Single-chain antibody against pathogenic Leptospira, preparation method and application

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to single-chain antibodies against pathogenic Leptospira, preparation methods and applications. Phage display technology is used to construct an immune library by immunizing rabbit spleens with Leptospira. After five rounds of solid-phase panning with decreasing antigen concentrations, ELISA identification and sequencing analysis, specific single-chain antibodies are screened. The host bacteria switching expression process is optimized to achieve efficient preparation of soluble single-chain antibodies. The antibodies have high sensitivity in sandwich ELISA detection and do not cross-react with common pathogens. In animal model treatment, the cocktail combination significantly improves the survival rate of infected golden hamsters and reduces the leptospira load in the kidneys, providing an innovative solution for the development of diagnostic reagents, antigen epitope identification and targeted treatment of leptospirosis.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, specifically relates to genetic engineering antibody technology, and in particular to single-chain antibodies against pathogenic Leptospira, and preparation methods and applications thereof. Background Art

[0002] Pathogenic Leptospira (hereinafter referred to as "Leptospira") is the pathogen that causes leptospirosis (leptospirosis), which can infect humans and animals. Leptospirosis is classified as a Category B infectious disease. The pathogen is transmitted through contact with contaminated water or animal urine and can cause multi-organ damage, with a mortality rate of up to 30% in severe cases (WHO, 2022). Although leptospirosis causes approximately one million cases and 60,000 deaths annually worldwide, its early symptoms are nonspecific (e.g., fever, myalgia) and its complex serotypes (over 300 identified) pose significant challenges to clinical diagnosis and treatment.

[0003] The primary reservoirs of leptospirosis are rodents, livestock, and bats. Among rodents, rats (such as the black-striped field mouse and the yellow-breasted rat) are the primary natural hosts, carrying the bacteria for months to years, and continuously excreting bacteria in their urine, contaminating the environment. Among livestock, pigs, dogs, and cattle are important sources of infection. Pigs, in particular, carry bacteria that are highly consistent with human strains, produce large amounts of urine, and contaminate a wide range of areas. Over 90% of leptospirosis cases are acquired through contact with rice paddies, floodwater, or stagnant water contaminated by animal urine.

[0004] The existing technology for leptospirosis diagnosis, the microscopic agglutination test (MAT), is the gold standard for diagnosis. It requires live bacteria and has low sensitivity (<50% early positive rate), posing a biosafety risk (Costa et al., 2015).

[0005] Existing ELISA kits often rely on whole-bacterial antigens or traditional monoclonal antibodies (such as anti-LipL32 monoclonal antibodies). However, these tests have high cross-reactivity rates (especially with nonpathogenic leptospires) and cannot distinguish active infection from prior exposure (Haake et al., 2020). Treatment options for leptospirosis are limited. Penicillin or doxycycline are the preferred drugs, but these drugs are prone to triggering the Herxheimer reaction, and drug-resistant strains are increasing annually (Suepaul et al., 2016), leading to antibiotic dependency. Vaccine development is lagging behind, with inactivated vaccines only effective against homologous serotypes and a short duration of protection (<1 year), making them inadequate for coping with multi-serotype epidemics (Adler, 2020).

[0006] There are gaps in the application of antibody technology for leptospirosis. Research on monoclonal antibodies (mAbs) has reported mouse-derived mAbs against leptospirosis membrane proteins (such as LipL32), but their large molecular weight (150 kDa) and poor tissue penetration make them difficult to use in targeted therapies (Narayanavari et al., 2017). Single-chain fragment variable (scFv) antibodies are genetically engineered antibodies with advantages such as small molecular weight, strong penetration, and ease of genetic engineering. In recent years, they have been widely used in various fields, including immunodiagnosis, antiviral therapy, and targeted therapy. scFvs are primarily produced through phage display technology, which does not require cell fusion. The scFv gene can be amplified using simple PCR and can be fused with a phage coat protein gene for expression and display on the phage surface, simplifying manipulation. scFvs (molecular weight approximately 27 kDa) have been used in areas such as anti-Ebola virus therapy. Existing phage display libraries mostly target bacterial toxins (such as anthrax toxin PA) and use mouse or human antibodies. There are no reports on screening leptospira-specific scFv based on rabbit libraries (Li et al., 2019).

[0007] Therefore, antibody drugs for leptospirosis and rapid and convenient diagnostic reagents for non-disease diagnosis and / or treatment purposes are in urgent need of development. Summary of the Invention

[0008] The present invention aims to construct a rabbit-derived immune library through phage display technology, screen for high-affinity scFv, and provide innovative solutions for the precise diagnosis and targeted treatment of leptospirosis.

[0009] In order to achieve the above object, the present invention adopts the following technical solutions:

[0010] In a first aspect, the present invention provides a single-chain antibody against pathogenic Leptospira, the amino acid sequence of which is any one or more of the following:

[0011] (a) the amino acid sequence shown in SEQ ID NO: 1;

[0012] (b) the amino acid sequence shown in SEQ ID NO: 2;

[0013] (c) The amino acid sequence shown in SEQ ID NO: 3.

[0014] In a second aspect, the present invention also provides a nucleic acid encoding the single-chain antibody against pathogenic Leptospira:

[0015] The nucleic acid encodes a single-chain antibody against pathogenic Leptospira as shown in SEQ ID NO: 1, and the nucleotide sequence is shown in SEQ ID NO: 4;

[0016] The nucleic acid encodes a single-chain antibody against pathogenic Leptospira as shown in SEQ ID NO: 2, and the nucleotide sequence is shown in SEQ ID NO: 5;

[0017] The nucleic acid encodes a single-chain antibody against pathogenic Leptospira as shown in SEQ ID NO: 3, and the nucleotide sequence is shown in SEQ ID NO: 6.

[0018] In a third aspect, the present invention also provides a recombinant expression vector comprising any one of the above nucleic acids.

[0019] Furthermore, the backbone of the recombinant expression vector is a plasmid, cosmid, phage or viral vector.

[0020] In a fourth aspect, the present invention further provides a transformant comprising the recombinant expression vector in a host cell.

[0021] Furthermore, the host cell is selected from yeast cells, mammalian cells or other cells suitable for preparing antibodies.

[0022] In a fifth aspect, the present invention further provides a method for preparing the single-chain antibody against pathogenic Leptospira, which comprises culturing the transformant and obtaining the single-chain antibody against pathogenic Leptospira from the culture.

[0023] In a sixth aspect, the present invention also provides a pharmaceutical composition comprising one or more of the single-chain antibody shown in SEQ ID NO: 1, the single-chain antibody shown in SEQ ID NO: 2, and the single-chain antibody shown in SEQ ID NO: 3, and a pharmaceutically acceptable carrier.

[0024] Furthermore, the pharmaceutical composition comprises the single-chain antibody shown in SEQ ID NO: 1, the single-chain antibody shown in SEQ ID NO: 2, and the single-chain antibody shown in SEQ ID NO: 3.

[0025] Furthermore, the molar ratio of the single-chain antibody shown in SEQ ID NO: 1, the single-chain antibody shown in SEQ ID NO: 2, and the single-chain antibody shown in SEQ ID NO: 3 is 1:1:1.

[0026] Furthermore, the pharmaceutical composition is administered by intraperitoneal injection, and the single dosage is 10 mg / kg-20 mg / kg body weight.

[0027] Furthermore, the pharmaceutical composition is used to reduce the leptospira load in the kidneys of infected animals, and the survival rate is increased to more than 80%.

[0028] In a seventh aspect, the present invention further provides a kit comprising the single-chain antibody, the nucleic acid, the recombinant expression vector, the transformant or the pharmaceutical composition.

[0029] Furthermore, the kit also includes a reagent for detecting the binding of the single-chain antibody to pathogenic Leptospira.

[0030] Furthermore, the kit is an ELISA detection kit.

[0031] In an eighth aspect, the present invention further provides use of the single-chain antibody, the nucleic acid, the recombinant expression vector, the transformant, the pharmaceutical composition or the kit in the preparation of a drug for diagnosing, preventing and / or treating leptospirosis.

[0032] More preferably, the leptospirosis is caused by Leptospira icterohaemorrhagiae.

[0033] In a ninth aspect, the present invention further provides a method for detecting pathogenic Leptospira in a sample, comprising contacting the single-chain antibody with the sample to be detected, and determining the binding of the single-chain antibody to the sample to be detected by ELISA or immunofluorescence to determine whether the sample contains pathogenic Leptospira. The method is for non-disease diagnosis and / or treatment purposes.

[0034] Beneficial Effects: The present invention constructs a rabbit-derived immune library using phage display technology, and obtains three strains of scFv with high affinity against pathogenic Leptospira through 3 to 5 rounds of solid-phase panning screening. The amino acid sequences are shown in SEQ ID NOs: 1-3. The invention also covers the use of the above-mentioned scFv in sandwich ELISA detection of Leptospira pathogens, as well as methods for treating infected animal models by combining scFv antibody cocktails, significantly reducing the renal Leptospira load and improving survival rates. The scFv antibody body is composed of a heavy chain variable region, a light chain variable region, and a connecting region. In addition, a protein tag is added to facilitate subsequent purification and other applications. The scFv can bind to Leptospira with high affinity, providing materials for the development of diagnostic reagents for leptospirosis, providing ideas for identifying leptospira antigen epitopes and vaccine design, and also providing a pharmaceutical basis for the treatment of leptospirosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments described in the present invention, and those skilled in the art can also obtain other drawings based on these drawings.

[0036] Figure 1 Flowchart for library construction and screening for expression of specific scFv.

[0037] Figure 2This is a diagram showing the specificity of scFv phage to Leptospira detected by phage-ELISA in Example 1.

[0038] Figure 3 This is a sequence comparison diagram of the three scFv strains in Example 1.

[0039] Figure 4 This is an SDS-PAGE image of the three scFv strains in Example 2, wherein: 1, scFv-1 whole cell lysate; 2, scFv-1 periplasmic expression solution; 3, scFv-1 supernatant expression solution; 4, scFv-6 whole cell lysate; 5, scFv-6 periplasmic expression solution; 6, scFv-6 supernatant expression solution; 7, scFv-36 whole cell lysate; 8, scFv-36 periplasmic expression solution; 9, scF-36 supernatant expression solution.

[0040] Figure 5 This is a WB identification image of the three purified scFv strains in Example 2.

[0041] Figure 6 This is a graph showing the results of ELISA testing the affinity of soluble scFv antibodies to Leptospira in Example 2.

[0042] Figure 7 This is a diagram showing the results of establishing a sandwich ELISA to detect Leptospira using scFv antibodies in Example 3.

[0043] Figure 8 This is the result of Example 4: scFv cocktail treatment improves the survival rate of golden hamsters infected with Leptospira.

[0044] Figure 9 This is a diagram of the pathological section results of Case 1 of Example 4.

[0045] Figure 10 This is a graph showing the pathological scoring results for Case 1 of Example 4.

[0046] Figure 11 This is the result of the case 2 of Example 4, in which scFv improved the survival rate of golden hamsters infected with Leptospira. DETAILED DESCRIPTION

[0047] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods and functional components in the following examples, unless otherwise specified, were obtained using conventional methods and routine protocols in the art. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. The following biological materials are all stored in this laboratory and can be distributed to the public for verification experiments.

[0048] New Zealand white rabbits and Syrian golden hamsters were purchased from Liaoning Changsheng Biotechnology Co., Ltd. Leptospira icterohaemorrhagiae was maintained in our laboratory; the phage vector pComb3XSS, host strain XL1-blue, and expression strain HB2151 were purchased from Beijing Baokewei Food Safety Biotechnology Co., Ltd.; the HRP-anti M13 enzyme-labeled antibody was purchased from Beijing Sino Biological Technology Co., Ltd.; and the HR-His monoclonal antibody was purchased from Wuhan Tri-Eagle Biotechnology Co., Ltd.

[0049] The following examples include constructing a rabbit-derived immune library using phage display technology to screen for high-affinity scFvs that specifically target pathogenic Leptospira; utilizing these scFvs to develop a rapid sandwich ELISA-based detection method for Leptospira pathogens; and utilizing scFv cocktail combination therapy to reduce pathogen load in infected hosts and improve survival rates. The examples cover the amino acid sequences (SEQ ID NOs: 1-3), encoding genes (SEQ ID NOs: 4-6), library construction techniques, and medical applications in the prevention and control of leptospirosis.

[0050] Example 1: scFvs of SEQ ID NOs: 1-3 were obtained through five rounds of panning of a rabbit-derived phage library.

[0051] 1. A method for constructing a phage display library against pathogenic Leptospira, comprising the following steps:

[0052] (a) New Zealand white rabbits were immunized with Leptospira icterohaemorrhagiae, and total spleen RNA was extracted and reverse transcribed into cDNA.

[0053] (b) Using cDNA as a template, the antibody heavy chain variable region (VH) and light chain variable region (VL) were amplified by PCR and spliced ​​into scFv gene fragments using a flexible linker peptide (Gly4Ser)3;

[0054] (c) The scFv target fragment was linked to the pComb3XSS phagemidase to obtain pComb3XSS-scFvs; pComb3XSS-scFvs was electroporated into competent cells to construct an anti-pathogenic Leptospira scFv immune library; the restriction enzyme cleavage site was sfiI.

[0055] 2. Screening of scFv immune library.

[0056] The scFv immune library was amplified and the primary phage scFv library was obtained by superinfection with VCSM13-assisted phage. The leptospira fragment protein coated on a solid phase carrier was used as the antigen and the library was enriched through five rounds of solid phase screening. After each round of panning, the phage binding signal was detected by phage-ELISA to screen the enriched library. Single colonies were picked from the output plate of the last round of panning to prepare phage antibody supernatant. HRP-anti M13 was used as the enzyme-labeled secondary antibody. After phage-ELISA identification, the top 10 OD450 values ​​were selected for sequencing. The results are as follows. Figure 2 As shown; 10 scFv strains were sent to the company for sequencing, successfully translated by snapgene software and subjected to IGMT Blast analysis. Combined with the phage-ELISA results, M13-1, M13-6, and M13-36 were finally selected for subsequent expression studies. The sequence alignment results of the three strains are shown in Figure 3 Three scFv gene sequences were obtained: the amino acid sequence of the scFv-1 antibody is shown in SEQ ID NO: 1, the amino acid sequence of the scFv-6 antibody is shown in SEQ ID NO: 2, and the amino acid sequence of the scFv-36 antibody is shown in SEQ ID NO: 3. The connecting peptide sequence in the scFv is shown in SEQ ID NO: 9. The nucleotide sequence encoding the scFv-1 antibody is shown in SEQ ID NO: 4. The nucleotide sequence encoding the scFv-6 antibody is shown in SEQ ID NO: 5. The nucleotide sequence encoding the scFv-36 antibody is shown in SEQ ID NO: 6.

[0057] Example 2: Expression of scFv antibody.

[0058] The identified antibody gene was expressed in E. coli strain HB2151 through host replacement, and whole cell lysate, periplasmic expression solution, and supernatant expression solution were prepared; the abundance of soluble antibody expression in different parts was identified by ELISA. Specifically:

[0059] 1. Transfer the phage vector carrying the scFv gene to the soluble expression E. coli strain HB2151, and prepare whole cell lysate, periplasmic expression solution, and supernatant expression solution. The specific steps are as follows:

[0060] Find the corresponding prepared phage antibody supernatant, aspirate 10 μL and add it to 990 μL of the prepared HB2151 host bacteria, and mark it; incubate at 37°C with gentle intermittent shaking for 1 hour to help the phage infect the host bacteria;

[0061] The culture medium was streaked onto SOBG-AN plates (containing 100 μg / mL amp, 100 μg / mL N, and 2% glucose) and cultured at 30°C overnight.

[0062] Pick 3-5 single colonies and inoculate 6 mL of 2×YT-AN liquid medium. Incubate with shaking at 250 rpm and 37°C for 3 h. Take 1 μL of the bacterial solution for PCR and shake the remaining bacterial solution overnight. Primer sequences:

[0063] The sequence of pComb3XSS-F1 is shown in SEQ ID NO: 7: AAGACAGCTATCGCGATTGCAG;

[0064] The sequence of pComb3XSS-R1 is shown in SEQ ID NO: 8: GCCCCCTTATTAGCGTTTGCCATC.

[0065] Take 5 mL of the overnight bacterial liquid that was successfully infected with the correct PCR band size and inoculate it into 50 mL of 2×YT-AG (containing 100 μg / mLamp, 2% glucose) medium, and culture it at 37°C, 250 rpm, and shake it until OD600 = 0.8 (about 1 hour). Add IPTG inducer to make its final concentration 0.2 mM, and shake and induce the culture overnight at 16°C constant temperature shaker 180 rpm.

[0066] The next day, the culture medium was divided into two parts, centrifuged at 3000g for 20 minutes at room temperature, and the two centrifugal supernatants were collected respectively. This was the expression supernatant. The supernatant expression liquid was obtained by covering with PEG-20000 and placed in a -80℃ refrigerator for later use.

[0067] One of the bacterial precipitates was used to prepare periplasmic soluble antibodies using the TES mild infiltration method and was frozen in a -80°C refrigerator for later use.

[0068] Another bacterial pellet was taken, resuspended in 1 mL of PBS buffer, and whole cell lysate was obtained by ultrasonic disruption, which was then frozen in a -80°C refrigerator for later use.

[0069] 15 μL of the obtained supernatant expression solution, periplasmic expression solution and whole cell lysate were respectively taken and loaded onto a 12% SDS-PAGE gel. After protein separation by electrophoresis, the gel was stained with Coomassie Brilliant Blue staining solution to preliminarily determine whether the solution contained the target protein and to estimate its approximate content. The SDS-PAGE results were as follows: Figure 4 shown.

[0070] 2. Using HRP-anti His as enzyme-labeled secondary antibody, the abundance of soluble antibodies in different parts was identified by ELISA method, such as Figure 6 shown.

[0071] 3. Determine the expression site based on the ELISA and SDS-PAGE results, and then perform large-scale expression of the target protein. Purify the target protein using a purification kit and perform conventional Western Blot identification using the His tag. Figure 5 shown.

[0072] Example 3: scFv was initially applied to sandwich ELISA to detect leptosomes.

[0073] 1. Coating protein: Dilute the scFv antibody solution to 100 μg / mL with carbonate coating solution, coat with 100 μL / well, set up negative and blank controls, and incubate at 4°C overnight.

[0074] 2. Blocking: Wash three times and pat dry, add blocking solution (PBS containing 3% BSA), 250 μL per well, and block at 37°C for 2 hours.

[0075] 3. Add the leptospira to be tested: wash 3 times and pat dry, add the inactivated leptospira to 10 8 / mL gradient dilution to 10 2 / mL and perform detection, 100 μL / well, binding reaction at 37°C for 2 h.

[0076] 4. Add detection antibody: Wash three times and pat dry, add 1:8000 golden hamster positive serum, 100 μL / well, and incubate at 37°C for 1 hour.

[0077] 5. Add enzyme-labeled antibody: Wash three times and pat dry. Dilute different concentrations of HRP-goat anti-hamster 1:4000 and mix evenly. Add 100 μL / well and incubate at 37°C for 1 hour.

[0078] 6. Color development: Wash three times and pat dry, add 100 μL of TMB color development solution to each well, and incubate at 37°C in the dark for about 15 minutes.

[0079] 7. Stop: Add 1M H2SO4 as the stop solution, 100 μL / well to stop color development and read at 450 nm. The sensitivity of the ELISA established using the scFv can be determined based on the test results.

[0080] ELISA results Figure 7 As shown, it can be seen that the three scFvs can specifically bind to Leptospira with high affinity, among which the ELISA established with scFv-6 has higher sensitivity.

[0081] Example 4: Evaluation of the preliminary protective effect of scFv.

[0082] 1. The golden hamsters were grouped and fed with 1×10 6 Hook body.

[0083] In Case 1, the scFv-1, scFv-6, and scFv-36 prepared in Example 1 were mixed at a molar ratio of 1:1:1 to produce therapeutic scFvs. This cocktail antibody therapy was used to verify the protective effect of the combined use of scFv-1, scFv-6, and scFv-36. A control group (normal saline), a 20 mg / kg scFvs treatment group, and a 10 mg / kg scFvs treatment group were established, with 10 mice in each group.

[0084] Case 2: To verify the protective effects of scFv-1, scFv-6, and scFv-36 alone, a control group, a 20 mg / kg scFv-1 treatment group, a 20 mg / kg scFv-6 treatment group, and a 20 mg / kg scFv-36 treatment group were set up, with 10 mice in each group.

[0085] 2. 48 hours after infection with Leptospira icterohaemorrhagiae, the control group received normal saline, while the experimental group received corresponding doses of the two antibodies for five consecutive days. After infection, the hamsters were observed for 28 days, and the time of death was recorded. Pathological sections of the hamsters that survived the 28-day observation period were examined.

[0086] The survival rate results of case 1 are as follows Figure 8 As shown, 48 hours after infection with Leptospira, specific scFvs treatment was performed. During the 28-day observation period, the survival rate of the 20 mg / kg group of the treatment group increased to 100%, which improved the survival rate of golden hamsters compared with the control group.

[0087] The survival rate results of Case 2 are as follows Figure 11 As shown, 48 hours after infection with Leptospira, specific scFv treatment was performed. During the 28-day observation period, the survival rate of the 20 mg / kg scFv-1 group increased to 80%, the survival rate of the 20 mg / kg scFv-6 group increased to 91%, and the survival rate of the 20 mg / kg scFv-36 group increased to 80%, which improved the survival rate of golden hamsters compared with the control group.

[0088] Representative photos of pathological section results of case 1 are as follows Figure 9 As shown, the scale bar is 200 μm. The HE section results of the control group showed that the kidneys were accompanied by local hemorrhage, the liver tissue was accompanied by a large number of inflammatory cell infiltrations, and the lung tissue had pulmonary consolidation accompanied by alveolar congestion.

[0089] The pathological grading results of case 1 are as follows Figure 10 As shown, specific scFvs treatment significantly alleviated the kidney, liver and lung damage caused by Leptospira infection compared with the control group.

[0090] The scFv antibody prepared by the present invention can bind to Leptospira with high affinity, providing materials for the development of diagnostic reagents for leptospirosis, providing ideas for identifying leptospira antigen epitopes, and providing a pharmaceutical basis for the treatment of leptospirosis. An IGBLAST analysis of the sequence showed that the scFv gene sequence was essentially identical to the variable region sequence of the rabbit-derived antibody, confirming that the constructed scFv gene sequence was correct.

[0091] The above-described embodiments are only specific implementation methods of the present application, which are used to illustrate the technical solutions of the present application, rather than to limit them. The scope of protection of the present application is not limited thereto. Although the present application has been described in detail with reference to the above-mentioned embodiments, those skilled in the art should understand that any person skilled in the art can modify or easily conceive of changes to the technical solutions described in the above-mentioned embodiments within the technical scope disclosed in the present application, or perform equivalent replacements for some of the technical features thereof; and these modifications, changes or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present application. They should all be included in the scope of protection of the present application. Therefore, the scope of protection of the present application shall be subject to the scope of protection of the claims.

Claims

1. A single-chain antibody against pathogenic Leptospira, characterized in that: Its amino acid sequence is selected from any one or more of the following: (a) the amino acid sequence shown in SEQ ID NO: 1; (b) the amino acid sequence shown in SEQ ID NO: 2; (c) The amino acid sequence shown in SEQ ID NO:

3.

2. The nucleic acid encoding the single-chain antibody according to claim 1, characterized in that: The nucleic acid encodes the single-chain antibody shown in SEQ ID NO: 1, and the sequence is shown in SEQ ID NO: 4; The nucleic acid encodes the single-chain antibody shown in SEQ ID NO: 2, and the sequence is shown in SEQ ID NO: 5; The nucleic acid encodes the single-chain antibody shown in SEQ ID NO: 3, and the sequence is shown in SEQ ID NO:

6.

3. A recombinant expression vector, characterized in that: Contains one of the nucleic acids as claimed in claim 2.

4. A transformant, characterized in that Comprising the recombinant expression vector as claimed in claim 3.

5. A method for preparing a single-chain antibody against pathogenic Leptospira, characterized in that: The method comprises culturing the transformant according to claim 4 and obtaining a single-chain antibody against pathogenic Leptospira from the culture.

6. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises one or more of the single-chain antibody shown in SEQ ID NO: 1, the single-chain antibody shown in SEQ ID NO: 2, and the single-chain antibody shown in SEQ ID NO: 3, and a pharmaceutically acceptable carrier.

7. The pharmaceutical composition according to claim 6, characterized in that: The pharmaceutical composition comprises the single-chain antibody shown in SEQ ID NO: 1, the single-chain antibody shown in SEQ ID NO: 2, and the single-chain antibody shown in SEQ ID NO:

3.

8. A kit, characterized in that: The kit comprises the single-chain antibody according to claim 1, the nucleic acid according to claim 2, the recombinant expression vector according to claim 3, the transformant according to claim 4 or the pharmaceutical composition according to claim 6.

9. Use of the single-chain antibody according to claim 1, the nucleic acid according to claim 2, the recombinant expression vector according to claim 3, the transformant according to claim 4, the pharmaceutical composition according to claim 6, or the kit according to claim 8 in the preparation of a medicament for diagnosing and / or treating leptospirosis, wherein the leptospirosis is caused by Leptospira icterohaemorrhagiae.

Images