is shown in SEQ ID NO.1, the amino acid sequence of the antigen protein MEP3 is shown in SEQ ID NO.2, the amino acid sequence of the antigen protein AP1 is shown in SEQ ID NO.3, the amino acid sequence of the antigen protein AP8 is shown in SEQ ID NO.4, the amino acid sequence of the antigen protein H11-2 is shown in SEQ ID NO.5, the amino acid sequence of the antigen protein H11-4 is shown in SEQ ID NO.6, and the amino acid sequence of the antigen protein AP5 is shown in SEQ ID NO.7.

[0013] The method for preparing the Haemonchus contortus antigen protein combination comprises the following steps: constructing a nucleotide sequence encoding the glycosyltransferase HcGALT and a nucleotide sequence encoding the antigen protein into the same eukaryotic expression vector or two eukaryotic expression vectors, transfecting the constructed eukaryotic expression vector into eukaryotic cells, culturing the cells to express the glycosyltransferase HcGALT and the antigen protein, galactosylating the antigen protein, and purifying the galactosylated antigen protein. Preferably, the N-terminus of the glycosyltransferase HcGALT or the antigen protein is connected to a signal peptide, and the N-terminus or C-terminus of the antigen protein is connected to a tag to facilitate purification of the antigen protein; further preferably, the N-terminus of the antigen protein is connected to a signal peptide and a tag.

[0014] Preferably, the preparation method of the Haemonchus contortus antigen protein combination comprises the following steps: constructing the optimized and modified nucleotide sequence encoding glycosyltransferase HcGALT into pFastBacDual to obtain the recombinant plasmid pFastBacDual-Hcgalt, constructing the optimized and modified nucleotide sequence encoding the antigen protein into pFastBacDual-Hcgalt to obtain the recombinant plasmid pFastBacDual-Hcgalt-MEP3 or pFastBacDual-Hcgalt-AP1 or pFastBacDual-Hcgalt-AP8 or pFastBacDual-Hcgalt-H11-2 or pFastBacDual-Hcgalt-H11-4 or pFastBacDual-Hcgalt-AP5, and obtaining the recombinant bacmid rbacmid-Hcgalt-MEP3 or rbacmid-Hcgalt-AP1 or rba cmid-Hcgalt-AP8 or rbacmid-Hcgalt-H11-2 or rbacmid-Hcgalt-H11-4 or rbacmid-Hcgalt-AP5 were transfected into Sf9 cells and packaged to obtain recombinant baculovirus rBV-Hcgalt-MEP3 or rBV-Hcgalt-AP1 or rBV-Hcgalt-AP8 or rBV-Hcgalt-H11-2 or rBV-Hcgalt-H11-4 4 or rBV-Hcgalt-AP5, the recombinant baculovirus rBV-Hcgalt-MEP3 or rBV-Hcgalt-AP1 or rBV-Hcgalt-AP8 or rBV-Hcgalt-H11-2 or rBV-Hcgalt-H11-4 or rBV-Hcgalt-AP5 was used to infect Hi5 cells to express the target protein, and the galactosylated MEP3 or AP1 or AP8 or H11-2 or H11-4 or AP5 was purified.

[0015] In the preparation method of the above-mentioned Haemonchus contortus antigen protein combination, the optimized and modified nucleotide sequence encoding glycosyltransferase HcGALT is shown as SEQ ID NO.8, the optimized and modified nucleotide sequence encoding antigen protein MEP3 is shown as SEQ ID NO.9, the optimized and modified nucleotide sequence encoding antigen protein AP1 is shown as SEQ ID NO.10, the optimized and modified nucleotide sequence encoding antigen protein AP8 is shown as SEQ ID NO.11, the optimized and modified nucleotide sequence encoding antigen protein H11-2 is shown as SEQ ID NO.12, the optimized and modified nucleotide sequence encoding antigen protein H11-4 is shown as SEQ ID NO.13, and the optimized and modified nucleotide sequence encoding antigen protein AP5 is shown as SEQ ID NO.14.

[0016] In the above-mentioned preparation method of the Haemonchus contortus antigen protein combination, the N-terminus of the glycosyltransferase HcGALT or the antigen protein can also be connected to a Kozak sequence, a signal peptide sequence, and a tag sequence. The signal peptide sequence is preferably MKTIIALSYIFCLVFAAG (SEQ ID NO.15), and the tag is preferably one or two of a Flag tag and a 10×His tag. The signal peptide, tag, and antigen protein are preferably connected by a flexible linker (preferably GS).

[0017] In the above-mentioned preparation method of the contorted Haemonchus contortus antigen protein combination, the antigen proteins MEP3, AP1, AP8, H11-2, H11-4, and AP5 are all obtained through eukaryotic expression, the expression host is the Hi-5 insect cell line, the expression vector is the pFastBacDual vector, the antigen protein and the galactosyltransferase HcGALT are expressed in tandem, and during protein purification, the galactosylation-modified antigen protein is purified through the tag, and the galactosyltransferase is not retained.

[0018] Application of the above-mentioned Haemonchus contortus antigen protein combination in the preparation of Haemonchus contortus vaccine.

[0019] A subunit vaccine of Haemonchus contortus comprises the above-mentioned Haemonchus contortus antigen combination and an adjuvant, wherein the adjuvant is preferably a saponin adjuvant.

[0020] The present invention has the following advantages and effects compared to the prior art:

[0021] (1) The subunit vaccine prepared from the antigen protein combination of the present invention can provide effective immune protection to goats after infection with Haemonchus contortus, reducing the egg-laying rate by 81.43%, which is the best effect among the recombinant proteins reported so far.

[0022] (2) The current commercial vaccine for Haemonchus contortus, Barbervax®, is derived from the natural intestine of the worm. However, since the worm cannot be cultured in vitro, the yield of natural protein antigens is low. Recombinant subunit vaccines can be expressed and purified in large quantities in vitro, reducing production costs.

[0023] (3) The present invention lays the foundation for the development of a highly effective subunit vaccine for Haemonchus contortus, provides an effective technical means for the prevention and treatment of the disease, and has important application value and promotion prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Schematic diagram of the construction of the recombinant donor plasmid.

[0025] Figure 2 The PCR identification results of Bacmid.

[0026] Figure 3 The Western-bolt identification results of each virus liquid supernatant are shown.

[0027] Figure 4 The SDS-PAGE electrophoresis images of the recombinant protein.

[0028] Figure 5 This is the mass spectrum of N-glycans released by PNGase F digestion of the recombinant protein.

[0029] Figure 6 Immunization and pest control procedures for animal experiments.

[0030] Figure 7 These are the results of counting Haemonchus contortus eggs in goat feces after immunization with subunit vaccine.

[0031] Figure 8 is the specific antibody level in goat serum of each group.

[0032] Figure 9 These are Western-blot images of goat serum antibodies in the immunized group and serum antibodies in the control group with the recombinant protein, respectively. DETAILED DESCRIPTION

[0033] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0034] Example 1: Expression of Galactosylation-Modified Antigenic Proteins of Haemonchus contortus MEP3, AP1, AP8, H11-2, H11-4, and AP5

[0035] 1. Construction of recombinant donor plasmid

[0036] The glycosyltransferase HcGALT or related antigen protein in the present invention is a truncated protein fragment designed based on the sequence published in GenBank (HcGALT: CDJ84420.1, MEP3: AAC31568.1, AP1: AML39755.1, AP8: XGW06241.1, H11-2: CAB57358.1, H11-4: CAC39009.1, AP5: AML39759.1): HcGALT protein 27- 442AAs (glycosyltransferase HcGALT), MEP3 protein 30-837AAs (antigen protein MEP3), AP1 protein 36-971AAs (antigen protein AP1), AP8 protein 74-978AAs (antigen protein AP8), H11-2 protein 36-972AAs (antigen protein H11-2), H11-4 protein 36-971AAs (antigen protein H11-4), AP5 protein 36-973AAs (antigen protein AP5). The nucleotide sequences encoding each protein fragment were codon optimized. The optimized nucleotide sequence encoding 27-442AAs of HcGALT protein is shown in SEQ ID NO.8, the optimized nucleotide sequence encoding 30-837AAs of MEP3 protein is shown in SEQ ID NO.9, the optimized nucleotide sequence encoding 36-971AAs of AP1 protein is shown in SEQ ID NO.10, the optimized nucleotide sequence encoding 74-978AAs of AP8 protein is shown in SEQ ID NO.11, the optimized nucleotide sequence encoding 36-972AAs of H11-2 protein is shown in SEQ ID NO.12, the optimized nucleotide sequence encoding 36-971AAs of H11-4 protein is shown in SEQ ID NO.13, and the optimized nucleotide sequence encoding 36-973AAs of AP5 protein is shown in SEQ ID NO.14.

[0037] (1) The Kozak sequence, SIP signal peptide, and Flag tag were inserted into the N-terminus of the HcGALT protein 27-442AAs. Pujian Biotechnology (Wuhan) Technology Co., Ltd. was commissioned to synthesize the Kozak sequence-SIP signal peptide coding sequence-Flag tag coding sequence-optimized HcGALT protein 27-442AAs coding sequence. The synthesized sequence was inserted between the XhoI and KpnI sites of pFastBacDual to construct the pFastBacDual-Hcgalt plasmid.

[0038] Kozak sequence-SIP signal peptide coding sequence-Flag tag coding sequence-optimized HcGALT protein 27-442AAs coding sequence is:

[0039] GCCGCCACCATGAAAACTATTATCGCCTTGTCTTATATATTCTGCCTTGTTTTTGCGGCCGGGGGCTCGGATTACAAGGATGATGATGATAAAGGGTCA (SEQ ID NO. 16) - the sequence shown in SEQ ID NO. 8.

[0040] (2) Kozak sequence, SIP signal peptide, Flag tag and 10×His tag were inserted into the N-terminus of MEP3 protein 30-837AAs, AP1 protein 36-971AAs, AP8 protein 74-978AAs, H11-4 protein 36-971AAs and AP5 protein 36-973AAs, respectively. Pujian Biotechnology (Wuhan) Technology Co., Ltd. was commissioned to synthesize the relevant sequences, which were inserted between the BamHI and EcoRI sites of the pFastBacDual-Hcgalt plasmid to construct the pFastBacDual-Hcgalt-MEP3, pFastBacDual-Hcgalt-AP1, pFastBacDual-Hcgalt-AP8, pFastBacDual-Hcgalt-H11-4 and pFastBacDual-Hcgalt-AP5 plasmids.

[0041] A Kozak sequence, SIP signal peptide, and 10×His tag were inserted into the N-terminus of the H11-2 protein 36-972AAs. Pujian Biotechnology (Wuhan) Technology Co., Ltd. was commissioned to synthesize the Kozak sequence-SIP signal peptide coding sequence-10×His tag coding sequence-optimized H11-2 protein 36-972AAs coding sequence. The synthesized sequence was inserted between the BamHI and EcoRI sites of the pFastBacDual-Hcgalt plasmid to construct the pFastBacDual-Hcgalt-H11-2 plasmid.

[0042] Among them, the Kozak sequence-SIP signal peptide coding sequence-Flag tag coding sequence-10×His tag coding sequence-optimized MEP3 protein 30-837AAs coding sequence is:

[0043] GCCGCCACCATGAAGACCATCATCGCCCTCTCATACATCTTTTGCCTCGTGTTCGCCGCCGGCGGCAGCGACTACAAGGACGACGACGACAAGGGTAGCCACCACCATCACCACCATCACCACCACCACGGTAGC (SEQ ID NO. 17) - the sequence shown in SEQ ID NO. 9.

[0044] The Kozak sequence-SIP signal peptide coding sequence-Flag tag coding sequence-10×His tag coding sequence-optimized AP1 protein 36-971AAs coding sequence is:

[0045] GCCGCCACCATGAAAACAATAATAGCGCTGAGCTATATATTCTGCCTCGTGTTTGCCGCCGGCGGTTCTGATTATAAAAGATGACGACGACAAGGGTTCTCATCACCACCACCATCATCATCATCATCATGGTTCT (SEQ ID NO. 18) - the sequence shown in SEQ ID NO. 10.

[0046] Kozak sequence-SIP signal peptide coding sequence-Flag tag coding sequence-10×His tag coding sequence-optimized AP8 protein 74-978AAs coding sequence is:

[0047] GCCGCCACCATGAAGACTATAATCGCTCTCGTATATTTTTTGCCTGGTCTTTCGCCGCAGGTGGGTCGGATTATAAGGATGACGATGACAAAGGATCACACCATCATCATCACCATCATCACCATCACGGAAGT (SEQ ID NO. 19) - the sequence shown in SEQ ID NO. 11.

[0048] Kozak sequence-SIP signal peptide coding sequence-Flag tag coding sequence-10×His tag coding sequence-optimized H11-4 protein 36-971AAs coding sequence is:

[0049] GCCGCCACCATGAAGACAATCATTGCACTGAGTTACATATTCTGTCTCGTCTTCGCAGCTGGTGGTTCGGACTACAAAGACGACGACGATAAAGGAAGTCATCACCACCACCACCACCACCATCATCATGGGAGC (SEQ ID NO. 20) - the sequence shown in SEQ ID NO. 13.

[0050] Kozak sequence-SIP signal peptide coding sequence-Flag tag coding sequence-10×His tag coding sequence-optimized AP5 protein 36-973AAs coding sequence is:

[0051] GCCGCCACCATGAAAACTATAATTGCTCTTAGTTACATCTTCTGTCTTGTGTTCGCGGCCGGAGGCTCAGATTACAAGGACGATGACGATAAAGGGTCCCACCACCATCATCATCACCATCATCATCATGGGTCG (SEQ ID NO. 21) - the sequence shown in SEQ ID NO. 14.

[0052] The Kozak sequence-SIP signal peptide coding sequence-10×His tag coding sequence-optimized H11-2 protein 36-972AAs coding sequence is:

[0053] GCCGCCACCATGAAAACTATCATAGCATTGTCGTACATATTCTGCCTCGTTTTCGCCGCAGGTGGTTCCCATCATCACCACCACCATCACCACCATCACGGATCG (SEQ ID NO. 22) - the sequence shown in SEQ ID NO. 12.

[0054] The schematic diagram of the construction of the above recombinant plasmid is as follows Figure 1 shown.

[0055] 2. Construction of recombinant Bacmid (baculovirus plasmid)

[0056] (1) Thaw DH10Bac competent cells on ice.

[0057] (2) Add 200 ng of pFastBacDual-Hcgalt-MEP3, pFastBacDual-Hcgalt-AP1, pFastBacDual-Hcgalt-AP8, pFastBacDual-Hcgalt-H11-2, pFastBacDual-Hcgalt-H11-4, and pFastBacDual-Hcgalt-AP5 plasmids to the competent cells, gently tap the tube wall to mix, and let it stand on ice for 30 minutes. Then, place it in a 42°C water bath for heat shock for 60 seconds.

[0058] (3) Quickly transfer to an ice bath and cool for 2 minutes. Then, add 500 μL of sterile LB medium without antibiotics to the EP tube, mix well, and incubate at 37°C and 220 rpm for 4 hours.

[0059] (4) Perform 10-fold serial dilution with LB medium, and spread 100 μL of the 100-fold diluted bacterial solution on an LB plate containing 50 mg / mL kanamycin, 7 mg / mL gentamicin, 10 mg / mL tetracycline, 100 mg / mL X-gal, and 40 mg / mL IPTG. Place the plate upside down in a 37°C incubator and culture for 48 h.

[0060] (5) Select a single white colony and inoculate it on an LB plate containing 50 mg / mL kanamycin, 7 mg / mL gentamicin, 10 mg / mL tetracycline, 100 mg / mL X-gal, and 40 mg / mL IPTG. Place the plate upside down in a 37°C incubator and incubate for 24 hours. The colonies that grow are all white colonies.

[0061] 3. Recombinant Bacmid Extraction and Identification

[0062] The above white single colony was inoculated into LB liquid medium containing 50 mg / mL kanamycin, 7 mg / mL gentamicin, and 10 mg / mL tetracycline. The culture was shaken at 37°C and 220 rpm for 12-16 hours. The bacterial liquid was collected and the bacmid was extracted using the Biyuntian Baculovirus Shuttle Vector Bacmid Mini-Amount Extraction Kit. PCR amplification was performed according to the primer sequences in Table 1. The product electrophoresis results were as follows: Figure 2 As shown, it shows that a fragment consistent with the size of the target fragment was successfully amplified and sequenced correctly, proving that the recombinant bacmid was successfully constructed.

[0063] Table 1 PCR primers for identification of recombinant plasmids

[0064] Primer name Primer sequences M13-Forward 5'-TGTAAAACGAGCGGCCAGT-3' (SEQ ID NO.23) M13-Reserve 5'-CAGGAAACAGCTATGACC-3' (SEQ ID NO.24)

[0065] 4. Transfection of recombinant bacmid into Sf9 cells for virus packaging

[0066] (1) Culture of Sf9 insect cells: Sf9 cells are semi-adherent cell lines that can be cultured in suspension. The optimal culture temperature is 27°C-28°C, and CO2 is not required during growth. They grow quickly and the subculture time is about 3 days.

[0067] (2) Count the cultured Sf9 cells and take about 1×10 6 Sf9 cells were plated in a six-well plate and allowed to rest in a cell culture incubator for 20-40 minutes to allow the cells to adhere to the wall.

[0068] (3) Prepare plasmid and transfection agent: Take two sterile EP centrifuge tubes, add 100 μL cell culture medium Sf-900TM SFM and 8 μL transfection agent Cellfectin to one, and add 100 μL cell culture medium Sf-900TM SFM and 3 μg bacmid (volume about 2 μL) to the other. Let it stand for 5 minutes, then mix well and let it stand for another 30 minutes.

[0069] (4) After the cells are completely attached to the wall, tilt the six-well plate, aspirate the culture medium along the wall of the well, then add 800 μL of Sf-900TM SFM culture medium along the wall of the well, and then add 210 μL of mixed Bacmid and transfection agent.

[0070] (5) After covering the six-well plate, mark the experimental group, negative control, and blank control, and place it in the incubator for 4 hours to allow the baculovirus to successfully transfect the Sf9 insect cells.

[0071] (6) After 4 hours, tilt the six-well plate, aspirate the culture medium along the wall of the well, and then add complete culture medium (Sf-900TM SFM culture medium containing 10% fetal bovine serum) along the wall of the well. After sealing the film, place the plate in the incubator and culture for 96 hours until the cells show typical signs of viral infection, the cell diameter becomes larger, the cells become brighter and rounder, indicating that the transfection is successful. The P0 generation recombinant baculovirus P0-rBV-Hcgalt-MEP3, P0-rBV-Hcgalt-AP1, P0-rBV-Hcgalt-AP8, P0-rBV-Hcgalt-H11-2, P0-rBV-Hcgalt-H11-4, and P0-rBV-Hcgalt-AP5 are packaged and the supernatant is collected as the virus solution containing the P0 generation recombinant baculovirus.

[0072] 5. P1, P2, and P3 generation virus amplification

[0073] Prepare Sf9 cells in exponential growth phase at a density of 2 × 10 6 cells / mL, inoculate the P0 recombinant baculovirus solution with the virus at a ratio of 1:30, culture for 4-5 days, and collect the virus by centrifugation. The supernatant is the P1 recombinant baculovirus. Similarly, amplify the P2 and P3 recombinant baculoviruses.

[0074] 6. Protein expression verification

[0075] Prepare exponentially growing High Five (Hi-5) cells at a density of 2 × 10 6cells / mL, P3 recombinant baculovirus was used to infect Hi-5 cells at a multiplicity of infection (MOI) of 0.1, and the cells were cultured at 28°C and 120 rpm for 96 h, and the supernatant was collected by centrifugation. Protein expression was detected by western blot using an anti-His mouse monoclonal antibody as the primary antibody and an HRP-goat anti-mouse secondary antibody as the secondary antibody. Figure 3 As shown, all proteins were successfully expressed in Hi-5 cells.

[0076] 7. Protein purification

[0077] The purification of recombinant proteins is mainly carried out through the His tag on the target protein. The galactose glycosyltransferase HcGALT functions in the virus liquid to transfer the galactose residue to the N-glycosylation modification of the target protein. Because it does not carry a His tag, it will not bind to the filler and will not appear in the eluate. Finally, the galactosyl modified target proteins Gal-rMEP3, Gal-rAP1, Gal-rAP8, Gal-rH11-2, Gal-rH11-4, and Gal-rAP5 ( Figure 4 The concentration of the purified target protein was determined by BCA assay.

[0078] 8. Preparation of N-glycans and MALDI-ToF analysis of protein samples

[0079] The workflow for N-glycan preparation includes enzymatic cleavage, enrichment, and permethylation derivatization of glycans. The specific steps for processing each protein sample are as follows:

[0080] (1) Treatment of protein samples: Take 200 μg of the target protein purified above, add methanol, sterile water and chloroform in the ratio of methanol: water: chloroform = 600 μL: 600 μL: 150 μL, blow and mix with the pipette tip and vortex, at this time the sample solution is milky white; the sample solution is centrifuged at 10000 r / min for 3 min, a white flocculent film appears in the middle of the solution, and the supernatant is discarded; add 500 μL of methanol to wash the protein film, blow and vortex with the pipette tip to mix, centrifuge at 12000 r / min for 3 min, discard the supernatant and retain the precipitate, and place the precipitate sample in a vacuum rotary evaporator for about 30 min.

[0081] (2) PNGase F cleavage and enrichment of glycans: Use the PNGase F deglycosylation kit from Beyotime to add 2 μL of 10×Denaturing Buffer and 18 μL of ddH2O to the evaporated protein sample. Vortex thoroughly and then boil at 100°C for 10 min to denature. After denaturation, immediately place on ice for 1 min to pre-cool. Then, add 4 μL of 10×Reaction Buffer, 4 μL of 10×Renaturing Buffer and 12 μL of ddH2O in sequence. Vortex thoroughly and mix thoroughly before adding 2 μL of PNGaseF enzyme. Vortex thoroughly and incubate at 37°C for 1-4 hours.

[0082] (3) The glycans released by PNGase F were desalted and purified using a porous graphite carbon column (PGC column). The specific steps were as follows: first, the PGC column was activated with 3 mL of acetonitrile and 3 mL of cleaning solution, and then the PGC column was equilibrated with 3 mL of equilibration solution. Next, the sample diluted with the equilibration solution was loaded onto the PGC column. After the sample in the PGC column settled naturally by gravity, it was rinsed three times with 3 mL of equilibration solution to remove impurities such as proteins, peptides, and salts. Finally, the sample was eluted with 1 mL of eluent and dried using a vacuum rotary evaporator.

[0083] (4) Full methylation derivatization of glycans: The glycan sample released by PNGase F was dissolved in 50 μL dimethyl sulfoxide (DMSO), and then added to 100 μL DMSO-NaOH slurry and mixed thoroughly; then 50 μL iodomethane was added in a fume hood and vortexed for 15 min at room temperature until the solution turned milky white; then 500 μL ultrapure water was added to terminate the reaction, and 250 μL chloroform was added for extraction; after the liquid phases were separated, the upper layer was gently removed, and the lower organic phase containing glycans was thoroughly washed with 1 mL ultrapure water, and the washing was repeated 5 times. Finally, the two organic phases were transferred to a new centrifuge tube and dried on a vacuum rotary evaporator.

[0084] MALDI-ToF analysis, the specific steps are as follows:

[0085] (1) Dissolve the evaporated fully methylated derivatized glycans in 15 μL of methanol solution.

[0086] (2) Take 1 μL of polysaccharide solution and mix thoroughly with 1 μL of DHB (2,5-dihydroxybenzoic acid).

[0087] (3) Take 1 μL of the sample to be tested and spot it on the MALDI metal plate, and let it stand at room temperature to allow it to crystallize.

[0088] (4) The samples were then detected using SCIEX's MALDI 5800 ToF / ToF instrument. The instrument parameters were set as follows: detection mode, positive ion reflector mode (Reflector Positive); acceleration voltage 20 kV; laser intensity 5000; 2 kV collision energy, air as CID gas for MS / MS analysis; each spectrum consisted of 1000 shots.

[0089] (5) The final data were analyzed by Data Explorer 4.0 software, and the inferred N-glycan structure was obtained by GlycoWorkbench 2.1 software. The N-glycan spectrum results of the recombinant protein are as follows Figure 5 As shown, the glycan samples separated from Gal-rMEP3, Gal-rAP1, Gal-rAP8, Gal-rH11-2, Gal-rH11-4 and Gal-rAP5 proteins all have an ion peak of m / z 1550.0 (±0.4) ( Figure 5 The size of the glycan structure (indicated by the arrow) is represented by the addition of a galactose structure to the glycan structure with an ion peak of m / z 1345.7, indicating that the galactose glycosyltransferase HcGALT successfully functions to transport galactose to α1,6-fucose.

[0090] Example 2: Immune protection experiment of Haemonchus contortus antigen protein combination

[0091] The six proteins purified above were mixed for goat immune protection experiments, and an adjuvant control group and an immune group were set up, with 5 goats in each group. The animals were examined for feces 5 times before the experiment, and no worm eggs were found. In the experimental group, each goat was immunized with 50 μg of recombinant proteins Gal-rMEP3, Gal-rAP1, Gal-rAP8, Gal-rH11-2, Gal-rH11-4, and Gal-rAP5, combined with 500 μg of Quil-A (saponin) adjuvant. In the control group, each goat was only immunized with 500 μg of Quil-A adjuvant. All goats were immunized by multiple subcutaneous injections on the back of the neck, once every three weeks, for three immunizations, with the fourth immunization and the third immunization separated by two weeks, for a total of four immunizations. At the third immunization, all goats were orally infected with 7,000 infective third-stage larvae of the contorted Haemonchus contortus. Starting from the first immunization, blood samples were collected every 7 days, and a total of 11 serum samples were collected. Changes in goat serum antibody levels were detected by indirect ELISA. The overall plan of the animal experiment is as follows. Figure 6 As shown, starting from the 18th day after the challenge, fecal samples were collected through rectal differentiation at intervals of 1 day and fecal egg counts (FEC) were performed to determine the number of eggs per gram of feces of goats. The samples were collected six times in total, and the egg reduction rate was calculated as (egg count of the control group - egg count of the immunized group) / egg count of the control group.

[0092] Fecal egg count results are as follows Figure 7 As shown in the data, the egg reduction rate on the 62nd day of the animal experiment was 90.13%, the egg reduction rate on the 64th day was 85.22%, the egg reduction rate on the 66th day was 75.12%, the egg reduction rate on the 68th day was 81.59%, the egg reduction rate on the 70th day was 82.89%, and the cumulative egg reduction rate was 81.43%, which is the best egg reduction effect among all recombinant proteins reported so far.

[0093] The ELISA method was used to dynamically detect the serum specific IgG antibody level of the immune mixed recombinant antigen. The results are as follows Figure 8 As shown in the figure, after the first immunization, the serum IgG antibodies of the goats in the experimental group showed a significant upward trend and reached a peak one week after the second immunization. Thereafter, there was a slight downward trend, but the antibody levels remained at a high level.

[0094] Western-blot results of goat serum antibodies in the immunized group and serum antibodies in the control group with recombinant protein are shown in Figure 9 As shown, compared with the adjuvant control group, specific IgG antibodies against Gal-rMEP3, Gal-rAP1, Gal-rAP8, Gal-rH11-2, Gal-rH11-4, and Gal-rAP5 were detected in the sera of the immunized group, indicating that these six recombinant proteins have good immunogenicity.

[0095] The above embodiments are only used to help illustrate the present invention. The implementation methods of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A Haemonchus contortus antigen protein combination, characterized by: Comprising galactosylation-modified antigenic proteins MEP3, AP1, AP8, H11-2, H11-4, and AP5 of Haemonchus contortus; wherein the galactosylation modification is achieved by expressing the glycosyltransferase HcGALT of Haemonchus contortus together with one or more of the above proteins in eukaryotic cells; The amino acid sequence of the glycosyltransferase HcGALT is shown in SEQ ID NO.1, the amino acid sequence of the antigen protein MEP3 is shown in SEQ ID NO.2, the amino acid sequence of the antigen protein AP1 is shown in SEQ ID NO.3, the amino acid sequence of the antigen protein AP8 is shown in SEQ ID NO.4, the amino acid sequence of the antigen protein H11-2 is shown in SEQ ID NO.5, the amino acid sequence of the antigen protein H11-4 is shown in SEQ ID NO.6, and the amino acid sequence of the antigen protein AP5 is shown in SEQ ID NO.

7.

2. The method for preparing the Haemonchus contortus antigen protein combination according to claim 1, characterized in that: The method comprises the following steps: constructing a nucleotide sequence encoding glycosyltransferase HcGALT and a nucleotide sequence encoding an antigen protein into the same eukaryotic expression vector or two eukaryotic expression vectors, transfecting the constructed eukaryotic expression vector into eukaryotic cells, culturing the cells to express the HcGALT protein and the antigen protein, and subjecting the antigen protein to galactosylation modification, and obtaining the galactosylation-modified antigen protein through purification.

3. The method for preparing the Haemonchus contortus antigen protein combination according to claim 2, characterized in that: A signal peptide is connected to the N-terminus of the glycosyltransferase HcGALT or the antigen protein, and a tag is connected to the N-terminus or C-terminus of the antigen protein.

4. The method for preparing the Haemonchus contortus antigen protein combination according to claim 2, characterized in that: The following steps are involved: The optimized and modified nucleotide sequence encoding glycosyltransferase HcGALT was constructed into pFastBacDual to obtain the recombinant plasmid pFastBacDual-Hcgalt, and the optimized and modified nucleotide sequence encoding antigen protein was constructed into pFastBacDual-Hcgalt to obtain the recombinant plasmid pFastBacDual-Hcgalt-MEP3 or pFastBacDual-Hcgalt-AP1 or pFastBacDual-Hcgalt-AP8 or pFastBacDual-Hcgalt-H11-2 or pFastBacDual-Hcgalt-H11-4 or pFastBacDual-Hcgalt-AP5, and the recombinant bacmid rbacmid-Hcgalt-MEP3 or rbacmid-Hcgalt-AP1 or rbacmid-Hcgalt-AP8 or rbacmid-Hcgalt-H11-2 or rbacmid-Hcgalt-H11-4 or rbacmid-Hcgalt-AP5 were transfected into Sf9 cells and packaged to obtain recombinant baculovirus rBV-Hcgalt-MEP3 or rBV-Hcgalt-AP1 or rBV-Hcgalt-AP8 or rBV-Hcgalt-H11-2 or rBV-Hcgalt-H11-4 or rBV-Hc galt-AP5, the target protein is expressed by infecting Hi5 cells with recombinant baculovirus rBV-Hcgalt-MEP3 or rBV-Hcgalt-AP1 or rBV-Hcgalt-AP8 or rBV-Hcgalt-H11-2 or rBV-Hcgalt-H11-4 or rBV-Hcgalt-AP5, and galactosylated MEP3 or AP1 or AP8 or H11-2 or H11-4 or AP5 is obtained by purification; The optimized and modified nucleotide sequence encoding glycosyltransferase HcGALT is shown as SEQ ID NO.8, the optimized and modified nucleotide sequence encoding antigen protein MEP is shown as SEQ ID NO.9, the optimized and modified nucleotide sequence encoding antigen protein AP1 is shown as SEQ ID NO.10, the optimized and modified nucleotide sequence encoding antigen protein AP8 is shown as SEQ ID NO.11, the optimized and modified nucleotide sequence encoding antigen protein H11-2 is shown as SEQ ID NO.12, the optimized and modified nucleotide sequence encoding antigen protein H11-4 is shown as SEQ ID NO.13, and the optimized and modified nucleotide sequence encoding antigen protein AP5 is shown as SEQ ID NO.

14.

5. The method for preparing the Haemonchus contortus antigen protein combination according to claim 4, characterized in that: The N-terminus of the glycosyltransferase HcGALT or antigen protein is connected to a Kozak sequence, a signal peptide sequence and a tag sequence.

6. The method for preparing the Haemonchus contortus antigen protein combination according to claim 5, characterized in that: The signal peptide sequence is MKTIIALSYIFCLVFAAG, the tag is one or both of a Flag tag and a 10×His tag, and the signal peptide, the tag, and the antigen protein are connected via a flexible linker.

7. Use of the Haemonchus contortus antigen protein combination according to claim 1 in the preparation of a Haemonchus contortus vaccine.

8. A subunit vaccine for Haemonchus contortus, characterized by: Comprising the Haemonchus contortus antigen combination according to claim 1.

9. The subunit vaccine of Haemonchus contortus according to claim 8, characterized in that: An adjuvant is also included.

Images